ID: 1037273806

View in Genome Browser
Species Human (GRCh38)
Location 8:17156731-17156753
Sequence GGCGCTGCTGCCCGGGCCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 507}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037273806_1037273812 -8 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273812 8:17156746-17156768 GCAGCGCCAGGCGGCGGTGCCGG 0: 1
1: 0
2: 6
3: 35
4: 343
1037273806_1037273813 -5 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273813 8:17156749-17156771 GCGCCAGGCGGCGGTGCCGGCGG 0: 1
1: 0
2: 5
3: 37
4: 371
1037273806_1037273816 7 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273816 8:17156761-17156783 GGTGCCGGCGGGTGCTGTACTGG 0: 1
1: 0
2: 0
3: 0
4: 77
1037273806_1037273814 -4 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273814 8:17156750-17156772 CGCCAGGCGGCGGTGCCGGCGGG 0: 1
1: 0
2: 2
3: 21
4: 252
1037273806_1037273819 17 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273819 8:17156771-17156793 GGTGCTGTACTGGATCCCGGTGG 0: 1
1: 0
2: 1
3: 8
4: 85
1037273806_1037273818 14 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273818 8:17156768-17156790 GCGGGTGCTGTACTGGATCCCGG 0: 1
1: 0
2: 1
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037273806 Original CRISPR GGCGCTGCTGCCCGGGCCCG AGG (reversed) Exonic
900136250 1:1118310-1118332 GGGCCTGCAGCCCGGGCCCGAGG - Intergenic
900202340 1:1415195-1415217 GCCGTTGCTGCCAGGGCCCTTGG + Intergenic
900207749 1:1438844-1438866 GGCGCTTCTGACAGGGCCTGAGG + Intronic
900346407 1:2212527-2212549 GGTACTGCTGCCTGGGGCCGGGG - Intronic
900349244 1:2227222-2227244 GTCCCTGCTGCGCGGGCCGGGGG - Intergenic
900413866 1:2526263-2526285 GTCGCTGATGCGCGGGCTCGGGG - Intronic
900596900 1:3484061-3484083 GGCACTGCTGGCCGGGCCCCGGG + Intergenic
900796486 1:4711662-4711684 GGAGCTGCTTCCCGGCACCGCGG - Intronic
900801349 1:4738902-4738924 TGCCCTGCTGCCAGGGCCCCAGG - Intronic
901022352 1:6261622-6261644 CACGCTGCTCCCCGGGCCTGGGG + Intergenic
901223931 1:7601089-7601111 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
901279842 1:8025907-8025929 GGCGGCGCAGCCCGGGCCTGGGG - Intronic
901462236 1:9398578-9398600 GGGGCTGCTGCCCTCACCCGTGG + Intergenic
901751885 1:11415062-11415084 GGCACAGCTGCCCTGGCCCAGGG - Intergenic
902385512 1:16073450-16073472 GGCGCAGCGGCCCGGCCCCGCGG - Exonic
902385592 1:16073685-16073707 GGCGCGGCGGGCGGGGCCCGGGG + Intergenic
902747352 1:18482625-18482647 AGGGCTGGTGCCCGGGCCCCTGG - Exonic
903057204 1:20644568-20644590 GCCGCTGCTGCCAGGGGCCCTGG + Exonic
903132679 1:21290012-21290034 AGCGCGCATGCCCGGGCCCGGGG + Intronic
904287021 1:29459415-29459437 GGCTCTGCTGCCTGGACCCCAGG + Intergenic
904701998 1:32363165-32363187 GGGGCTGGTGCCAAGGCCCGTGG + Intronic
904912702 1:33947293-33947315 GGCTCTGCTGCCCCTGCCCAAGG + Intronic
905183325 1:36179419-36179441 GCCGCTGCGGCCCGGGCAAGGGG + Intronic
906499175 1:46328544-46328566 GCCGTTGCTGCCAGGGCCCTTGG + Intergenic
909931388 1:81503357-81503379 GGCGCTGCTGCCGAGGCTCTGGG - Intronic
910343820 1:86216024-86216046 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
912550654 1:110483332-110483354 GGCGCTCCTGCCTGGGTCCTGGG - Intergenic
912751971 1:112293999-112294021 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
914002259 1:143703175-143703197 GGGGCGGCTGGCCGGGCCCGGGG - Intergenic
914919736 1:151838876-151838898 GGCGCTTGTGGGCGGGCCCGGGG + Exonic
915343486 1:155188655-155188677 GGCGGTGGAGCCCGGGGCCGGGG + Intronic
915502439 1:156328244-156328266 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
916588379 1:166166889-166166911 GGCCCGGCTGCCTCGGCCCGGGG + Exonic
916729474 1:167553436-167553458 CACGCCGCTGCCCGCGCCCGGGG + Exonic
917817612 1:178725870-178725892 GGCGCAGCCGCCAGGGCCAGGGG - Intronic
917906602 1:179591819-179591841 GGCGCTGGTGCGCAGGCGCGCGG + Exonic
918332368 1:183472416-183472438 CTCGCTGCTGCTCTGGCCCGTGG - Intronic
919931198 1:202222448-202222470 GGCTCTGCGGCCCGGCCCCTGGG + Intronic
921044087 1:211460873-211460895 GGGGCTGCTGGCCGGGCGGGGGG - Intergenic
922222964 1:223622360-223622382 ATCACTGCTGCCAGGGCCCGGGG + Intronic
923008003 1:230067375-230067397 GGCGCCGCCGCCCGCGCCCCCGG - Exonic
923506622 1:234610326-234610348 TGCGCTGCTGCGCTGCCCCGCGG - Intergenic
923783190 1:237043104-237043126 GGCGCAGCTGACCGGGGGCGGGG + Intronic
924436816 1:244049276-244049298 GCCGCAGCTGCACCGGCCCGCGG - Intronic
924561075 1:245156547-245156569 GCCGCCGCTGCCGGAGCCCGGGG - Exonic
924624658 1:245688446-245688468 GCAGCTGCGGGCCGGGCCCGAGG + Exonic
1062874085 10:931481-931503 GGCGCGGCCGCCGGGCCCCGGGG - Exonic
1063133073 10:3195119-3195141 GGAGCTGCTCCCCCGGCCTGAGG - Intergenic
1063459090 10:6204043-6204065 GGCGCTGCTCCACGCGCCCCGGG + Intronic
1067071829 10:43138237-43138259 GGCGCCCCTGCCCGGACTCGTGG - Intergenic
1067178978 10:43970792-43970814 GGCTCTGCTCCCAGGGCCTGAGG + Intergenic
1068690123 10:59906090-59906112 GGCGCTGCGGCGCGTCCCCGGGG + Intronic
1069486772 10:68828373-68828395 GGCGCTGCTCTGAGGGCCCGGGG + Intronic
