ID: 1037262849

View in Genome Browser
Species Human (GRCh38)
Location 8:17027358-17027380
Sequence GTCACCGCAGGCCGCCCCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037262849_1037262866 29 Left 1037262849 8:17027358-17027380 CCGTGGGGGCGGCCTGCGGTGAC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1037262866 8:17027410-17027432 CCTCCCGAGAGGATGAGGAGAGG 0: 1
1: 0
2: 3
3: 41
4: 224
1037262849_1037262853 -5 Left 1037262849 8:17027358-17027380 CCGTGGGGGCGGCCTGCGGTGAC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1037262853 8:17027376-17027398 GTGACCACCCTGGGCCTTCCTGG 0: 1
1: 0
2: 3
3: 23
4: 251
1037262849_1037262855 -1 Left 1037262849 8:17027358-17027380 CCGTGGGGGCGGCCTGCGGTGAC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1037262855 8:17027380-17027402 CCACCCTGGGCCTTCCTGGCCGG 0: 1
1: 1
2: 5
3: 48
4: 379
1037262849_1037262867 30 Left 1037262849 8:17027358-17027380 CCGTGGGGGCGGCCTGCGGTGAC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1037262867 8:17027411-17027433 CTCCCGAGAGGATGAGGAGAGGG 0: 1
1: 0
2: 0
3: 27
4: 284
1037262849_1037262864 24 Left 1037262849 8:17027358-17027380 CCGTGGGGGCGGCCTGCGGTGAC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1037262864 8:17027405-17027427 CTTCTCCTCCCGAGAGGATGAGG 0: 1
1: 0
2: 1
3: 14
4: 219
1037262849_1037262861 18 Left 1037262849 8:17027358-17027380 CCGTGGGGGCGGCCTGCGGTGAC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1037262861 8:17027399-17027421 CCGGCCCTTCTCCTCCCGAGAGG 0: 1
1: 0
2: 0
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037262849 Original CRISPR GTCACCGCAGGCCGCCCCCA CGG (reversed) Exonic
900518793 1:3095809-3095831 GGCACCCCAAGCAGCCCCCAGGG - Intronic
900581605 1:3412465-3412487 GTCACCCCGGGACGCCCTCAAGG + Exonic
900715608 1:4141586-4141608 GTGACCTCAGGCCTGCCCCAGGG + Intergenic
900979340 1:6037422-6037444 ATCACCACAGCCCGTCCCCAGGG - Intronic
902451845 1:16501209-16501231 GCCAGCGCAGGCTGCCCGCAGGG - Intergenic
902734365 1:18390489-18390511 ACCACAGCAGGCCTCCCCCAGGG + Intergenic
902767935 1:18629613-18629635 CTCACCGCTGGCTGGCCCCAGGG - Intergenic
902808888 1:18877287-18877309 GTCACTGCAGGCCGAGACCAAGG + Intronic
904376001 1:30082883-30082905 GTCACTGCAGGGCGGCCCCAGGG + Intergenic
905302888 1:36997657-36997679 GTCACCCCCGGCCCCTCCCAAGG - Intronic
908231742 1:62112217-62112239 GCCACCGCACCCGGCCCCCAAGG - Intronic
910708504 1:90154988-90155010 GTCACAGCAAGCCCCACCCAAGG - Intergenic
912246140 1:107964111-107964133 GAACCCGGAGGCCGCCCCCAGGG - Intronic
916787875 1:168099211-168099233 GTCTCAGCAGGCCACCCACAAGG - Intronic
919780219 1:201216514-201216536 GCCTCCGCTGGCGGCCCCCAAGG + Exonic
924739983 1:246789282-246789304 GTGGCCTCCGGCCGCCCCCAGGG - Intergenic
1064408906 10:15088612-15088634 GTCACCGCCGACCGCTCCCAGGG + Intronic
1065101635 10:22336720-22336742 GTCACCGAAGGCAACCCCCAGGG - Intergenic
1065691021 10:28333904-28333926 GCCACCGCAGCCGGCCCCCTTGG - Intronic
1069660652 10:70121345-70121367 GGCACCCGAGGCAGCCCCCATGG + Intronic
1070062848 10:73001932-73001954 GTCACCCCAGGCTGCTCCCAAGG - Intergenic
1073173933 10:101538759-101538781 GCCACCGCACCCGGCCCCCAGGG - Intronic
1076511043 10:131013616-131013638 GACAGCGCAGTCCGCCCACACGG + Intergenic
1076686495 10:132200580-132200602 GACACCCCAGGCCTCTCCCACGG + Intronic
1077214469 11:1389612-1389634 GGCACCGCTTGCCGCCGCCACGG + Intergenic
1077251648 11:1563411-1563433 GTCCCAGCAGACAGCCCCCAGGG - Intronic
