ID: 1037269608

View in Genome Browser
Species Human (GRCh38)
Location 8:17112120-17112142
Sequence CCCACGTGTCCAGGGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 1, 2: 7, 3: 45, 4: 327}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037269608_1037269616 2 Left 1037269608 8:17112120-17112142 CCCTCCCTCCCTGGACACGTGGG 0: 1
1: 1
2: 7
3: 45
4: 327
Right 1037269616 8:17112145-17112167 TTGCAATTTGAGATGAGATTTGG 0: 26
1: 767
2: 2273
3: 5633
4: 14138
1037269608_1037269617 3 Left 1037269608 8:17112120-17112142 CCCTCCCTCCCTGGACACGTGGG 0: 1
1: 1
2: 7
3: 45
4: 327
Right 1037269617 8:17112146-17112168 TGCAATTTGAGATGAGATTTGGG 0: 27
1: 791
2: 2618
3: 10332
4: 13689
1037269608_1037269620 8 Left 1037269608 8:17112120-17112142 CCCTCCCTCCCTGGACACGTGGG 0: 1
1: 1
2: 7
3: 45
4: 327
Right 1037269620 8:17112151-17112173 TTTGAGATGAGATTTGGGTGGGG 0: 636
1: 1979
2: 10095
3: 12822
4: 9433
1037269608_1037269619 7 Left 1037269608 8:17112120-17112142 CCCTCCCTCCCTGGACACGTGGG 0: 1
1: 1
2: 7
3: 45
4: 327
Right 1037269619 8:17112150-17112172 ATTTGAGATGAGATTTGGGTGGG 0: 673
1: 1973
2: 10309
3: 12710
4: 10112
1037269608_1037269618 6 Left 1037269608 8:17112120-17112142 CCCTCCCTCCCTGGACACGTGGG 0: 1
1: 1
2: 7
3: 45
4: 327
Right 1037269618 8:17112149-17112171 AATTTGAGATGAGATTTGGGTGG 0: 639
1: 2054
2: 10290
3: 12845
4: 9442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037269608 Original CRISPR CCCACGTGTCCAGGGAGGGA GGG (reversed) Intronic
900236495 1:1594132-1594154 CCCAGGTGCCCCAGGAGGGATGG - Intergenic
900386201 1:2412195-2412217 GCCACCTGGCCAGGGAGGGCAGG + Intronic
900401185 1:2473609-2473631 CACAGGTGGACAGGGAGGGACGG - Intronic
900456838 1:2779162-2779184 CCCAGGTGTCCACCGATGGATGG - Intronic
900472331 1:2861061-2861083 CCCAAGTGTCCTGGAGGGGAGGG - Intergenic
900947343 1:5838514-5838536 CCCACCTGTCCTGGGAGGAGGGG + Intergenic
901456914 1:9368313-9368335 CACATGTGCCCAGGGAGGGCGGG - Exonic
901500955 1:9652350-9652372 CCCACTTGCCCAGGCTGGGAAGG - Intronic
901688464 1:10957779-10957801 ACCATGTGGCCAGGGAGGCACGG + Intronic
901972327 1:12917989-12918011 CCCAGGTGTCCAGGTGGGGAGGG + Intronic
902012852 1:13283773-13283795 CCCAGGTGTCCAGGTGGGGAGGG - Intronic
903164466 1:21510453-21510475 CCCAGCTGCCCAGGGAGGCAGGG + Intronic
903367171 1:22812220-22812242 CCTGCCTGGCCAGGGAGGGAAGG + Intronic
903656791 1:24954422-24954444 CACACAAGTCCAGGGAAGGAAGG + Intronic
904336407 1:29801032-29801054 CCCACTTGACCAGTGAGGAAGGG - Intergenic
904378088 1:30094383-30094405 GCCAGCTCTCCAGGGAGGGATGG - Intergenic
904575040 1:31499993-31500015 TCCACGTGGAGAGGGAGGGAGGG + Intergenic
904734856 1:32623898-32623920 TCCACGTGTTGTGGGAGGGAGGG + Intronic
906544429 1:46611506-46611528 CCCACAGGCCCAGGGAGGTATGG + Intronic
906694228 1:47813344-47813366 TCCAGGTGGCCAGGGATGGAAGG + Intronic
909774161 1:79463840-79463862 CTCATGTTTCGAGGGAGGGAGGG - Intergenic
919849178 1:201660873-201660895 CCCAGGTGGCCAGGGTGGCAGGG + Intronic
919937742 1:202265693-202265715 CCCACTTAACCAGGGAGGAAAGG - Intronic
920083688 1:203397848-203397870 CCCAAGTGTCGATGGAGGAATGG - Intergenic
923997107 1:239507250-239507272 CCCATGTGTTGTGGGAGGGAGGG + Intronic
1063420726 10:5910909-5910931 GCCAGGTGCACAGGGAGGGAGGG - Intronic
1063494485 10:6494329-6494351 CTCCCGTGGCCAGGGAGAGATGG - Intronic
1063598302 10:7457500-7457522 CCCACATGCTCAGGGAGAGAAGG - Intergenic
1063651010 10:7936839-7936861 CCAGCGGGTACAGGGAGGGAGGG - Intronic
1064261383 10:13788960-13788982 CCCAAGTGCCCAGGGCTGGATGG - Intronic