1069962730 10:72087945-72087967 GTCCCTGCGGCCCGGGCCGGCGG - Intronic
1070257613 10:74825478-74825500 TGCGCTGCAGCCCGGAGCCGAGG + Intergenic
1070644203 10:78190228-78190250 AGTGCTGCTGCCCGGGCCTTTGG + Intergenic
1070966603 10:80534501-80534523 GTGGCGGCTGGCCGGGCCCGGGG - Intergenic
1071526652 10:86363318-86363340 GGCGCCGCCGCCTGGGCCGGAGG - Intronic
1072180500 10:92975803-92975825 GGGGCGGCTGGCCGGGCGCGGGG - Intronic
1072465172 10:95656459-95656481 GGAGCAGGTGCCGGGGCCCGGGG - Intronic
1072681687 10:97512199-97512221 GGATCTGCTGCCTGGGCCAGGGG - Intronic
1075054582 10:119207807-119207829 GCCGCTGCTGCCGGAGCCGGGGG - Exonic
1076615376 10:131751192-131751214 GGGGCTGCAGCCGGGTCCCGGGG - Intergenic
1076707033 10:132307798-132307820 GGCGCTGCTGCCCCTGCGCTCGG + Exonic
1076717123 10:132371824-132371846 GGCTCTGCAGCCCTGGCCCACGG - Intronic
1076724829 10:132408470-132408492 GGCGCTGCTGGCCATGCCCGAGG + Intronic
1076742576 10:132494076-132494098 GGAGCTGGTGCACGGCCCCGTGG - Intergenic
1076917689 10:133432789-133432811 GGAGCTGCTGCACAGGCCTGCGG - Intergenic
1076937685 10:133576864-133576886 GGAGCTGCTGCACAGGCCTGCGG - Intergenic
1077021113 11:417528-417550 GCCGCTGCCGCACGGGCCTGGGG + Intergenic
1077664387 11:4094748-4094770 GACGCTGCGGCCCACGCCCGGGG - Intronic
1077668535 11:4137473-4137495 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
1080889880 11:36400237-36400259 GGCCCTGGTGCCCTGCCCCGTGG - Intronic
1081289169 11:41305061-41305083 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1082678860 11:56143946-56143968 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1082810504 11:57476592-57476614 GGCGCGGCTGCCCGGCCGCGTGG - Exonic
1083173931 11:60937897-60937919 GGCACTGCTGTCCTTGCCCGGGG - Exonic
1083258312 11:61509800-61509822 GGCGCTGGTTCCCGGGCTCTGGG + Exonic
1083475109 11:62910300-62910322 GTCGCTGCTGCCGGGCCCCCAGG - Exonic
1084363980 11:68685835-68685857 GGCTCTGCCGCCCTGTCCCGGGG + Intronic
1084624370 11:70295663-70295685 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
1084636755 11:70398287-70398309 CGCGGCGCTGCCCGGGGCCGGGG - Intergenic
1086122400 11:83316487-83316509 GGGGCTGCTGGCCGGGCGGGGGG + Intergenic
1089421043 11:118331740-118331762 GGCGCGGCTGGCCGGGCGGGGGG + Intergenic
1089694904 11:120211029-120211051 AGCGCTGGAGCCCGGGGCCGCGG + Exonic
1091273107 11:134331860-134331882 GGCGGGGCTGGCCGGGGCCGGGG - Exonic
1091558691 12:1594474-1594496 GCCGCTGCTCCGCGGGCCGGCGG + Intronic
1091705157 12:2688661-2688683 GGCGCTGCTGCCCCCGCCACCGG - Exonic
1092401905 12:8184485-8184507 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1094525869 12:31230349-31230371 GGCTCTGTTGCCCGGGCTGGAGG - Intergenic
1096685872 12:53288050-53288072 GGCACTGCTTCCCGGGGCCGGGG + Exonic
1096856609 12:54488314-54488336 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
1097102944 12:56602054-56602076 AGTTCTCCTGCCCGGGCCCGAGG - Exonic
1098024671 12:66189277-66189299 GGCTCGGCTGCCCGAGCCCCGGG - Exonic
1098288560 12:68933345-68933367 GGCGCGGCTGCTGGTGCCCGCGG + Intronic
1098787356 12:74776508-74776530 GGCGTTGTGGCCCGGGCCTGTGG + Intergenic
1099202132 12:79690101-79690123 GTCGCTGCTGCCCCCTCCCGGGG + Exonic
1100477654 12:94949048-94949070 GCCGCTGCTGCCCAGGTCCAAGG - Intronic
1102475386 12:113185339-113185361 GGCGCGGCCTCCCAGGCCCGCGG - Exonic
1102973547 12:117190147-117190169 GGGGCGGCTGCCCGGCCCCGGGG + Intronic
1103703102 12:122858162-122858184 GGCGCTGCTGCCGAGGCCGCGGG + Exonic
1103905633 12:124326034-124326056 GGCTCAGCTGCCCAGGCCCCTGG + Intronic
1103939873 12:124495793-124495815 GTCCCTGCTGCCCGGGACAGCGG - Intronic
1104442126 12:128802319-128802341 GGCGCTGATGCCAGGGCTAGGGG - Intronic
1104568086 12:129903230-129903252 GCCGCGGCCGCCAGGGCCCGGGG - Intronic
1104866963 12:131961474-131961496 GCCGCCGCTGCCCCGGCCCCTGG + Exonic
1104885512 12:132104842-132104864 GCCGCCGCTGCCCCGGCCCCTGG + Exonic
1105278818 13:18951528-18951550 TGCCCTCCTGCCCAGGCCCGGGG + Intergenic
1105322793 13:19344760-19344782 GGGGCTGCTGACCGAGCCCCAGG + Intergenic
1105503088 13:20989095-20989117 GGTGCTGGTGGCCGGGCCCGTGG + Exonic
1105749802 13:23412227-23412249 GGCTCTGTTGCCCAGGCGCGGGG - Intronic
1105874820 13:24541955-24541977 GGGGCTGCTGACCGAGCCCCAGG - Intergenic
1106720109 13:32427864-32427886 GGCGCCGGTGCACGGGCCCGGGG - Intronic
1109364625 13:61339271-61339293 GGCCCTGCTGCCCCGGGCAGAGG + Intergenic
1109789718 13:67230624-67230646 GCCGCTTCCGCCCGGGCCTGGGG - Intergenic
1113895100 13:113759275-113759297 GCCGCCGGTGCCCGGGCCCCTGG + Exonic
1114165269 14:20212929-20212951 GGGGCTGCTGGCCGGGCGGGGGG - Intergenic
1115203236 14:30875066-30875088 GCTGCTGCTGCCGGGGCCCGCGG + Exonic
1115646023 14:35369049-35369071 GGCGCTGCGGCTCTGGCCCGTGG + Intergenic
1116436264 14:44897761-44897783 GGCGCGGCTGCCCAGGGCCAGGG + Intronic
1117424718 14:55581239-55581261 GACGCCGCTGCCCGCGTCCGGGG - Intronic
1117478300 14:56118752-56118774 CGCGCCGCTGCCCGGGACCAGGG - Intronic
