ID: 1037260584

View in Genome Browser
Species Human (GRCh38)
Location 8:17002611-17002633
Sequence GCGGTGATGCTGTTCAGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037260579_1037260584 3 Left 1037260579 8:17002585-17002607 CCCTCTTTGGGGTTGTCCTTGGG No data
Right 1037260584 8:17002611-17002633 GCGGTGATGCTGTTCAGCTGCGG No data
1037260581_1037260584 2 Left 1037260581 8:17002586-17002608 CCTCTTTGGGGTTGTCCTTGGGA No data
Right 1037260584 8:17002611-17002633 GCGGTGATGCTGTTCAGCTGCGG No data
1037260577_1037260584 4 Left 1037260577 8:17002584-17002606 CCCCTCTTTGGGGTTGTCCTTGG No data
Right 1037260584 8:17002611-17002633 GCGGTGATGCTGTTCAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037260584 Original CRISPR GCGGTGATGCTGTTCAGCTG CGG Intergenic
No off target data available for this crispr