1064552734 10:16520310-16520332 CCCGCCTCTCCAGGGTGGGACGG + Intronic
1065198397 10:23289073-23289095 CCCACGTGTGCAGGGAGAGCAGG + Intronic
1066745302 10:38601388-38601410 CCTGGGTGTCCACGGAGGGAAGG - Intergenic
1068749664 10:60577418-60577440 CCCACCTGTTGTGGGAGGGATGG + Intronic
1069761133 10:70812407-70812429 CCCATGTGTCGAGGGAGGGAGGG - Intergenic
1070691911 10:78533318-78533340 CCCATGTGTCCAGTGTGGGGAGG + Intergenic
1070823298 10:79375722-79375744 AGCAAGTGTCCAGGGAGAGACGG + Intergenic
1071661296 10:87505247-87505269 CCCGCGGGTCCAGGGATGGCGGG + Exonic
1072722453 10:97789280-97789302 CCCAAGTGTCTGGGTAGGGAGGG + Intergenic
1072808046 10:98437862-98437884 CCCACGTGTCAAGGGAGACCTGG + Intronic
1073621202 10:105050423-105050445 CCCATGTGTCAAGGAATGGAGGG + Intronic
1074686447 10:115966365-115966387 CCCACGTGTTGAGGGAGGGAGGG + Intergenic
1076470420 10:130714448-130714470 CCACCCTGTCCAGGGAGGGCAGG + Intergenic
1076928215 10:133506356-133506378 TCCACGTGTCCATGGGTGGAGGG - Intergenic
1077146849 11:1050279-1050301 CAGACGTGCCCAGGCAGGGAGGG + Intergenic
1077325386 11:1961687-1961709 GCCACGTGTCCACTGATGGACGG - Intronic
1077327239 11:1969140-1969162 CCCCCGTGTCCTGAGAGGCAGGG - Intronic
1077352974 11:2101285-2101307 CCGAGGGGTCCAGTGAGGGAAGG - Intergenic
1077394960 11:2316167-2316189 GCCGCTTGTCCAGGCAGGGAGGG + Intronic
1077489642 11:2854948-2854970 CACAGGTGACCAGAGAGGGAAGG + Intergenic
1077785589 11:5380272-5380294 TGCAGGTGTCCAGGGAGGCAGGG + Intronic
1078423973 11:11234403-11234425 CCCAGGGTTCCAGGGATGGAAGG + Intergenic
1081606945 11:44532971-44532993 CCTAAGTGTCCACGGATGGATGG + Intergenic
1083399074 11:62411524-62411546 CCCAGGGTTTCAGGGAGGGAGGG - Intronic
1083631416 11:64097353-64097375 CCCACATGTGAAGGGAAGGAAGG + Intronic
1083896222 11:65621051-65621073 CCCAGGTGCCCCAGGAGGGACGG + Intronic
1084450115 11:69231782-69231804 CCCACGTGGCCAGGCTGGGAGGG + Intergenic
1087261367 11:96016250-96016272 CCTACGTGTACATGGGGGGAGGG + Intronic
1087812826 11:102626557-102626579 CCCATGTGTTGAGGGAGGGAGGG + Intergenic
1089170120 11:116505979-116506001 CCCATCTGTCCAGGGAAGGAAGG - Intergenic
1089340093 11:117751441-117751463 GCCAAGTCTCCAGGGAAGGATGG + Intronic
1089859406 11:121575446-121575468 CCCCCGTGGACAGGGAGAGAGGG - Intronic
1089871018 11:121672758-121672780 TCCAGATGACCAGGGAGGGAGGG + Intergenic
1090333536 11:125948370-125948392 GCCACGTGTGCAGTGCGGGAGGG + Intergenic
1091213849 11:133887438-133887460 GCCACGTGTCCAGAGGTGGAAGG - Intergenic
1091361034 11:134978591-134978613 CCCAGGTGGCGAGGGAGGGAAGG + Intergenic
1202808367 11_KI270721v1_random:16866-16888 GCCACGTGTCCACTGATGGACGG - Intergenic
1202810221 11_KI270721v1_random:24320-24342 CCCCCGTGTCCTGAGAGGCAGGG - Intergenic
1093226546 12:16490808-16490830 CTCATGTGTCCCGGGATGGATGG - Intronic
1095478692 12:42611358-42611380 CAGCCGTGGCCAGGGAGGGAAGG - Intergenic
1096345530 12:50842906-50842928 CCCGCGTGCCCAGGGCGGGTGGG + Intronic
1096389687 12:51218444-51218466 CCCGCCTTTCTAGGGAGGGAGGG - Intergenic
1096502082 12:52070212-52070234 TCCACGTAACCAGGGAGGAACGG - Exonic
1096613549 12:52818758-52818780 CCCGCCTGGCCAGGGAGGGCAGG - Intergenic
1098160836 12:67647827-67647849 TCCACGTGTCTTGGAAGGGAAGG + Intergenic
1101253968 12:102959184-102959206 CCCAGGTCTCCAAGGAGTGAAGG + Intronic
1101531739 12:105579946-105579968 CACACTTCTCCAGGTAGGGAAGG + Intergenic
1102040302 12:109796575-109796597 CACACGTGTCCAGGGAGGAGAGG + Exonic
1102418230 12:112783100-112783122 CCCACTTGGCCAAGCAGGGAAGG - Intronic