1117978818 14:61322076-61322098 GGCGCCGCTGCCCCGGCCCCGGG - Exonic
1118184312 14:63523096-63523118 GGGGCTGCTGGCCGGGCGGGGGG - Intronic
1118584715 14:67341474-67341496 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1118849468 14:69573056-69573078 GCTGCTGCTGCCCGCGCTCGGGG + Exonic
1120809850 14:88792520-88792542 GCCGCTCCCGCTCGGGCCCGCGG + Exonic
1120881303 14:89417027-89417049 GCCCCTGCCGCCCGCGCCCGCGG - Intronic
1120892875 14:89506033-89506055 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1122270771 14:100567687-100567709 GCCGCAGCGGCCCGGGCCGGCGG + Intronic
1122275216 14:100587453-100587475 GCCGCGGCTGCGCGGGGCCGGGG - Intergenic
1122414566 14:101542754-101542776 GGAGCTGCTGGCCAGGCCCTGGG - Intergenic
1122540914 14:102497243-102497265 GCCGCTGCTTCCTGGGCCAGGGG + Intronic
1122773654 14:104107913-104107935 GGTGCCGCTGCCCGGACCCATGG + Intronic
1122882061 14:104694682-104694704 GGGGCTGCTACCAGGGCCCAGGG - Intronic
1122947697 14:105020776-105020798 GCCGCTGCTGAGGGGGCCCGGGG - Intronic
1124500842 15:30225404-30225426 GGAGCTGCTGGCCGGGCGTGTGG - Intergenic
1124575506 15:30904111-30904133 GGCGCAGCTGCCCGCGGCTGGGG + Intronic
1124641371 15:31398520-31398542 GGTGCTGCTGCCTGGCCCCCAGG + Intronic
1124742729 15:32313263-32313285 GGAGCTGCTGGCCGGGCGTGTGG + Intergenic
1127072966 15:55303045-55303067 GGCGCGGCTGGCCGGGCGGGGGG - Intronic
1127974394 15:63986455-63986477 GGCTCTGCTGCCCCGGCTGGAGG + Intronic
1128089819 15:64911885-64911907 CGCGCTGGTGCCCGGGCGCGAGG - Exonic
1128089966 15:64912568-64912590 GACGCTGCTGCCCGGCCTAGAGG - Intronic
1128254421 15:66186333-66186355 GGGGCTGCTGGCCAGTCCCGGGG - Intronic
1128263942 15:66252291-66252313 GGCGCTGGTGCCGGGGCGCGAGG + Intronic
1129221451 15:74133956-74133978 GACGCTGTTGCCCCGGCCCTTGG - Exonic
1129295052 15:74595662-74595684 GGCGCTGCTGCCGAGGCTCTGGG - Exonic
1129428425 15:75481353-75481375 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1129460206 15:75696735-75696757 GGCACTGCTGTCTGGGCCTGAGG + Intronic
1129764011 15:78149623-78149645 TGCGCTGCTGACCCGGCCCGGGG - Intronic
1130108206 15:80944867-80944889 GGTGCTGCTGCTCGGGCTGGTGG - Intronic
1131058497 15:89390409-89390431 GTTTCTGCTGCCCGGTCCCGAGG - Intergenic
1131515289 15:93072889-93072911 GGCACTGCCGGCCGGGCGCGCGG - Intronic
1132230165 15:100176030-100176052 GGCCCTGCTGCCCAGGCCACAGG + Intronic
1132573315 16:653452-653474 GTGGGTGCTGCCCGGGCCTGGGG + Intronic
1132583418 16:695329-695351 GGCGGGGCTGCACGGGGCCGGGG - Intronic
1132611627 16:819629-819651 GGGGCTGCTGGCCTGGCCTGGGG + Intergenic
1132683574 16:1153336-1153358 GGCGCTGGGGGCCGGGGCCGGGG + Exonic
1132683593 16:1153370-1153392 GGCGCTGGGGGCCGGGGCCGGGG + Exonic
1132842272 16:1984005-1984027 CGCGGCGCTGGCCGGGCCCGAGG - Intronic
1133156387 16:3879939-3879961 GGCCCGGCCGCCCGTGCCCGGGG - Exonic
1133156496 16:3880237-3880259 GTCGCTGCCAGCCGGGCCCGGGG - Exonic
1133305190 16:4804041-4804063 TTCGGTGCTTCCCGGGCCCGGGG - Exonic
1134567871 16:15266672-15266694 GGGGCTGGTGCCCGGGGCTGGGG - Intergenic
1134734564 16:16489681-16489703 GGGGCTGGTGCCCGGGGCTGGGG + Intergenic
1134932902 16:18222225-18222247 GGGGCTGGTGCCCGGGGCTGGGG - Intergenic
1136115858 16:28093900-28093922 GGCTCTTCTGCCCAGGCCCAAGG + Intergenic
1136141933 16:28293513-28293535 GGCGCAGCTCCCCGGCCCCACGG + Intronic
1138597343 16:58036063-58036085 TGCCCTGCTGCCTGGGCCCTCGG + Intronic
1140442572 16:74999080-74999102 GGCGCGGCTGGCGGGGCCGGCGG + Exonic
1140661038 16:77191501-77191523 GACACTGCTGCCCCGGCCCCCGG + Exonic
1141701740 16:85645488-85645510 GGGGCAGCTGCCCTGTCCCGAGG - Intronic
1141946936 16:87317148-87317170 GGCGCTGCTGCCGGGGGGCCGGG - Exonic
1141962691 16:87420177-87420199 TGTGCTGCTGCCGGGGCCCTGGG - Intronic
1141982068 16:87556913-87556935 GCTGCTCCTGCCCGGGCCAGAGG - Intergenic
1142145068 16:88489497-88489519 GTCTGAGCTGCCCGGGCCCGTGG + Intronic
1142291005 16:89193525-89193547 GGGGCTGCTGCACGGCCCCCAGG + Exonic
1142518868 17:491421-491443 GGCGCTCCTGCCCGTCCCGGAGG + Intergenic
1142855104 17:2724699-2724721 GGCGCCGGGGCCCGGGCGCGGGG + Intergenic
1143025723 17:3941069-3941091 GGCGCTGCTGCTCGGGGCTGAGG + Exonic
1143862559 17:9901591-9901613 GACGCTGCTGCCCTGGGCTGTGG - Intronic
1144062788 17:11598714-11598736 GGTGGTGCGGCCCGGGCCCAGGG + Exonic
1144101896 17:11948894-11948916 GGTGCTGCTGCCCTGTCCCCTGG + Intronic
1144127912 17:12220155-12220177 GGTGCTGCTGCCAGGGGCTGTGG + Intergenic
1145027095 17:19476089-19476111 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1145268155 17:21390332-21390354 GGCACTGCTCCCCAGGCCCCAGG + Intronic
1145418189 17:22741480-22741502 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1146058702 17:29593550-29593572 GGCGCCGGAGCCGGGGCCCGGGG - Exonic
1146886550 17:36474692-36474714 GTGGCTGCTGCCCAGGCCCCAGG - Intergenic
1147172646 17:38631078-38631100 GGGGCGGCTGGCCGGGCGCGGGG - Intergenic
1147725209 17:42562606-42562628 GGCCATGCTGCCCAGGCCTGCGG - Exonic
1148561252 17:48607881-48607903 GCCGGTGGTCCCCGGGCCCGCGG + Exonic