1079342783 11:19627099-19627121 GTCACCGCACCCGGCCCACATGG - Intronic
1083648742 11:64187927-64187949 CTCACTGCAAGCTGCCCCCAGGG - Intronic
1083826193 11:65205386-65205408 GCCACCGCAGGCTGCTGCCAGGG - Intronic
1084474486 11:69381058-69381080 GCCACTCCAGGCCGGCCCCAGGG - Intergenic
1084705726 11:70815054-70815076 GCCACCAGAGGGCGCCCCCAGGG + Intronic
1085704161 11:78771011-78771033 GTCACCGCAGGCAGTCTCCATGG + Exonic
1087615940 11:100486746-100486768 GTCACAGCAAGCCCCACCCAAGG + Intergenic
1089626800 11:119756010-119756032 GCCACCACAGGCCCCCCACAGGG - Intergenic
1091659224 12:2370851-2370873 GACACCGCAGACTGCCACCAAGG - Intronic
1091916089 12:4272641-4272663 TTCACCGCAGTCGGCTCCCAGGG + Intergenic
1094025895 12:25959107-25959129 GCCCCCGCAGGCCGCCCAGAGGG - Exonic
1099202180 12:79690269-79690291 CTCACCTCAGGCCGCCCACCAGG + Exonic
1102350047 12:112185228-112185250 GTCACCGGCCGCCGCCCCCCCGG + Exonic
1104666548 12:130651256-130651278 GTCTCCTCAGGCCGCCAGCAGGG - Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1111672315 13:91347565-91347587 ATCACCGCAGGCCCCGCCCACGG - Intergenic
1113766053 13:112881754-112881776 GTCACCCCAGGCAGCCCCGTGGG + Intronic
1114664082 14:24368339-24368361 CTCGCAGCTGGCCGCCCCCATGG - Exonic
1115718244 14:36129333-36129355 TTGACTGCAGGCTGCCCCCAGGG - Intergenic
1116790838 14:49338307-49338329 GTCACCACAGGCCAGCTCCATGG + Intergenic
1117088070 14:52221403-52221425 GGAACCTCAGGCCTCCCCCAAGG + Intergenic
1121051137 14:90819691-90819713 GTCACGGCAGGCCACCTACAGGG + Intergenic
1127874886 15:63103533-63103555 GCTACCACAGGCCGACCCCAGGG - Intergenic
1131268933 15:90935054-90935076 GCCACCGCAGGCCTCCCTCTGGG + Intronic
1132959272 16:2613066-2613088 GACGCCCCAGGCAGCCCCCATGG - Intergenic
1132972332 16:2695041-2695063 GACGCCCCAGGCAGCCCCCATGG - Intronic
1136348872 16:29694519-29694541 CTCACCGCAGTCCCCCCCCTGGG + Intronic
1141430379 16:83968094-83968116 GCCCCCTCAGGCCGCCCCCTTGG - Intergenic
1142518067 17:446299-446321 GCCACCGCACCCGGCCCCCACGG + Intergenic
1146063090 17:29617261-29617283 GTCACAGCAAACCACCCCCAGGG + Intronic
1148865829 17:50628112-50628134 GTCAGCTAAGCCCGCCCCCAAGG - Intergenic
1150896157 17:69213365-69213387 GTCACAGCAAGCCCCACCCAAGG - Intronic
1151500303 17:74483991-74484013 CTCTCTGCAGGCCTCCCCCAGGG + Exonic
1152223576 17:79082385-79082407 GTCCCCGCAGGCTTCCCTCACGG - Intronic
1152938353 17:83153202-83153224 GGGACCACAGGCCGCCCCCACGG - Intergenic
1153971158 18:10228534-10228556 GACACTGCAGGCAGCCTCCATGG - Intergenic
1154412052 18:14146861-14146883 GGCAGCTCAGGCCGCGCCCATGG - Intergenic
1157619324 18:49007028-49007050 GTCAGCGCAGGCAGAGCCCAGGG + Intergenic
1163757690 19:19116224-19116246 GTGTCCCCAGGCAGCCCCCATGG - Intergenic
1165060486 19:33202751-33202773 TTCAGCACAGGCCTCCCCCATGG - Intronic
1165319323 19:35075877-35075899 CCCACCGCTGGCCACCCCCATGG - Intergenic
1166888028 19:45973348-45973370 GCCGCCCCAGGCCCCCCCCATGG - Exonic
926154850 2:10448134-10448156 GGCGCCGCAGGCCAGCCCCATGG + Exonic
927792814 2:26023642-26023664 ATCACCGCAGGCCTTACCCATGG - Intergenic
929775768 2:44929676-44929698 GTCCCCGCAGGCCGAGCCCGCGG + Intergenic
931265056 2:60653135-60653157 GTCACCTGATGCAGCCCCCACGG - Intergenic
942302142 2:174572286-174572308 GGAACCGAATGCCGCCCCCAAGG - Exonic
944645859 2:201780732-201780754 GTCTCCGCAGGCCCCCCGCAGGG + Intronic
948462755 2:238138341-238138363 GTGACCCCAGGCCCCCACCACGG + Intergenic
1170284208 20:14687677-14687699 GTCACTGCATGCAGCCCACAGGG + Intronic
