ID: 1037277818

View in Genome Browser
Species Human (GRCh38)
Location 8:17200319-17200341
Sequence TCAACCAGTGACAGCCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037277806_1037277818 25 Left 1037277806 8:17200271-17200293 CCAGGCAGTCCAGAAGTGCCAAG 0: 1
1: 0
2: 1
3: 16
4: 154
Right 1037277818 8:17200319-17200341 TCAACCAGTGACAGCCTGGCCGG No data
1037277810_1037277818 7 Left 1037277810 8:17200289-17200311 CCAAGGCATTCATACCTCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 139
Right 1037277818 8:17200319-17200341 TCAACCAGTGACAGCCTGGCCGG No data
1037277808_1037277818 16 Left 1037277808 8:17200280-17200302 CCAGAAGTGCCAAGGCATTCATA 0: 1
1: 0
2: 0
3: 49
4: 683
Right 1037277818 8:17200319-17200341 TCAACCAGTGACAGCCTGGCCGG No data
1037277813_1037277818 -7 Left 1037277813 8:17200303-17200325 CCTCCAGGGGCAACCCTCAACCA 0: 1
1: 2
2: 12
3: 36
4: 218
Right 1037277818 8:17200319-17200341 TCAACCAGTGACAGCCTGGCCGG No data
1037277814_1037277818 -10 Left 1037277814 8:17200306-17200328 CCAGGGGCAACCCTCAACCAGTG 0: 1
1: 1
2: 12
3: 68
4: 284
Right 1037277818 8:17200319-17200341 TCAACCAGTGACAGCCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037277818 Original CRISPR TCAACCAGTGACAGCCTGGC CGG Intronic
No off target data available for this crispr