1148787157 17:50150988-50151010 GGCGGAGCGGCCCGGGCCGGCGG - Intergenic
1149491010 17:57085308-57085330 GGCGCTGCGGGCCGGGCCGCGGG + Intronic
1149994617 17:61400094-61400116 CGCGCCGCCGCCCGGGCCGGGGG + Exonic
1150007240 17:61477366-61477388 GGCGCGGCTGCCAGAGCCCCCGG - Intronic
1150311081 17:64129975-64129997 GCTGCTGCTGCCCGGCCTCGGGG - Exonic
1150488516 17:65560076-65560098 GGCGCTGCTGGCGTGTCCCGGGG - Intronic
1150643554 17:66964865-66964887 GGCGCGGCGGGCCGGGCCGGCGG + Intergenic
1150840138 17:68600159-68600181 GCCGCTGCAGCCCTGGGCCGGGG + Intronic
1151491127 17:74432707-74432729 GGCGCTGCGGCTCGGGCTGGAGG + Intronic
1152070647 17:78132190-78132212 GGGGGTGCTGCGTGGGCCCGAGG - Intronic
1152634934 17:81427029-81427051 GACCCTGGTGCCCGGGCCAGGGG + Intronic
1152737584 17:82004969-82004991 CGACCTGCTGCCCGGGGCCGGGG + Intronic
1152807345 17:82362448-82362470 GGGGCTGCTGCCAGGGTCCCTGG - Exonic
1153636376 18:7117241-7117263 GGGGCTGTTGGCCGGGCGCGGGG - Intronic
1154278232 18:12979978-12980000 GGGGCGGCTGGCCGGGCGCGGGG + Intronic
1154367705 18:13726488-13726510 GGCGCGGCTGGCGGGGCCGGGGG - Exonic
1155570355 18:27185387-27185409 GGCGGAGCTGCCCGGGCGGGCGG - Intergenic
1157602403 18:48902149-48902171 GGCGGGGCGGCCCTGGCCCGGGG - Intergenic
1159054434 18:63450378-63450400 GGGGCGGCTGGCCGGGCTCGGGG + Intergenic
1160393898 18:78558324-78558346 GGCGCTGCTGCCCCCGGCCCAGG + Intergenic
1160548781 18:79680019-79680041 GGCGCAGCGGCGCGGGCCCCGGG - Exonic
1160725499 19:616314-616336 GGAGCTGCTGGCCGGGCGTGTGG - Exonic
1160807841 19:1000476-1000498 GGCGCTGGGGCCGGGGTCCGCGG + Exonic
1160849607 19:1183999-1184021 GGATCCGCTGCCCGGCCCCGAGG + Intronic
1160935423 19:1592433-1592455 GGCGCCCCTGCCCCGGGCCGCGG - Intronic
1161068986 19:2251184-2251206 GGCGCGGAGGCCCGGGCCGGGGG - Exonic
1161115981 19:2496679-2496701 GGCGCTGCTGCCAGGCACAGTGG - Intergenic
1161210447 19:3062661-3062683 GGGGCCGCTGCCCGGGGCGGGGG - Intronic
1161412465 19:4124011-4124033 GGCGCTGCGGGCCTGGGCCGAGG + Exonic
1161720009 19:5897414-5897436 GGCCCTGGTGCCAGGGCCCGTGG - Intronic
1161854220 19:6754301-6754323 GGCGCTGCGGCCAGGGGCGGCGG - Exonic
1161973348 19:7596020-7596042 TCCGCAGCGGCCCGGGCCCGGGG - Exonic
1162128236 19:8510866-8510888 GGCGCGGCGGCCCGGCCGCGGGG + Exonic
1162398397 19:10430925-10430947 GGCGTTCCTGCCCGAGCCCCTGG + Intronic
1162398767 19:10432355-10432377 CGCGCTGCTGGCCAGGCCCAAGG - Intronic
1162470866 19:10871471-10871493 GTCGCCGCGGCCCGGCCCCGTGG - Intergenic
1162954670 19:14091232-14091254 AGCGCGGCAGCCCCGGCCCGCGG - Intergenic
1163432049 19:17274061-17274083 TGCGATGCTCCCCGGGCCCCAGG - Intronic
1163945186 19:20529738-20529760 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
1164192069 19:22926110-22926132 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1164658658 19:29942749-29942771 GGCCCAGCTGCCCGGGCCCCCGG + Intronic
1164684557 19:30158252-30158274 GGAGCTGCTGCCTGGACCCCAGG - Intergenic
1164845175 19:31426155-31426177 TGCTCTGCTGCCCAGGCCAGAGG + Intergenic
1165809384 19:38601538-38601560 GGATCTGCTGCCTGGCCCCGCGG - Intronic
1166102068 19:40576891-40576913 GCCGCTGCTGCCATGGCCCCCGG - Exonic
1166330629 19:42076243-42076265 GGAGCCGTGGCCCGGGCCCGGGG + Intronic
1166367288 19:42284160-42284182 GGCGCTGAGCCTCGGGCCCGGGG + Intronic
1166938144 19:46347295-46347317 GGAGCTGCAGCCTGGGCGCGGGG + Intronic
1167289560 19:48616891-48616913 GGCACAGCTGCCCTGGCCTGGGG - Intronic
1167428423 19:49441435-49441457 GACGCGGCCGCCCGGGCCCGCGG - Exonic
1167578460 19:50328887-50328909 CGCGCCGGTCCCCGGGCCCGCGG + Exonic
1167614468 19:50524814-50524836 GGGGCTGCTGGCTGGGCTCGGGG - Intronic
1167795236 19:51704382-51704404 CGAGCTGCTGGCCAGGCCCGAGG + Intergenic
1168092706 19:54096109-54096131 GGTGGCGCTGCCCGGGCCGGTGG - Exonic
1168309196 19:55452168-55452190 GGCGCCGCCGCCCGGTCCCAGGG + Intergenic
924962435 2:46505-46527 TGCCCAGCTGCCCAGGCCCGGGG + Intronic
926776249 2:16425967-16425989 GGCCCTGCTCCCAGGGCCCTGGG + Intergenic
927685630 2:25168664-25168686 GGAGCAGCTCCCCGGGCCAGGGG + Exonic
927707627 2:25306587-25306609 GGGGCTGCAGCCCTGGCACGAGG - Intronic
927833310 2:26371082-26371104 GGGGCGGCTGGCCGGGCCAGGGG + Intronic
928094169 2:28393752-28393774 GCCGCTGCTGCCCCGGGACGAGG - Exonic
928558016 2:32447631-32447653 GGCGCGGCTGGCCGGGCAGGGGG + Intronic
929614788 2:43298013-43298035 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
930202134 2:48556773-48556795 GGCACGGCTGCCCGGGCGGGGGG + Intronic
930202235 2:48556999-48557021 GGCACGGCTGCCCGGGCGGGGGG + Intronic
930725203 2:54675332-54675354 GTCCCTGCTGCCTGGCCCCGTGG + Intergenic
931656269 2:64512294-64512316 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
932191072 2:69741973-69741995 GGCGCGGCCGTCCCGGCCCGGGG + Exonic
933772645 2:85754047-85754069 GGCGCAGCTGCCCGGGGCGAGGG + Exonic
934014634 2:87866762-87866784 GTGGCTGCTGCCCAGGCCCCAGG + Intergenic
934309682 2:91851954-91851976 GGGGCGGCTGCCCGGGCGGGGGG - Intergenic