1102587737 12:113934914-113934936 CACAGGTGTCAAGGGAGTGAGGG - Intronic
1103106851 12:118235047-118235069 CCAACGTGTCTAGGAAAGGAAGG + Intronic
1103607248 12:122096541-122096563 CACACCTGTCCTGGGAGGGTGGG - Intronic
1104714015 12:131004949-131004971 CCGAGGTCCCCAGGGAGGGAAGG - Intronic
1104811393 12:131622215-131622237 CCCACGTGAGCAGGAAGGGGTGG + Intergenic
1104847841 12:131855714-131855736 CCCAGGTGTTCAGGGAGGGGCGG + Intergenic
1106110318 13:26771432-26771454 CCCAGGTGACCAGGAAGGGCAGG - Intergenic
1106226478 13:27790543-27790565 CCCGCGTGCCCGGGGAGGAAGGG - Intergenic
1107171195 13:37343744-37343766 CCAACATGTACAGGGAGGCAGGG + Intergenic
1108278800 13:48840146-48840168 GCCAGGTGACCAGGGTGGGAGGG + Intergenic
1108378110 13:49832520-49832542 TCCACATGTCATGGGAGGGAGGG + Intergenic
1109971556 13:69777008-69777030 CCCACGTGTCATGGGTGGGAGGG + Intronic
1111597254 13:90427795-90427817 CCCACAAGCTCAGGGAGGGAGGG + Intergenic
1111861381 13:93711424-93711446 CCCACGTGTCCTGTGAGGGAGGG - Intronic
1112395115 13:99022542-99022564 AGCAAGCGTCCAGGGAGGGACGG + Intronic
1113424979 13:110200359-110200381 CCCCGGGGTCCAGGGAGGCAAGG + Intronic
1114311077 14:21467804-21467826 CCCAAGTGTCCATGGACAGATGG + Intronic
1114385786 14:22252785-22252807 CACACGTGTCCAGGGAAGAGAGG + Intergenic
1115374878 14:32663617-32663639 ACAACGTGTCCAAGGTGGGAAGG + Intronic
1115524527 14:34266480-34266502 CACAGGTGTCCAGGGAAGCAGGG + Intronic
1115566450 14:34629569-34629591 CCAAAGTGTCGAGGGAGGGTGGG + Intronic
1115841358 14:37474362-37474384 CCCATGTGTCGTGGGAGGGGAGG + Intronic
1119760359 14:77146478-77146500 GCCAGGTGTCCAGGTTGGGAGGG + Intronic
1121446683 14:93983327-93983349 CCCACATGTCATGGGAGGGACGG - Intergenic
1121879930 14:97490848-97490870 CCCACTTGTCAAGGGCGGGATGG + Intergenic
1122098062 14:99386100-99386122 CCCATGTGTACACAGAGGGACGG + Intergenic
1122356399 14:101125571-101125593 GACGCGTGTCCAGGGTGGGAAGG + Intergenic
1122393515 14:101407012-101407034 CCCAGGTGTCCATGGAGTAATGG - Intergenic
1122601144 14:102922619-102922641 CCCACGTGACCAGGCAGGTCGGG - Intergenic
1122923225 14:104888475-104888497 GCCCCATGACCAGGGAGGGAGGG + Intronic
1123450835 15:20358082-20358104 CCCATGTGGCCTGGGCGGGAGGG - Intergenic
1124351011 15:28955750-28955772 CCCAGGTGCCTAGGGAGGCATGG + Intronic
1124407494 15:29405031-29405053 ACCAGGAGTCCAGGCAGGGAGGG - Intronic
1129389445 15:75213356-75213378 CACAGGTGTGAAGGGAGGGAGGG - Intergenic
1130160367 15:81392948-81392970 CCCATGTGTCCAGGAAGGAGAGG - Intergenic
1130569015 15:85023821-85023843 TCCAAGTGTTCAGGGAAGGAGGG + Intronic
1132573794 16:655718-655740 ACCACGTGGCCAGGGTGGCAGGG + Intronic
1132584536 16:700545-700567 CCCAGGTGTCCGGGGAGGCCTGG + Intronic
1132586172 16:706517-706539 CCCACGGCGCGAGGGAGGGATGG + Intronic
1132807142 16:1780035-1780057 GCCAGGTGTCCTGGGAGGGGTGG - Intronic
1133014597 16:2933631-2933653 TCCAGAGGTCCAGGGAGGGAAGG + Intronic
1133056100 16:3146129-3146151 CCCAGGTTTCTAGGGAGGGGTGG - Intronic
1134793721 16:17014728-17014750 CCTACTTGAGCAGGGAGGGAAGG - Intergenic
1135648870 16:24188033-24188055 CCCAGCTGTCCAGGCAGGGCGGG - Intronic
1135699505 16:24619742-24619764 GCCACGGGTACAGGGAGGAAAGG + Intergenic
1136230839 16:28884357-28884379 CCCCCGTGTCCACGGCGAGATGG - Intronic
1136287080 16:29250722-29250744 TCCATGTGTCTGGGGAGGGAAGG - Intergenic
1136416144 16:30105005-30105027 ACCACCTGAGCAGGGAGGGAGGG + Exonic
1136450803 16:30353422-30353444 CGAACATGTCCAGGGAGGGTGGG + Exonic
1137677533 16:50311195-50311217 ACCACCTGTCCAGGAAGAGATGG - Intronic
