ID: 1037280571

View in Genome Browser
Species Human (GRCh38)
Location 8:17237296-17237318
Sequence TTTAAAAAACATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1405
Summary {0: 1, 1: 1, 2: 16, 3: 184, 4: 1203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037280571_1037280576 17 Left 1037280571 8:17237296-17237318 CCTTCCTCCTCATGTTTTTTAAA 0: 1
1: 1
2: 16
3: 184
4: 1203
Right 1037280576 8:17237336-17237358 TTAGTAGCTCTATAGAGTCCTGG 0: 1
1: 2
2: 0
3: 2
4: 58
1037280571_1037280577 18 Left 1037280571 8:17237296-17237318 CCTTCCTCCTCATGTTTTTTAAA 0: 1
1: 1
2: 16
3: 184
4: 1203
Right 1037280577 8:17237337-17237359 TAGTAGCTCTATAGAGTCCTGGG 0: 1
1: 2
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037280571 Original CRISPR TTTAAAAAACATGAGGAGGA AGG (reversed) Exonic
900201472 1:1409150-1409172 CTTAAAAAAAAAGAGGAGGCCGG + Intergenic
900848130 1:5120204-5120226 TTTAAAAAACAAAATGAGCAGGG + Intergenic
901018364 1:6244089-6244111 TCTAGAAACCTTGAGGAGGAGGG - Intergenic
901123460 1:6913112-6913134 GTTTACAAACATGAAGAGGAAGG - Intronic
901715398 1:11149587-11149609 ATTATCAAACCTGAGGAGGAGGG + Intronic
903298487 1:22361252-22361274 TTTAACAAAAATCAGGAGGCTGG + Intergenic
904274910 1:29375515-29375537 TTCAAAAAATTTGAAGAGGAGGG - Intergenic
906023159 1:42649151-42649173 TTCAAAAAAAATAAAGAGGAGGG + Intronic
906555017 1:46703402-46703424 TTTAAAAAAATTGAGCAGGCCGG - Intronic
906771924 1:48493066-48493088 TTTATAAGACATGAGTAGTAAGG - Intergenic
906895650 1:49768130-49768152 TTCCAAAAAATTGAGGAGGAGGG + Intronic
906967250 1:50470055-50470077 TTTAAAAAACAAGAGCCAGAAGG - Intronic
907027430 1:51134954-51134976 TTCAAAAAAATTAAGGAGGAGGG + Intronic
907356060 1:53874810-53874832 TTTAAAAAGCATGTTGTGGAAGG - Intronic
907591688 1:55679580-55679602 TTTAAAAAAAAAGAAGAGCAGGG - Intergenic
907680191 1:56555857-56555879 TTTAAATAACATGATGATGCTGG + Intronic
907980985 1:59480598-59480620 ATTTAAAAAGAAGAGGAGGAGGG + Intronic
908479720 1:64526561-64526583 TTAAAAAGACTTGAGGAGGGGGG + Intronic
908664301 1:66472947-66472969 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
908864693 1:68533832-68533854 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
908968902 1:69801250-69801272 TTCCAAAAACTTGAGGAGGAAGG - Intronic
909267539 1:73579794-73579816 TTCCAAAAATCTGAGGAGGAGGG + Intergenic
909706258 1:78588160-78588182 TTTAAAAAAGCAGAGGAGGAAGG + Intergenic
909733975 1:78933034-78933056 TTCCAAAAAATTGAGGAGGAGGG + Intronic
909882793 1:80901162-80901184 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
909898720 1:81107246-81107268 TTCCAAAAAATTGAGGAGGATGG - Intergenic
909946896 1:81673811-81673833 TTTAAAAAACTAGAAGAGGCTGG - Intronic
910083095 1:83365265-83365287 TTTTTAAAAAATTAGGAGGAAGG + Intergenic
910303683 1:85737147-85737169 TTTAAAAAACATGATCAGTAGGG + Intronic
910333430 1:86101917-86101939 TTCCAAAAATTTGAGGAGGAAGG - Intronic
910563924 1:88622176-88622198 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
910702588 1:90092350-90092372 TTTAAACAACATGGGGATTAGGG - Intergenic
910819499 1:91330609-91330631 TTTCAAAAAATAGAGGAGGAGGG + Intronic
911008129 1:93248999-93249021 TTTCAAAAAATTGAAGAGGAGGG - Intronic
911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG + Intronic
911310410 1:96285851-96285873 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
911458271 1:98155218-98155240 TTACAAAAAATTGAGGAGGAGGG + Intergenic
911667527 1:100570951-100570973 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
912016531 1:105044133-105044155 TTCAAAAAAAGTGAAGAGGAGGG + Intergenic