934754639 2:96816619-96816641 GGCGCTGCTGGCGGTGCGCGTGG + Exonic
935396928 2:102619426-102619448 CGCGCACCTGCCCGAGCCCGCGG - Intergenic
936038415 2:109130043-109130065 GGCGGTGCTGCCCGCGGCCGCGG - Exonic
937271962 2:120658781-120658803 GGGGCTGCTGCAGGGGCACGTGG - Intergenic
937334402 2:121052625-121052647 GGAGCTGCTGCATGGGCCAGTGG - Intergenic
938116038 2:128603562-128603584 GGCGCTGTAGCCCGGCCCTGGGG - Intergenic
938293252 2:130161477-130161499 GGGGGTGCTGCGCTGGCCCGCGG - Intronic
938777009 2:134550864-134550886 GGCTCTGCTCCCAGGGCCCCTGG + Intronic
940354067 2:152718899-152718921 GGCTCTGCTGCCCGCGGCCGCGG - Exonic
941909655 2:170751733-170751755 AGCGCTGCCGCCGGGGCCTGGGG + Intergenic
943297125 2:186154036-186154058 GGCGCGGCTGGCCGGGCGGGGGG + Intergenic
944711213 2:202336486-202336508 GGCCCTGCTGCCCTGGCTCTGGG + Intergenic
945110434 2:206356478-206356500 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
945110456 2:206356527-206356549 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
945110607 2:206356877-206356899 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
945835791 2:214835471-214835493 GGGGCGGCTGCCCGGGCGGGGGG + Intergenic
945988223 2:216371643-216371665 GGCAGCGCTGCCCGGGCGCGGGG - Exonic
948133688 2:235620252-235620274 AACGCTGCTGCCCGGGACCAGGG - Intronic
948140764 2:235670449-235670471 GGCGCTGCCGGCCAGGTCCGCGG - Intronic
948339504 2:237238133-237238155 GGCTCTGCTGCCTGTGCCGGTGG + Intergenic
948461074 2:238130328-238130350 GGCCCTGCTGCCCGAGCCCCTGG + Exonic
948468616 2:238163870-238163892 GGCACTGCTGGCCGCGCCCCTGG + Exonic
948983872 2:241508467-241508489 GGCGCTGCAGAGCGGGCCGGGGG - Exonic
1168804344 20:663668-663690 GGCTCAGCTGGCCGGGCCGGCGG + Exonic
1169449894 20:5702111-5702133 GGGGCGGCTGGCCGGGCCTGGGG - Intergenic
1170150476 20:13221631-13221653 GGCTCCGCTTCCCGGGCCCGCGG - Intergenic
1172051548 20:32122183-32122205 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
1172335480 20:34112160-34112182 AGCGCTGCCGCCGGGGCCTGGGG - Exonic
1172402226 20:34659439-34659461 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1172721108 20:37000605-37000627 GTGGCGGCTGGCCGGGCCCGGGG - Intronic
1174218710 20:48936053-48936075 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
1175428932 20:58889446-58889468 GGCGCCGCTGCCTTGCCCCGGGG + Intronic
1175429313 20:58891108-58891130 CGGGCTGCTGCCCGAGCCCGGGG + Intronic
1175806480 20:61831938-61831960 GCCGCTCCTGCCCAGGCCCGAGG - Intronic
1175897748 20:62346836-62346858 GGCCCCGGTGCCCGGGCCTGTGG - Intronic
1175926780 20:62475204-62475226 GCCGCCGCTGCCGGGCCCCGAGG + Exonic
1175949502 20:62575844-62575866 GGACCTCCTGACCGGGCCCGGGG + Intergenic
1175949854 20:62577629-62577651 GGGGCTGGTGCCCGGTCCCTGGG + Intergenic
1176021053 20:62962624-62962646 GACGCTGCTGACCGGGGCGGTGG + Exonic
1176128968 20:63488226-63488248 GGGGCGGGGGCCCGGGCCCGGGG + Exonic
1176143211 20:63554093-63554115 GACGCTGCGGCCCGGGGGCGGGG - Exonic
1176414922 21:6468520-6468542 GGCGGAGCTGCGCGGGCCGGAGG - Intergenic
1177177911 21:17719251-17719273 GGGGCTGCTGGCCGGGCAGGGGG + Intergenic
1177178143 21:17719785-17719807 GGGGCTGCTGGCCGGGCAGGGGG + Intergenic
1178075730 21:29011952-29011974 GGCGCGGCTGGCCGGGTCGGGGG - Intronic
1178505239 21:33157233-33157255 GGCACTGCTGCCCAGGCCATGGG - Intergenic
1178951582 21:36990126-36990148 GGCGCTGCGGGCCGGGACAGGGG - Intronic
1178961915 21:37073322-37073344 GCTGCTGCTGCCCGCGTCCGAGG + Intronic
1179690422 21:43076842-43076864 GGCGGAGCTGCGCGGGCCGGAGG - Intronic
1179893682 21:44350222-44350244 GGCGGTGCTGCGCGGGGACGCGG + Intronic
1179994822 21:44969157-44969179 GGCCCAGCTGCCCAGGCTCGAGG + Intronic
1180159042 21:45990915-45990937 GGGGCTGCTGCCAGAGGCCGCGG + Intronic
1181031378 22:20150187-20150209 GGAACTGCTGCCCCGGCCCCAGG + Exonic
1181039416 22:20184818-20184840 GACGCTGCTGCCCCCACCCGAGG + Intergenic
1181040088 22:20187987-20188009 GGCCCTGCAGCCAGGGCCTGGGG - Intergenic
1181511955 22:23393215-23393237 GGAACTGCTGCCCCGGCCCCAGG - Intergenic
1182294955 22:29307121-29307143 GGCAATGCTCCCCGGGGCCGCGG + Exonic
1183264554 22:36817271-36817293 GGGGCTGCGGCCAGGGCACGAGG + Intronic
1183540751 22:38428081-38428103 GGCGCTTCCGCCGGGGCACGTGG + Exonic
1183736970 22:39649624-39649646 GTCGGTGCTGCCCAGGCCCGAGG - Exonic
1183931072 22:41236605-41236627 GGCTCTGGAGCCCGGGCCCCAGG + Exonic
1183982969 22:41553310-41553332 GGGGCTGCTGCGATGGCCCGGGG - Intergenic
1184328701 22:43812049-43812071 GGCGCTGCTGCCCACCCCCAGGG - Intronic
1184465846 22:44668657-44668679 GGCGCCCCCGCGCGGGCCCGAGG + Intronic
1185027543 22:48424406-48424428 GGAGCTGCTGCCCATGCCGGGGG + Intergenic
1185245650 22:49771504-49771526 GGCGCTGCTCCCAGAGCGCGAGG - Intergenic
1185295058 22:50049090-50049112 GGCCCTGCTGCCCGGTCAAGGGG + Intronic
1185321277 22:50201219-50201241 GGCGCCGCCGCCCGGTCCCGAGG + Exonic
1185321292 22:50201252-50201274 CGCGCCGCGGCCCGTGCCCGGGG + Exonic
1185420200 22:50730771-50730793 GGCCCCGCCGCCCGGGCCCCCGG - Intergenic