1138567648 16:57845296-57845318 CGCAAGAGTCCAGGGAGGGATGG - Intronic
1139700409 16:68704575-68704597 GCCAGGTCTGCAGGGAGGGAGGG + Intronic
1141626997 16:85266649-85266671 CCTACCTCTCCAGGGAGGGAAGG + Intergenic
1142092684 16:88223354-88223376 TCCATGTGTCTGGGGAGGGAAGG - Intergenic
1142274842 16:89112956-89112978 CCAGCTTGTCCTGGGAGGGAGGG - Intronic
1142686720 17:1581388-1581410 CCCAGGAGGCCAGGGAGGGCCGG + Intronic
1143156890 17:4843137-4843159 CCCACGTGTCGAAGCAGGGTAGG + Intronic
1143653009 17:8275905-8275927 CCCAAGTGTCCAGTGACAGAAGG - Intergenic
1144281889 17:13734549-13734571 CCCACATGTTGTGGGAGGGACGG + Intergenic
1144554817 17:16272805-16272827 CCCAAGTGGCCAGGGAAGTAAGG - Intronic
1144698878 17:17323732-17323754 CCAACGTCCCCAGGGAGGGCCGG - Intronic
1144936364 17:18902202-18902224 CCCACCTGTTCACAGAGGGATGG + Intronic
1145304384 17:21665253-21665275 CCCAAGTGTCCATGGATGGATGG - Intergenic
1146269996 17:31478626-31478648 GCCAGGGCTCCAGGGAGGGAGGG - Intronic
1146452891 17:32988780-32988802 CCCACGTGTCAAGGGAGGGAGGG - Intronic
1146632426 17:34480341-34480363 GCCAAGTGCCCAGGGAAGGAAGG + Intergenic
1146917510 17:36687581-36687603 CCCAAGTGTCCCGGGTGGGTGGG + Intergenic
1148212928 17:45819044-45819066 CCCACATGTCAAGGGGGGCAAGG + Intronic
1149060862 17:52420044-52420066 CCCATGTGTCTAGGGAGGGAGGG + Intergenic
1149077012 17:52607654-52607676 CCCACATGTTGAGGGAGGGAGGG + Intergenic
1150623800 17:66828585-66828607 CCCATGTGTTGCGGGAGGGATGG - Intergenic
1151577556 17:74960304-74960326 CCCACGTGGCCAGAGAGGTGTGG - Intronic
1152101104 17:78302148-78302170 CTCAGGTGACCTGGGAGGGAAGG + Intergenic
1152267130 17:79301697-79301719 CCCAGGTGTCCATCAAGGGATGG + Intronic
1152337605 17:79707253-79707275 CCCACGTGGCCTGGGCGGGAGGG + Intergenic
1152408154 17:80108989-80109011 CCCAGCTGTCCAGGGAGGTCGGG + Intergenic
1152527906 17:80900072-80900094 CCCACTTCTGCAGGGAGGGGTGG - Intronic
1152571455 17:81123021-81123043 CCCCTGTGTACAGGGAGGGAAGG - Intronic
1152572156 17:81125615-81125637 CCCACGTGACCAGCCAGGCAGGG - Intronic
1152663328 17:81552920-81552942 CCCACGTGTTCAGCCACGGAGGG - Intronic
1153839195 18:8990763-8990785 CCCACGTGTCCGGGGCAGGGTGG + Intergenic
1154411019 18:14142416-14142438 CCCACCTGTCGGGGGAGGGTAGG + Intergenic
1157524838 18:48372928-48372950 CCAGCATGTCCAGGGAGGGTTGG - Intronic
1158747522 18:60218455-60218477 CCCATGTGTAGAGGGAGGGAGGG + Intergenic
1159218140 18:65423874-65423896 CCCACATGTCATGGGAGGGAAGG + Intergenic
1159721505 18:71897627-71897649 CCCATGTGTTGAGGGAAGGAGGG + Intergenic
1160250329 18:77198014-77198036 CCCAGGTGTGCAGAGAGGAAAGG + Intergenic
1160426513 18:78782312-78782334 CAGAGGTGTCCAGGGATGGAGGG + Intergenic
1160803450 19:980703-980725 GCCACGTCCCCAGGGAGGGGAGG + Intergenic
1160992143 19:1864216-1864238 CCCACGTGGCCGGGGTTGGAGGG + Intergenic
1161080041 19:2306033-2306055 CCCCCGTGTACAGGCTGGGAAGG - Intronic
1162502625 19:11062641-11062663 CCCAGGTGGTCAGTGAGGGAAGG + Intronic
1162872206 19:13595146-13595168 CCCAAGTGTTCATGGATGGATGG + Intronic
1163007978 19:14408222-14408244 CACACGGGATCAGGGAGGGAGGG - Exonic
1163845738 19:19637360-19637382 CCCACCTGTTCAAGGAGGGAAGG + Exonic
1164548399 19:29187771-29187793 CCCAGCTGTCCTGTGAGGGAAGG - Intergenic
1164934463 19:32200296-32200318 CCAAGGTGTCCAGGAAGGGATGG + Intergenic
1168282283 19:55312070-55312092 CCCACGGGGCCGGGGAGGGAGGG + Exonic
1168663645 19:58185987-58186009 CCCTGGTATTCAGGGAGGGATGG - Intronic
1168709713 19:58491998-58492020 CTGACATGTCCAGGGAGGGCTGG - Intronic
927156154 2:20222938-20222960 CCCAGCGGTCCAGGGAGGTAAGG + Intronic
