ID: 1037273813 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:17156749-17156771 |
Sequence | GCGCCAGGCGGCGGTGCCGG CGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 414 | |||
Summary | {0: 1, 1: 0, 2: 5, 3: 37, 4: 371} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1037273805_1037273813 | -4 | Left | 1037273805 | 8:17156730-17156752 | CCCTCGGGCCCGGGCAGCAGCGC | 0: 1 1: 0 2: 0 3: 20 4: 272 |
||
Right | 1037273813 | 8:17156749-17156771 | GCGCCAGGCGGCGGTGCCGGCGG | 0: 1 1: 0 2: 5 3: 37 4: 371 |
||||
1037273806_1037273813 | -5 | Left | 1037273806 | 8:17156731-17156753 | CCTCGGGCCCGGGCAGCAGCGCC | 0: 1 1: 0 2: 0 3: 35 4: 507 |
||
Right | 1037273813 | 8:17156749-17156771 | GCGCCAGGCGGCGGTGCCGGCGG | 0: 1 1: 0 2: 5 3: 37 4: 371 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1037273813 | Original CRISPR | GCGCCAGGCGGCGGTGCCGG CGG | Exonic | ||