949987531 3:9552723-9552745 GGCGCTCCGTCCCGGGCCGGCGG - Exonic
950940382 3:16885089-16885111 GGCGCCGAGGGCCGGGCCCGGGG - Intronic
952817968 3:37462194-37462216 GAGGCTGCTGCCCTGGCCTGGGG - Intronic
954295939 3:49674488-49674510 GGTGCTGCTGAGCGAGCCCGAGG + Exonic
954483489 3:50823772-50823794 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
956761180 3:72446838-72446860 GGCTATCCGGCCCGGGCCCGGGG - Exonic
959415671 3:106074776-106074798 GGGGCTGCTGGCCGGGCGGGGGG + Intergenic
960030018 3:113046521-113046543 GGGGCTGCTGGCCGGGCGGGGGG + Intergenic
960030066 3:113046648-113046670 GGGGCTGCTGGCCGGGCGGGGGG + Intergenic
961013479 3:123450043-123450065 GGCGCTGGAGCCCTGGCCGGGGG - Intergenic
963028422 3:140942297-140942319 GGGGGTGAGGCCCGGGCCCGAGG + Intronic
965590405 3:170356913-170356935 GGCTCTGCTCCCCGCCCCCGCGG - Intergenic
966378931 3:179323704-179323726 GGCGCTGCGGCCCTGCCCGGCGG + Intronic
966866115 3:184260032-184260054 GGCCCTGCAGCCCCCGCCCGCGG + Exonic
966886840 3:184381588-184381610 GGCGCTGAGGAGCGGGCCCGTGG + Exonic
967055511 3:185825662-185825684 TGCGCTGCTGCCAGGGCAAGCGG + Intergenic
967825081 3:193871069-193871091 GGCTCTGCTGCCGTGGCCCCAGG - Intergenic
967859487 3:194140899-194140921 CGCGCGGCAGCCGGGGCCCGCGG - Intergenic
967859717 3:194141658-194141680 GGCGCTGGGGCCCGGGGCGGGGG - Intergenic
968087057 3:195878544-195878566 GGAGCGGCTGCCCCGGCCCGAGG - Exonic
968286196 3:197510249-197510271 CGCGCTGCCGCCCGAGCCTGAGG - Exonic
968570884 4:1340197-1340219 CGCCATGCTGCCCGGGCCCCGGG - Intergenic
968924264 4:3538856-3538878 GGGGCGGCTGGCCGGGCCAGGGG + Intergenic
969353409 4:6611235-6611257 GGCGCTGCAGCACAGGCCCGTGG + Exonic
970332954 4:15003533-15003555 GGCGGCGCTGCCCTCGCCCGCGG - Exonic
971027447 4:22602442-22602464 GCCGTTGCTGCCAGGGCCCTTGG - Intergenic
971195751 4:24471008-24471030 CGCGCTCCCTCCCGGGCCCGGGG - Intergenic
971459037 4:26874105-26874127 GGCTCTGCTGCCCTGGCTCTGGG + Intronic
972396520 4:38663732-38663754 CGCGCCGCCGCCCGAGCCCGGGG - Intergenic
974021169 4:56693464-56693486 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
976002098 4:80386228-80386250 GGGGCTGCAGGCCGGGGCCGAGG - Intronic
978123573 4:105110325-105110347 GGGGCTGCTGGCCGGGCGGGGGG - Intergenic
979941808 4:126771432-126771454 GGCGCCTCTGCCCGGCCCCCCGG + Intergenic
980920744 4:139083690-139083712 GCCGCTGCTGCCCGCGTTCGGGG - Intronic
982257586 4:153466078-153466100 CGCGCTGCGGGGCGGGCCCGCGG + Intergenic
982615698 4:157636611-157636633 GGGGCTGCTGGCCGGGCGGGGGG + Intergenic
982615930 4:157637158-157637180 GGCGCGGCTGGCCGGGCGGGGGG + Intergenic
984915536 4:184719692-184719714 GGCTGTGCTGCCTGGGCCTGGGG - Intronic
985493365 5:191802-191824 GGCGCTGGTGCGCGGCCTCGCGG + Exonic
985544829 5:504371-504393 GGGGCTGCAGCCAGGGCCCAGGG + Intronic
985706894 5:1406537-1406559 GGGGCTGTTGCCGGGGCGCGGGG - Intronic
986330721 5:6714253-6714275 GGCGCTGGGGCCCGCGGCCGAGG + Intergenic
987088124 5:14487973-14487995 GGCGAAGCGGCCCCGGCCCGGGG - Exonic
989061457 5:37415437-37415459 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
991435946 5:66596972-66596994 CGCGCTGCTGCCCCGGGGCGCGG - Exonic
992042426 5:72848683-72848705 GGCCCTGGTGCCTGGGCCGGGGG + Intronic
992574681 5:78097296-78097318 GGGGCTGCTGGCCGGGCGGGGGG - Intronic
996397472 5:123027483-123027505 AGCGCTGGTGCCCGTGCCCTCGG - Intronic
998152042 5:139763117-139763139 GGCTCTGCTGGGCGGGCCCAGGG + Intergenic
999181016 5:149670338-149670360 GGGGCGGCTGGCCGGGCCAGGGG + Intergenic
999767918 5:154755242-154755264 CGCGCCGCTGGCCGGGCCCTGGG - Intronic
1000296404 5:159916624-159916646 GGCGCGCCTGGCCGGGCTCGCGG - Intergenic
1002186057 5:177455376-177455398 CGTGCGGCTGCGCGGGCCCGTGG - Exonic
1002561725 5:180087084-180087106 GGCTCTGCTGCCCAGGCTGGAGG + Intergenic
1002633604 5:180596484-180596506 GGCGCTGGACCCCGGCCCCGAGG + Intergenic
1002861175 6:1080654-1080676 GGCGGTGCAGCCGGGGCCCACGG - Intergenic
1003911496 6:10747777-10747799 CGCGCTGCGCCCCGGGGCCGCGG - Exonic
1004349712 6:14880441-14880463 GGGGCTGCTGCCTGAGCCCCTGG - Intergenic
1004414848 6:15415572-15415594 GGGGCTGCTGGCCGGGCGGGGGG + Intronic
1004627922 6:17393927-17393949 GGCGCGGCGACCCGGGCGCGGGG + Intronic
1006141345 6:31931919-31931941 GGCGCGGCTGGCCGGGCGGGGGG + Intronic
1006209683 6:32384792-32384814 GGCGCGGCTGGCCGGGCGGGGGG + Intergenic
1006634574 6:35452638-35452660 GGCGCTGCAGGCGGGGCCTGAGG + Exonic
1006645416 6:35511842-35511864 GGCGCTGCCTCGCGGACCCGCGG - Intronic
1007403180 6:41616452-41616474 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1007775769 6:44223638-44223660 GCAGGTGCTGCCCGGGGCCGGGG + Exonic
1010239291 6:73601423-73601445 GGGGCGGCTGGCCGGGCGCGGGG - Intronic
1010981661 6:82376293-82376315 GGTGGAGCTGCCCGGGACCGTGG - Intergenic
1012465813 6:99515393-99515415 GACGCTGCGGCCCGGCCCGGCGG - Intronic
1012550961 6:100464572-100464594 GGGGCTGCTGGGCGGGCGCGGGG + Intronic
1013322607 6:109009515-109009537 GGCGCTGCAGCCAGGAGCCGCGG - Intronic
1014078749 6:117265555-117265577 GGCGCTTCTGCCCTGGAGCGCGG + Exonic
