ID: 1037273806

View in Genome Browser
Species Human (GRCh38)
Location 8:17156731-17156753
Sequence GGCGCTGCTGCCCGGGCCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 507}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037273806_1037273816 7 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273816 8:17156761-17156783 GGTGCCGGCGGGTGCTGTACTGG 0: 1
1: 0
2: 0
3: 0
4: 77
1037273806_1037273813 -5 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273813 8:17156749-17156771 GCGCCAGGCGGCGGTGCCGGCGG 0: 1
1: 0
2: 5
3: 37
4: 371
1037273806_1037273819 17 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273819 8:17156771-17156793 GGTGCTGTACTGGATCCCGGTGG 0: 1
1: 0
2: 1
3: 8
4: 85
1037273806_1037273818 14 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273818 8:17156768-17156790 GCGGGTGCTGTACTGGATCCCGG 0: 1
1: 0
2: 1
3: 5
4: 92
1037273806_1037273812 -8 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273812 8:17156746-17156768 GCAGCGCCAGGCGGCGGTGCCGG 0: 1
1: 0
2: 6
3: 35
4: 343
1037273806_1037273814 -4 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273814 8:17156750-17156772 CGCCAGGCGGCGGTGCCGGCGGG 0: 1
1: 0
2: 2
3: 21
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037273806 Original CRISPR GGCGCTGCTGCCCGGGCCCG AGG (reversed) Exonic