ID: 1037273819

View in Genome Browser
Species Human (GRCh38)
Location 8:17156771-17156793
Sequence GGTGCTGTACTGGATCCCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037273805_1037273819 18 Left 1037273805 8:17156730-17156752 CCCTCGGGCCCGGGCAGCAGCGC 0: 1
1: 0
2: 0
3: 20
4: 272
Right 1037273819 8:17156771-17156793 GGTGCTGTACTGGATCCCGGTGG 0: 1
1: 0
2: 1
3: 8
4: 85
1037273806_1037273819 17 Left 1037273806 8:17156731-17156753 CCTCGGGCCCGGGCAGCAGCGCC 0: 1
1: 0
2: 0
3: 35
4: 507
Right 1037273819 8:17156771-17156793 GGTGCTGTACTGGATCCCGGTGG 0: 1
1: 0
2: 1
3: 8
4: 85
1037273815_1037273819 -4 Left 1037273815 8:17156752-17156774 CCAGGCGGCGGTGCCGGCGGGTG 0: 1
1: 0
2: 1
3: 30
4: 335
Right 1037273819 8:17156771-17156793 GGTGCTGTACTGGATCCCGGTGG 0: 1
1: 0
2: 1
3: 8
4: 85
1037273809_1037273819 10 Left 1037273809 8:17156738-17156760 CCCGGGCAGCAGCGCCAGGCGGC 0: 1
1: 0
2: 4
3: 41
4: 461
Right 1037273819 8:17156771-17156793 GGTGCTGTACTGGATCCCGGTGG 0: 1
1: 0
2: 1
3: 8
4: 85
1037273810_1037273819 9 Left 1037273810 8:17156739-17156761 CCGGGCAGCAGCGCCAGGCGGCG 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1037273819 8:17156771-17156793 GGTGCTGTACTGGATCCCGGTGG 0: 1
1: 0
2: 1
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037273819 Original CRISPR GGTGCTGTACTGGATCCCGG TGG Exonic