1014798321 6:125749669-125749691 GCCGCGCCTGCCCAGGCCCGGGG + Exonic
1015366322 6:132401375-132401397 GGGGCTGCTCCCCGGGACGGCGG - Exonic
1015965469 6:138692713-138692735 CGCGCGGCTGCGCCGGCCCGAGG - Intergenic
1017690705 6:156961448-156961470 GCCGCTGCTGGCGGGGCCCAAGG - Intronic
1018091226 6:160348229-160348251 GGGGCTGCTGCGGGCGCCCGGGG + Intergenic
1018295411 6:162339302-162339324 GGCGCGGCTGGCCGGGCGGGGGG - Intronic
1018702960 6:166441858-166441880 GGAGCAGCTGCCGGGGGCCGGGG + Intronic
1018743008 6:166744581-166744603 GGCCCTGCTGCACGGGTGCGCGG - Intronic
1018952522 6:168388619-168388641 GGAGCTGCCGCCAAGGCCCGAGG - Intergenic
1019076712 6:169393890-169393912 GCAGCTGCCGCCCAGGCCCGAGG - Intergenic
1019455159 7:1123087-1123109 GGCCCTGGTGCCCAGGACCGAGG + Intronic
1019473300 7:1232598-1232620 CGGGCTGGTGCCTGGGCCCGGGG - Intergenic
1019745862 7:2700140-2700162 GCCGCTCCTGCCCAGGCCTGGGG - Intronic
1019981418 7:4624288-4624310 GGGGCTGCTGGCCGGGCGGGGGG - Intergenic
1019989945 7:4683531-4683553 GTCCCTGCTGCCTGGGCCTGGGG + Intronic
1020022687 7:4878505-4878527 TGCTCTGCTGCCCGGGCTGGAGG - Intronic
1020955919 7:14740031-14740053 GCAGCTGCTGCCCAGGCCCCAGG + Intronic
1021672342 7:23046256-23046278 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
1023972400 7:45000565-45000587 CGAGCCGCTGCCCGGGCCAGAGG - Intronic
1024247314 7:47480066-47480088 GGCGCCGCTGGCCGAGCCTGGGG + Intronic
1024538739 7:50459843-50459865 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1024538890 7:50460196-50460218 GGGGCGGCTGGCCGGGCCAGGGG - Intronic
1026466906 7:70662101-70662123 AGCGCAGCTGCCTGGGCCTGTGG - Intronic
1026968372 7:74454124-74454146 GGCGCCCCGGCCCCGGCCCGCGG - Exonic
1027266118 7:76496161-76496183 GGCTCTGCTGCCCAGGCTGGTGG + Intronic
1027317495 7:76994279-76994301 GGCTCTGCTGCCCAGGCTGGTGG + Intergenic
1029113990 7:98228100-98228122 GGTGCTGCTGGCCAGGCCTGTGG + Exonic
1029430011 7:100523502-100523524 GGGGCGGCTGGCCGGGCACGGGG + Intergenic
1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG + Intergenic
1029549981 7:101232512-101232534 GGCGCTGCGGGGAGGGCCCGGGG + Exonic
1029569270 7:101359370-101359392 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
1030216039 7:107044748-107044770 GGCCCGGCTGGCCCGGCCCGCGG - Exonic
1032037630 7:128531655-128531677 GCGGCTGCTGCCCGGGCGGGGGG + Intergenic
1032117001 7:129126301-129126323 GCCGCCGCTGCCGAGGCCCGAGG - Intergenic
1032117015 7:129126360-129126382 GGCGCTGCGGGCCTGGTCCGAGG - Intergenic
1032569832 7:132985514-132985536 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1033477163 7:141702108-141702130 GCCGCTGCTGCGCTGGGCCGAGG - Exonic
1033661968 7:143408654-143408676 GGGGGTGCTGGCCGGGCCCCGGG + Intronic
1034086485 7:148327176-148327198 GGGGCTGCTGCAGTGGCCCGTGG + Intronic
1034234140 7:149554706-149554728 GGCGCGGCTGGCCGGGCGGGGGG - Intergenic
1034234237 7:149554932-149554954 GGGGCGGCTGGCCGGGCTCGGGG - Intergenic
1034306293 7:150047697-150047719 GGCGCCGCCGCCTGCGCCCGCGG + Intergenic
1034450443 7:151134491-151134513 GGGGCTGGTGCCCGGGGCTGTGG - Exonic
1034800554 7:154052956-154052978 GGCGCCGCCGCCTGCGCCCGCGG - Intronic
1035233912 7:157484204-157484226 GGCGCTGCTGCCCTGGCTGTGGG - Intergenic
1035522328 8:284730-284752 GGCCCTGCTGCGTCGGCCCGTGG - Intergenic
1036454251 8:8893564-8893586 CGCGCTCCCGCCCGAGCCCGGGG - Exonic
1036578814 8:10054364-10054386 GGCGCTGCTGGCGGGGCTGGAGG - Exonic
1036775960 8:11613331-11613353 GCCGCTGCCGCCCGGGCCTGAGG - Intergenic
1037273806 8:17156731-17156753 GGCGCTGCTGCCCGGGCCCGAGG - Exonic
1037529211 8:19757313-19757335 GCCGCTGCTCCCCGCCCCCGGGG - Intronic
1037977580 8:23224572-23224594 GTCGCTCCTGCCTGGCCCCGGGG + Intronic
1038554119 8:28494555-28494577 GGAGCGGGGGCCCGGGCCCGCGG + Intronic
1038798202 8:30727733-30727755 GCTGCTTCTGCCCGAGCCCGCGG - Exonic
1039454602 8:37698400-37698422 GGCGGCGCTGCCCAGGCCCGAGG - Exonic
1039873615 8:41567408-41567430 GGCGCAGCAGCCCGGGCGTGGGG - Intergenic
1039936604 8:42051658-42051680 CGCCCGGCTGCCCCGGCCCGCGG - Intronic
1040065439 8:43140795-43140817 GGTGCTGCGGCCGGGCCCCGCGG + Intronic
1042235866 8:66613025-66613047 GGCGCTGCGGGCCGGGGTCGGGG - Exonic
1042920177 8:73912452-73912474 GGCGCTGCTGCAGGGGCTCCAGG - Intergenic
1042962913 8:74321633-74321655 GGCGCCGAGGCCCGGCCCCGCGG + Intronic
1044707783 8:95025107-95025129 GCGGCGGCTGCCCGGGCCGGAGG + Exonic
1045368915 8:101501595-101501617 GGGGCTGCTGCCGGGGCCTAGGG + Intronic
1048766772 8:137853300-137853322 GGCACTGCTCCCCGGGGCCTGGG - Intergenic
1048838858 8:138547053-138547075 GGTGCTGCTGCCCATGCCCCTGG + Intergenic
1049473301 8:142785786-142785808 GGCCCTGCTGCCCTTGCCCTAGG + Intronic
1049620941 8:143598014-143598036 GGGGCCGCGGCCCGGGCGCGGGG - Exonic
1049639344 8:143707606-143707628 GGGGCTGGTGGCCGGGCCGGGGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049668432 8:143859078-143859100 GGAGCTGCGGCCGGGCCCCGGGG + Exonic
1049668851 8:143860686-143860708 GGAGCTGCGGCCGGGCCCCGGGG + Exonic
