ID: 1037273812 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:17156746-17156768 |
Sequence | GCAGCGCCAGGCGGCGGTGC CGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 385 | |||
Summary | {0: 1, 1: 0, 2: 6, 3: 35, 4: 343} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1037273805_1037273812 | -7 | Left | 1037273805 | 8:17156730-17156752 | CCCTCGGGCCCGGGCAGCAGCGC | 0: 1 1: 0 2: 0 3: 20 4: 272 |
||
Right | 1037273812 | 8:17156746-17156768 | GCAGCGCCAGGCGGCGGTGCCGG | 0: 1 1: 0 2: 6 3: 35 4: 343 |
||||
1037273806_1037273812 | -8 | Left | 1037273806 | 8:17156731-17156753 | CCTCGGGCCCGGGCAGCAGCGCC | 0: 1 1: 0 2: 0 3: 35 4: 507 |
||
Right | 1037273812 | 8:17156746-17156768 | GCAGCGCCAGGCGGCGGTGCCGG | 0: 1 1: 0 2: 6 3: 35 4: 343 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1037273812 | Original CRISPR | GCAGCGCCAGGCGGCGGTGC CGG | Exonic | ||