1173806212 20:45927042-45927064 GCCACAGCAGGCAGCCCACAGGG + Intergenic
1174686899 20:52465003-52465025 GTCACTGCAGGCCACCCTCATGG + Intergenic
1175195986 20:57243726-57243748 GGCACCGCAGCCCCTCCCCACGG + Intronic
1175826166 20:61937721-61937743 GTCAACCCAGGCCTCCCTCAGGG + Exonic
1176860980 21:14011466-14011488 GGCAGCTCAGGCCGCGCCCATGG + Intergenic
1179172720 21:38985255-38985277 GCCACCGCAGGCTGCCCCCACGG + Intergenic
1180090533 21:45531594-45531616 GTCCCCACAGGCCACCCGCAGGG + Exonic
1180261366 21:46671362-46671384 GTCACTGTAGGCCACCCCCTTGG - Intergenic
1180960595 22:19760715-19760737 CACACCGCAGGCCGGCCCCGAGG - Intronic
1180981600 22:19880701-19880723 GTCAGCTCAGGCCGCCCCTTGGG + Exonic
1184496139 22:44842701-44842723 GTCACCCCTGGTGGCCCCCAAGG - Intronic
961222595 3:125212393-125212415 GCCTCCGCAGGCCGCCCCGCAGG + Intronic
968704445 4:2071481-2071503 CCCACTGCAGGCCTCCCCCATGG - Intergenic
968741453 4:2333523-2333545 CTCCCCGCAGGCCGCACCCCAGG - Intronic
973619518 4:52712697-52712719 GGCACCGCCGCCCGCCCCCCGGG - Intergenic
979231567 4:118353124-118353146 CCCACCGCAGTCCGCCCGCACGG + Intergenic
985665067 5:1177882-1177904 GTCACTGCAGGGCGCAGCCACGG - Intergenic
997583951 5:135033937-135033959 GTCCCCGCAGGTCGCAGCCAGGG - Exonic
1003020044 6:2502042-2502064 GTTACGGCAGGCCCTCCCCATGG - Intergenic
1003556030 6:7141127-7141149 GCCCCCTCGGGCCGCCCCCAGGG + Intronic
1005755708 6:28923629-28923651 GCCCCCGCAGGCCGGCGCCATGG - Exonic
1012465771 6:99515230-99515252 GTGACCGCCCGGCGCCCCCAGGG + Exonic
1018384109 6:163287432-163287454 GTCCCCACAGGCCGCACACACGG + Intronic
1018786818 6:167114625-167114647 GTCACAGCAGGCCTCGGCCAGGG - Intergenic
1019513195 7:1428762-1428784 GTCACGGCAGGCCGGCCCGGGGG + Intronic
1019539579 7:1545680-1545702 GTCACTGCAGGGCGCCCCCCAGG - Exonic
1023869980 7:44257921-44257943 GTTACCCCAGGCCCTCCCCATGG - Intronic
1023990324 7:45124789-45124811 CTCACTGCAGGCTGCACCCAGGG + Intergenic
1029360098 7:100082016-100082038 GCCCCCGCCGCCCGCCCCCAAGG - Intronic
1031557874 7:123200369-123200391 GTCTCCACAGGCAGCCTCCATGG + Intergenic
1033462769 7:141562508-141562530 GTCACAGCAAGCCCTCCCCAAGG - Intronic
1034343424 7:150371887-150371909 GTCACCGCGGGGCGGCCCCTGGG - Exonic
1035220294 7:157402440-157402462 GTCACCCCACGCCCGCCCCACGG - Intronic
1037262849 8:17027358-17027380 GTCACCGCAGGCCGCCCCCACGG - Exonic
1048297971 8:133228739-133228761 GTCACCCCAGGCTGCTACCAAGG - Exonic
1049471583 8:142777292-142777314 CTCACCGCAGGCCCCGCCCCAGG + Intronic
1049595314 8:143480730-143480752 GACACCGCAGGCAGTGCCCATGG - Intronic
1053163505 9:35829349-35829371 GACACCGGAGGCCACCCCCCGGG + Intronic
1056810981 9:89763743-89763765 GTCAGCTCAGGCCTCCCACAGGG + Intergenic
1057501617 9:95601096-95601118 CTCACCGCAGGCCGGGCCCTGGG + Intergenic
1059178416 9:112189068-112189090 GTCACCTCAGGCTAGCCCCAGGG + Intergenic
1062122009 9:134838899-134838921 GTCCCTGCATGCCACCCCCATGG - Intronic
1062286366 9:135774799-135774821 GTCAGCCCAGGACCCCCCCATGG - Intronic
1062289007 9:135786269-135786291 GGCACCGGAGGCAGCTCCCAGGG + Exonic
1062302488 9:135882786-135882808 GTCTGCGGTGGCCGCCCCCAGGG - Intronic
1062462962 9:136669493-136669515 GTCACCCCAGCATGCCCCCAAGG - Intronic
1189369538 X:40416791-40416813 GTCATGGGAGGCCTCCCCCAGGG + Intergenic
1195237096 X:102911315-102911337 GTCACAGCAAGCCACACCCAAGG + Intergenic
1195397026 X:104422170-104422192 GTTACCGCAGGCAGGGCCCAGGG + Intergenic
1199703525 X:150404119-150404141 GCCACCACAGGCAGCCCACATGG + Intronic