ID: 1037273812

View in Genome Browser
Species Human (GRCh38)
Location 8:17156746-17156768
Sequence GCAGCGCCAGGCGGCGGTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037273805_1037273812 -7 Left 1037273805 8:17156730-17156752 CCCTCGGGCCCGGGCAGCAGCGC 0: 1
1: 0
2: 0
3: 20
4: 272
Right 1037273812 8:17156746-17156768 GCAGCGCCAGGCGGCGGTGCCGG 0: 1
1: 0
2: 6
3: 35
4: 343
1037273806_1037273812 -8 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273812 8:17156746-17156768 GCAGCGCCAGGCGGCGGTGCCGG 0: 1
1: 0
2: 6
3: 35
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037273812 Original CRISPR GCAGCGCCAGGCGGCGGTGC CGG Exonic