927818924 2:26245083-26245105 CCCACTTTCCCAGGGAGGGGAGG - Intronic
929593705 2:43162673-43162695 ACCACATCTCCAGGGAAGGAGGG - Intergenic
930037617 2:47097040-47097062 CACAGGTGGACAGGGAGGGAGGG + Intronic
930594068 2:53364372-53364394 CCCACATGTTGAGGGAGGGGAGG - Intergenic
930694203 2:54394699-54394721 CCCATGTGTGGAGGGAGGGAGGG - Intergenic
931041562 2:58306027-58306049 CCCATGTGTCATGGGAGGGAGGG + Intergenic
931632188 2:64311399-64311421 CCCAGGAGTCCGGGGAGTGAGGG + Intergenic
932268998 2:70392477-70392499 CCCACCTGTGCAGTGGGGGAAGG + Intergenic
933993957 2:87654169-87654191 CCCACTTCTCCTGGGAGGGGTGG + Intergenic
935857445 2:107290317-107290339 AGGACGAGTCCAGGGAGGGAGGG - Intergenic
936299908 2:111296745-111296767 CCCACTTCTCCTGGGAGGGGTGG - Intergenic
936467422 2:112765568-112765590 CTCAAGTGTCCGGAGAGGGATGG - Intergenic
938093814 2:128449076-128449098 CCCACGTGGCCAGGGAAGGTTGG - Intergenic
938383198 2:130848080-130848102 CCCAGGTGGGCAGGGAGGGTGGG + Intronic
938796074 2:134719042-134719064 GCCGCGTGGACAGGGAGGGAGGG + Intergenic
940927297 2:159379090-159379112 CCCAAGTGTCCACTGATGGATGG + Intronic
942547980 2:177084328-177084350 CCCACTTCTGCAGAGAGGGAAGG + Intergenic
943917849 2:193660647-193660669 CCCACCTGTCAAGGGTGGGCGGG + Intergenic
948422590 2:237869655-237869677 CCCACGTGTCCATGGATGAATGG - Intronic
948789059 2:240367931-240367953 CCCATGTTTCTAGGGAGGCATGG - Intergenic
948795107 2:240398715-240398737 CCCAGCAGCCCAGGGAGGGAGGG - Intergenic
1168752717 20:294606-294628 CTCACATGTGCAGGGAGGAAAGG - Intergenic
1171175694 20:23049709-23049731 CCCGAACGTCCAGGGAGGGAGGG - Exonic
1171521903 20:25782685-25782707 CCCAAGTGTCCGTGGATGGATGG - Intronic
1171554922 20:26073198-26073220 CCCAAGTGTCCGTGGATGGATGG + Intergenic
1171824187 20:29879154-29879176 CCCACATGTCCAGGCAGGTTGGG + Intergenic
1172149372 20:32779663-32779685 CCCAAGTTCCCAAGGAGGGAAGG - Intronic
1172589181 20:36105611-36105633 CCCACATTGCCAGGGAGTGATGG + Intronic
1172875509 20:38161661-38161683 CCCCCATGTCTAGGGAGGGCAGG - Intronic
1173493300 20:43500835-43500857 CCCATGTGTCAAGGGAGAGGGGG + Intergenic
1173866691 20:46317045-46317067 CCCAGGCGGCGAGGGAGGGAGGG - Intergenic
1173961188 20:47073802-47073824 CCCACGGGTCAAGGGAGTGGAGG - Intronic
1174199639 20:48798304-48798326 CCTCAGTGTCCAGTGAGGGATGG - Intronic
1174214034 20:48902427-48902449 CCCAAATGTCCATGGATGGATGG - Intergenic
1174390900 20:50217721-50217743 CCCACGTCTCCACGCAGGGCTGG + Intergenic
1174487634 20:50871233-50871255 CTCAGGGGTCCCGGGAGGGAGGG - Intronic
1175138864 20:56844807-56844829 ACCATTTGTTCAGGGAGGGAAGG + Intergenic
1175538964 20:59736412-59736434 CACACCTGTCCACAGAGGGAAGG - Intronic
1175786302 20:61713710-61713732 CCCATGTGAGCAGCGAGGGAGGG + Intronic
1175882306 20:62267487-62267509 TCTACTTGTCCAGGGAGAGAAGG + Intronic
1176234187 20:64046614-64046636 CCCACGTGTTCAGGGAAGTTTGG - Intronic
1176655711 21:9587681-9587703 CCCAAGTGTCAATGGATGGATGG - Intergenic
1177268344 21:18812455-18812477 TCCACATGTCAAGGGAAGGAGGG + Intergenic
1178219293 21:30637818-30637840 CCCACATATCAAGGGAAGGACGG + Intergenic
1178582070 21:33845936-33845958 CCCACGTCAGCAGGAAGGGATGG + Intronic
1179574914 21:42301899-42301921 TCCACGTGTCCTGGGCAGGAAGG + Intergenic
1179594067 21:42430579-42430601 CCCAGGCGACCAGGGATGGACGG - Intronic
1179654759 21:42838050-42838072 CCCCGGGGTCCAGGGAGGCACGG + Intergenic
1179887060 21:44318729-44318751 CCCAGGTCTCCAGGGAGGGGAGG + Intronic
1180060997 21:45385047-45385069 CGCACGGCTCCAGGGAGGCAGGG - Intergenic
