ID: 1037273814

View in Genome Browser
Species Human (GRCh38)
Location 8:17156750-17156772
Sequence CGCCAGGCGGCGGTGCCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037273805_1037273814 -3 Left 1037273805 8:17156730-17156752 CCCTCGGGCCCGGGCAGCAGCGC 0: 1
1: 0
2: 0
3: 20
4: 272
Right 1037273814 8:17156750-17156772 CGCCAGGCGGCGGTGCCGGCGGG 0: 1
1: 0
2: 2
3: 21
4: 252
1037273806_1037273814 -4 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273814 8:17156750-17156772 CGCCAGGCGGCGGTGCCGGCGGG 0: 1
1: 0
2: 2
3: 21
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037273814 Original CRISPR CGCCAGGCGGCGGTGCCGGC GGG Exonic