ID: 1037275513

View in Genome Browser
Species Human (GRCh38)
Location 8:17173954-17173976
Sequence TTGGATACAGAGAGGCATCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037275508_1037275513 16 Left 1037275508 8:17173915-17173937 CCTTATCCAACGTGACTTGCTGT 0: 1
1: 0
2: 12
3: 20
4: 70
Right 1037275513 8:17173954-17173976 TTGGATACAGAGAGGCATCGAGG No data
1037275511_1037275513 -7 Left 1037275511 8:17173938-17173960 CCTTAAAAGAAGAAATTTGGATA 0: 1
1: 4
2: 10
3: 115
4: 710
Right 1037275513 8:17173954-17173976 TTGGATACAGAGAGGCATCGAGG No data
1037275507_1037275513 17 Left 1037275507 8:17173914-17173936 CCCTTATCCAACGTGACTTGCTG 0: 1
1: 0
2: 12
3: 24
4: 102
Right 1037275513 8:17173954-17173976 TTGGATACAGAGAGGCATCGAGG No data
1037275506_1037275513 27 Left 1037275506 8:17173904-17173926 CCAGAGTAATCCCTTATCCAACG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1037275513 8:17173954-17173976 TTGGATACAGAGAGGCATCGAGG No data
1037275509_1037275513 10 Left 1037275509 8:17173921-17173943 CCAACGTGACTTGCTGTCCTTAA 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1037275513 8:17173954-17173976 TTGGATACAGAGAGGCATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037275513 Original CRISPR TTGGATACAGAGAGGCATCG AGG Intronic
No off target data available for this crispr