1180922924 22:19531111-19531133 CCCAGGTGTCAATGGAGGTAGGG + Intergenic
1181335551 22:22125448-22125470 GCCTGGAGTCCAGGGAGGGAAGG - Intergenic
1182100142 22:27651811-27651833 CTCACGTGCCCAGGGTGGGCTGG - Intergenic
1182122338 22:27796339-27796361 CCCAGGTGTCCTGCCAGGGAAGG + Intronic
1182272345 22:29163096-29163118 CCCACGTGTTGAGGGAGGGAAGG + Intronic
1182619912 22:31613338-31613360 CCCACACCTCCAGGGAGGGCAGG - Exonic
1183446650 22:37860947-37860969 GCCAGGAGCCCAGGGAGGGAGGG - Intronic
1183829811 22:40411742-40411764 TCCAGGCGTCCAGGGAGGGAGGG + Exonic
1184265633 22:43344254-43344276 CCCACCGGGCCTGGGAGGGACGG + Intergenic
1184387914 22:44186735-44186757 CCCAGGGGTCATGGGAGGGAAGG + Intronic
1184406083 22:44301652-44301674 CCCATGTGCCCATCGAGGGATGG + Intronic
1184552219 22:45210486-45210508 CCCAGGTGTCCAGAATGGGAGGG + Intronic
1184926962 22:47649274-47649296 CCCAAGTGTCCATCAAGGGATGG - Intergenic
1185160405 22:49224322-49224344 CCCAAGTCTCCATGGATGGATGG + Intergenic
951037506 3:17950394-17950416 CCCATGTGTCATGGGAGGGACGG + Intronic
951324690 3:21287335-21287357 CCCATGTGTTATGGGAGGGATGG + Intergenic
951427115 3:22560183-22560205 CCCACGTGTCCATTAATGGATGG + Intergenic
953535431 3:43773659-43773681 CTCAGGGATCCAGGGAGGGAGGG - Intergenic
958693134 3:97493848-97493870 ACCACGTGTCCAGAGAGTGGTGG + Intronic
960525104 3:118700935-118700957 CCCAAGTGTCAAGGAATGGAGGG - Intergenic
960939361 3:122923358-122923380 CCCACACCTCCAGGGAGGCAGGG - Intronic
961016176 3:123469977-123469999 CCCACAGGGGCAGGGAGGGAGGG + Intergenic
961444272 3:126971874-126971896 ACCACGTGCCCAGGAAGGGTGGG + Intergenic
961668611 3:128509945-128509967 CTCACCTGTGCAGAGAGGGAAGG + Intergenic
962362940 3:134756695-134756717 CCTAGGTGTGCAGGGATGGAGGG + Intronic
962481417 3:135801643-135801665 CCCATGTGCCCAGGGATGGCAGG - Intergenic
966807810 3:183820064-183820086 CCCATGTGGCCAGGCAGGCAAGG + Intronic
967233819 3:187366094-187366116 CACAGGTATCCAGGAAGGGAAGG + Intergenic
968427979 4:535680-535702 TCCAAGTGTCCTGGGAGGGCTGG - Intronic
968946432 4:3666938-3666960 CCCAAGGGTCCAGGGAGGAGGGG + Intergenic
968974996 4:3817444-3817466 CCCATGTGCCCAGGAAGAGAAGG + Intergenic
969271343 4:6105413-6105435 CCCATGCGTGCAGGGAGGGAAGG + Intronic
969491545 4:7502061-7502083 CACATGTGCCCAGGCAGGGAGGG + Intronic
969495496 4:7523887-7523909 CCCAGGGGCCCAAGGAGGGAGGG - Intronic
973642612 4:52918070-52918092 CCCACGTGACCAGGGAGCCCAGG + Intronic
974382081 4:61154133-61154155 CCCACGTGTCCAGGGAATTCTGG - Intergenic
974582148 4:63816702-63816724 TGCACGTGTCTAGGGAGAGAAGG - Intergenic
974843249 4:67322281-67322303 CCCATGTGTTGTGGGAGGGAGGG + Intergenic
976082227 4:81368369-81368391 CCCATGTGTCAAGGCGGGGAGGG - Intergenic
977136626 4:93312859-93312881 CCCAAGTGTATAGGGAGGCATGG + Intronic
978567812 4:110102901-110102923 CCCACGTGTTGTGGGAGGGATGG + Intronic
982459502 4:155651080-155651102 CCCATGTGTCATGGGAGGGAGGG - Intergenic
985647610 5:1092404-1092426 CCCCCAGGTCCAGGGAGGGTGGG - Intronic
985802841 5:2017024-2017046 CCCACAGGTCAAGGGAGAGACGG + Intergenic
986191061 5:5496178-5496200 CCCTCGTGTCCCGGGAAGAAGGG + Intergenic
986650891 5:9962350-9962372 CCCATGTGTTGAGGGAGGAAAGG - Intergenic
987065605 5:14286758-14286780 CGCACGTGTCCAGCAGGGGAGGG + Intronic
987193403 5:15500997-15501019 CCCAGATGCCCAGGGAAGGAAGG - Intronic
989082284 5:37635811-37635833 CCCATGTGTCATGGGAGGGTGGG + Intronic
990558779 5:56963245-56963267 CCCATGTGTCGAGAGAGGGAGGG + Intronic
991759940 5:69910538-69910560 CCCACGAGTACAGGGAGGCGGGG - Intergenic