1049669266 8:143862288-143862310 GGAGCTGCGGCCGGGCCCCGGGG + Exonic
1049669678 8:143863881-143863903 GGAGCTGCGGCCGGGCCCCGGGG + Exonic
1049670093 8:143865489-143865511 GGAGCTGCGGCCGGGCCCCGGGG + Exonic
1049741726 8:144244291-144244313 GGCCCTGCTGCCTGAGCCCAAGG + Exonic
1051180756 9:14409493-14409515 GTTGCTGCTGCCTGGGCCAGGGG - Intergenic
1055375902 9:75648166-75648188 GCAGCTGCTGCCAGGGCCCCAGG - Intergenic
1056152729 9:83804584-83804606 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1056495088 9:87148437-87148459 GGCCCTGTTTCCCGGCCCCGCGG + Intergenic
1056624753 9:88244875-88244897 GGGGCGGCTGGCCGGGCCCGGGG + Intergenic
1057154795 9:92830937-92830959 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
1057155048 9:92831519-92831541 GGGGCGGCTGGCCGGGCCAGGGG + Intergenic
1057218157 9:93240962-93240984 GGCACTGCTGCCCTGGGCCGGGG + Intronic
1058661385 9:107271818-107271840 GGGGCGGCTGGCCGGGCGCGGGG - Intergenic
1058747107 9:108002523-108002545 AGGGCTGCTGCCCTGGCCTGTGG - Intergenic
1058885709 9:109320281-109320303 GGCGCTGCCCGCCGCGCCCGGGG - Exonic
1059120897 9:111641011-111641033 GGGGCGGCTGGCCGGGCGCGGGG - Intronic
1059633919 9:116154294-116154316 GGCGCAGGTGGCCGGGCCGGCGG - Exonic
1060115280 9:120935488-120935510 GGAGCTGGTGCCAGGGCCCCAGG - Intergenic
1060478054 9:124000003-124000025 GGCGCCGGGGCCCGGGCCGGAGG - Intergenic
1060952416 9:127612541-127612563 GGCCCTGCGCCCCGGGCCTGAGG + Intronic
1061047768 9:128176373-128176395 GTCCCTGCTGCCCGTGCCCCGGG - Exonic
1061540930 9:131277565-131277587 AGAGCGGCTGCCCGGGCCAGCGG - Intergenic
1061757153 9:132823262-132823284 GGTGCTGCTGCTCGGGCCTGTGG - Exonic
1061858405 9:133455563-133455585 GCGGCTCCTGCCCGGGCCCCAGG + Exonic
1061875349 9:133540821-133540843 GGCGCTGTGGCCAGGCCCCGGGG - Intronic
1062491874 9:136808618-136808640 GGCCCGGCTGCCCGGCCCGGGGG + Intronic
1062491889 9:136808665-136808687 GGCGCGGCGCCCCGGGCCGGCGG - Intronic
1062567281 9:137168872-137168894 GGCGGGGCTCCCCGGGTCCGCGG + Exonic
1062601445 9:137320275-137320297 GGGGCTGCAGCCAGGGCCCAGGG + Intronic
1203771979 EBV:54115-54137 GGAGCTGCTGACCGAGGCCGAGG - Intergenic
1186880824 X:13864466-13864488 GGGGCTGGTGCCCAGGCACGTGG + Intronic
1189210415 X:39278174-39278196 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1189325693 X:40109512-40109534 GGCTCCGCCGCCCGGGGCCGGGG - Intronic
1189717725 X:43882541-43882563 AGCTCTGCAGCCCAGGCCCGGGG + Intergenic
1193443121 X:81567391-81567413 GGCCCTGCTGCTTGGGCCAGCGG - Intergenic
1195278929 X:103310776-103310798 CGCGCTGCTGCCCGGGGATGGGG + Exonic
1196443299 X:115732817-115732839 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196444223 X:115737120-115737142 GCCGCTGCTGGCCGGCGCCGGGG - Intergenic
1196445620 X:115844732-115844754 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196446291 X:115847713-115847735 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196446962 X:115850694-115850716 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196447631 X:115853677-115853699 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196448301 X:115856656-115856678 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196448970 X:115859647-115859669 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196449641 X:115862638-115862660 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196450310 X:115865621-115865643 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196450980 X:115868606-115868628 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196451651 X:115871585-115871607 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196452322 X:115874572-115874594 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196452992 X:115877541-115877563 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196453662 X:115880534-115880556 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196454331 X:115883543-115883565 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1196455411 X:115888615-115888637 GCCGCTGCTGGCCGGCGCCGGGG + Intergenic
1197736048 X:129850885-129850907 GGGGCTGCTGGCCGGGCGGGGGG - Intergenic
1199129844 X:144171749-144171771 GTGGCTGCTGCCCAGGCCCCAGG - Intergenic
1199948203 X:152683862-152683884 GGCGATGCAGCCAGGGCCAGTGG + Intergenic
1199961476 X:152784592-152784614 GGCGATGCAGCCAGGGCCAGTGG - Intergenic
1200058771 X:153474808-153474830 AGCGCTGCTGCACGTGCGCGGGG + Intronic
1200233594 X:154458143-154458165 GCCGCTGCTCCCCGGGGCCAGGG - Intergenic
1200292557 X:154886608-154886630 GGCGCTCTTCCACGGGCCCGGGG + Exonic
1200292674 X:154887058-154887080 GGCACCCCAGCCCGGGCCCGGGG + Exonic
1200339401 X:155382348-155382370 GGCGCTCTTCCACGGGCCCGGGG + Exonic
1200339518 X:155382798-155382820 GGCACCCCAGCCCGGGCCCGGGG + Exonic
1200346952 X:155457895-155457917 GGCACCCCAGCCCGGGCCCGGGG - Exonic
1200347069 X:155458345-155458367 GGCGCTCTTCCACGGGCCCGGGG - Exonic
1200829455 Y:7676968-7676990 GGGGCTGGTGGCAGGGCCCGAGG - Intergenic