991839170 5:70785601-70785623 CCCACGAGTACAGGGAGGCGGGG - Intergenic
993716747 5:91282453-91282475 CCCATGTATCGAGGGAGGGAGGG + Intergenic
997694818 5:135852448-135852470 CCCATGTGTCCATGAAGAGAGGG - Intronic
998186120 5:139981354-139981376 CCCACATGGCCATGGTGGGAAGG + Intronic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
998503266 5:142652123-142652145 GCCACATGTCCAGGAAGGAATGG + Intronic
1000881485 5:166703217-166703239 CCCACGTGAAGAGGGAGGGTGGG - Intergenic
1001216535 5:169861104-169861126 CCCGCGTGTCCCGTGAGTGAGGG - Intronic
1002199030 5:177516696-177516718 GGCACGCGTCCGGGGAGGGATGG - Intronic
1002833617 6:846602-846624 CCCACAAGGCCAGGCAGGGAAGG + Intergenic
1003447181 6:6195298-6195320 CACCTGTGGCCAGGGAGGGAGGG - Intronic
1005328162 6:24721627-24721649 GCCACGTGCGCAGGCAGGGAGGG + Intergenic
1005941008 6:30559901-30559923 CCCACATGTCCACTGATGGAAGG + Intronic
1006101108 6:31686915-31686937 CTCAAGTGTCCAGGGAGCCAGGG - Intergenic
1007927526 6:45662523-45662545 ACCAAGTCTCCAAGGAGGGATGG + Intronic
1007927694 6:45663403-45663425 CCCGCGTGTGCTGGGAGAGATGG - Intronic
1009896205 6:69753682-69753704 CCCAAGTGTCCACTGATGGATGG + Intronic
1010917068 6:81633250-81633272 CCCACATGTCATGGGAGGGTAGG - Intronic
1012935884 6:105366684-105366706 CCCAAGTGCCCAGGGATGAATGG + Intronic
1013646680 6:112149406-112149428 CCCATGTGTCATGGGAGGGATGG + Intronic
1014629506 6:123771751-123771773 CCCACGTGTCATGGGACAGAAGG + Intergenic
1014761571 6:125363123-125363145 CTCACTTTTCCCGGGAGGGAAGG - Intergenic
1017408991 6:154149382-154149404 CCCACGTGTCATGGGAGGGATGG - Intronic
1018541617 6:164886352-164886374 CCCACATATACAGGTAGGGAGGG - Intergenic
1018570435 6:165204140-165204162 CCCATGTGTTGAGGGAGGGAGGG - Intergenic
1018790255 6:167142998-167143020 CCCAGGTGTCCAGGTGGGGCAGG + Intergenic
1019325950 7:438361-438383 CCCGCAGGACCAGGGAGGGAGGG - Intergenic
1019377274 7:699539-699561 CCCAGCTCTGCAGGGAGGGAGGG - Intronic
1019981057 7:4622536-4622558 CCCAGGTGTTGAGGGAGGGAGGG + Intergenic
1023766963 7:43520863-43520885 ACAAAGTGGCCAGGGAGGGATGG - Intronic
1025282402 7:57637867-57637889 CCCAAGTGTCCATGGATGGACGG - Intergenic
1025302328 7:57827652-57827674 CCCAAGTGTCCATGGATGGACGG + Intergenic
1026253580 7:68691472-68691494 GCCAAGTGTCCAGGGATGGCTGG + Intergenic
1027155588 7:75765168-75765190 CCCACGGGGCCAGGGAGCAAGGG - Intergenic
1028661957 7:93288164-93288186 CCCATGTGTCAAGGGCGGGGCGG - Intronic
1028834362 7:95357971-95357993 CCCACGTGCCCAGAGGGGTATGG - Intergenic
1029324421 7:99793808-99793830 CCCACATGTCCATCGATGGATGG - Intergenic
1032525331 7:132575559-132575581 CCCATGTGCCCAGGGAGGGTAGG + Intronic
1033738740 7:144251151-144251173 GCCACATGTCCAGGAAGTGATGG + Intergenic
1033744307 7:144299803-144299825 GCCACATGTCCAGGAAGTGATGG - Intergenic
1034227389 7:149494562-149494584 CCCCCGTGCCTAGGGAGAGAGGG - Intronic
1034242567 7:149621618-149621640 CCCCCGTGCCTAGGGAGAGAGGG - Intergenic
1034975107 7:155443951-155443973 CCCAAGTGTTCACAGAGGGATGG + Intergenic
1035024439 7:155816805-155816827 GCCTCGTGCCCAGGGAGGAAGGG + Intergenic
1035048885 7:155986981-155987003 CACCCGTGTCCTGGGAGTGAGGG + Intergenic
1035596487 8:862218-862240 CCCACGTGTCCTGTGGTGGACGG + Intergenic
1036198120 8:6740005-6740027 CTCACTTGTCCATGAAGGGAAGG + Intronic
1037269608 8:17112120-17112142 CCCACGTGTCCAGGGAGGGAGGG - Intronic
1037337881 8:17809326-17809348 CCCACGTGTTGAGCGGGGGATGG - Intergenic
1037558141 8:20046500-20046522 CCCAGGTGTCCATGAATGGATGG - Intergenic
1037660398 8:20921263-20921285 CCCACGTGTCATGGGTGGGTGGG - Intergenic
1038479274 8:27890667-27890689 CCCACCTGCTCAGGGTGGGAGGG + Intronic
1040496077 8:47966515-47966537 CCCACAAGACCAGAGAGGGATGG - Intronic
1045320266 8:101077172-101077194 CACAGCTGTCCACGGAGGGATGG - Intergenic
1047189376 8:122664019-122664041 CATATGTGTACAGGGAGGGAAGG - Intergenic
1047512719 8:125528008-125528030 CCCAAGGCTCCAGGAAGGGAAGG + Intergenic
1049575454 8:143387748-143387770 CCCACTTCTCCAGGGAAGGGTGG + Intergenic
1049608796 8:143542546-143542568 CCCAAGTGTCCACGGGTGGATGG + Intergenic
1049804450 8:144532623-144532645 AGCAGGGGTCCAGGGAGGGACGG - Intronic
1051376040 9:16403966-16403988 CCCAAGTGTCCATCGATGGATGG + Intergenic
1051922536 9:22284775-22284797 GCCACCTTCCCAGGGAGGGAAGG - Intergenic
1054744631 9:68842230-68842252 CACATGTGTCCATGGAGGCAGGG + Intronic
1055049394 9:71963819-71963841 CACAGGAGTCCAGGGAGGGGTGG - Intronic
1055360776 9:75488277-75488299 CTCAGGTCTCCAGGGAGGGAGGG + Intergenic
1055864251 9:80793772-80793794 CCCACCTTTCCAGGGTGGGTGGG + Intergenic
1057204027 9:93160045-93160067 CCCGCGCGGACAGGGAGGGAGGG + Intergenic
1057306400 9:93914748-93914770 CCCACTTGTCCAAGCAGTGAAGG + Intergenic
1057310095 9:93937351-93937373 GACAAGTGTGCAGGGAGGGAGGG + Intergenic
1057802328 9:98198028-98198050 CCCACGTGGACAGGGAGGAGAGG + Intergenic
1058823332 9:108753050-108753072 CCCACGTGTTGAGAGAGGGGGGG - Intergenic
1060189730 9:121584530-121584552 CCCAAGTGCCCAGGGAGGACAGG + Intronic
1060770366 9:126327398-126327420 CCCACGTGACCAGAGAGAGCAGG - Intronic
1061296647 9:129680474-129680496 CCCAGGTGTCTAGGGCGGGTGGG - Intronic
1061367196 9:130178252-130178274 CCCCCTTGTACAGAGAGGGAAGG + Intronic
1061451193 9:130667748-130667770 TCCTGGAGTCCAGGGAGGGAGGG - Intronic
1062174377 9:135152883-135152905 CCCTCTTGTGCAGGGAGGGTGGG + Intergenic
1062212395 9:135372105-135372127 CCCACATCTCCCGGGTGGGATGG - Intergenic
1062229157 9:135471695-135471717 CCCAGGTCTCCATGGAGGCAGGG - Intergenic
1062286647 9:135776038-135776060 CCCGAGTTTCCAGGGAGGGCTGG - Intronic
1062343168 9:136102687-136102709 CTCAAGTGTCCAGGGAGTGAGGG + Intergenic
1203633428 Un_KI270750v1:91142-91164 CCCAAGTGTCAATGGATGGATGG - Intergenic
1186230306 X:7446514-7446536 CCCACATGGCAAGGAAGGGAGGG + Intergenic
1186245569 X:7613017-7613039 CCGACTTGTTCAGGGAGAGAGGG + Intergenic
1186638205 X:11428022-11428044 CCCACGGGTCCGGGGAGGGTGGG - Intronic
1186779623 X:12899751-12899773 ACCAGGTGTCCAGGAAGAGAAGG + Intergenic
1187127934 X:16471242-16471264 CCCCCGTGCCCAGGAAGGGGTGG + Intergenic
1188114441 X:26225734-26225756 TCCACGTGGGCAGGGTGGGAAGG + Intergenic
1188343093 X:29029196-29029218 CCCACATGTCGTGGGAGGGCTGG - Intronic
1190528517 X:51351815-51351837 TCCACGTGTTGTGGGAGGGACGG - Intergenic
1193978701 X:88155622-88155644 CTCACGTGGCCATAGAGGGAGGG + Intergenic
1195018737 X:100804759-100804781 CCCAGGTGTGCCAGGAGGGAAGG - Intergenic
1195625279 X:107000128-107000150 GCCACCTGTCCCGGGCGGGAGGG + Exonic
1195656295 X:107334380-107334402 CCCACGTATCGAGGGAGGGAGGG + Intergenic
1195718595 X:107843384-107843406 CCCTCATCTCCAGGGATGGATGG + Intronic
1196766166 X:119245748-119245770 ACCACATGTCCAGTGAAGGAGGG + Intergenic
1197566659 X:128096173-128096195 CCCACGTGTTGTGGGAGGAATGG - Intergenic
1199306315 X:146270656-146270678 CCTACATGTCAAGGGAGGGATGG + Intergenic
1199663481 X:150077964-150077986 CCTAGGTGTCCAGGTATGGAGGG - Intergenic
1201065300 Y:10090498-10090520 CCCATGTGTTCAGGGTGGTATGG + Intergenic
1201381841 Y:13388747-13388769 CCCACGTGTCAAGGGAGACCAGG + Intronic