912601437 1:110938165-110938187 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
912639094 1:111327389-111327411 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
913100953 1:115564964-115564986 TATAAAAAACATTAGGAGGAAGG + Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
913380005 1:118200124-118200146 TACGAAAAGCATGAGGAGGAAGG + Intergenic
913707284 1:121438636-121438658 TCCAAAAAAAAAGAGGAGGAAGG + Intergenic
914512950 1:148350971-148350993 TTTAAAAAGAAAGAGAAGGAAGG + Intergenic
914895915 1:151672527-151672549 TTCAAAAAAAGAGAGGAGGAGGG - Intronic
914897961 1:151693755-151693777 TTTAAAAAACTGGCAGAGGAGGG - Exonic
915000786 1:152588197-152588219 TTCCAAAAAATTGAGGAGGAAGG + Intronic
915349881 1:155217692-155217714 TCTGAAGAAGATGAGGAGGAAGG - Intergenic
915779471 1:158530462-158530484 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
915803823 1:158823243-158823265 TTCAAAAAAATTGAGGAGGAAGG - Intergenic
915880124 1:159661035-159661057 TTTAAAAAAATTGAAGAAGATGG - Intergenic
916047075 1:161007943-161007965 TATGAAATAGATGAGGAGGATGG - Intronic
916833503 1:168517721-168517743 TTTAAAAAATATGTGAAGGTAGG + Intergenic
916904386 1:169266069-169266091 TTCCAAAAAATTGAGGAGGAGGG + Intronic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
917097614 1:171414902-171414924 TTCCAAAAACCTGAGGAGAAAGG + Intergenic
917127669 1:171703268-171703290 TTTAAAAGACACAAGGAGGTTGG + Exonic
917148686 1:171921565-171921587 TTTAAAAAAAAGGAGGAGGAGGG - Intronic
917217802 1:172696239-172696261 TGTAAAATAGAAGAGGAGGAGGG + Intergenic
917223668 1:172759051-172759073 TGTAAAAAAAATGAGTATGATGG - Intergenic
917363725 1:174205321-174205343 TTCCAAAAAACTGAGGAGGAGGG - Intronic
917375298 1:174346276-174346298 TTTCAAAAAAAGGAGGAGAAAGG - Intronic
917673278 1:177294616-177294638 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
917707800 1:177652095-177652117 TTTAAAAGAAATGTGGAGGATGG - Intergenic
918380393 1:183948190-183948212 TCCAAAAAAAAAGAGGAGGAGGG + Intronic
918514183 1:185344328-185344350 TTTAAAACACATGATGAGGCTGG - Intergenic
918827100 1:189338094-189338116 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
918858890 1:189795860-189795882 TTTCAGAAACGTGAGAAGGAGGG - Intergenic
918877880 1:190073045-190073067 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
918959141 1:191248899-191248921 TTTAAAAAAAAAGAAAAGGAGGG - Intergenic
919207800 1:194439461-194439483 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
919269031 1:195314426-195314448 TTTCAAAAAATTGAGGAAGAGGG + Intergenic
919376946 1:196807070-196807092 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
919389481 1:196964410-196964432 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
919453266 1:197795780-197795802 TCCAAAAAAATTGAGGAGGAAGG - Intergenic
919553835 1:199027003-199027025 TTTAAGAAATAAGAGGAGGAAGG - Intergenic
920016945 1:202919496-202919518 TTTAAAAAAAAAATGGAGGAAGG - Intronic
920219519 1:204386530-204386552 TTTAAGAAACTTGAAGTGGAAGG - Intergenic
920410054 1:205752052-205752074 TTTAAAAAAATTGCGGGGGACGG - Intergenic
920808697 1:209260785-209260807 ATCAAAAAAGATGAGAAGGAAGG - Intergenic
920861780 1:209714789-209714811 ATTGAAAAACTTGAGCAGGATGG + Intronic
921194634 1:212743494-212743516 GTTAATGAACATGTGGAGGAAGG - Intronic
921751640 1:218800975-218800997 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
921840741 1:219825709-219825731 TTTCAAATACATGAGGGAGAAGG + Intronic
922376586 1:224974471-224974493 TTTAAAAAACATTTGGCTGATGG - Intronic
922430854 1:225551417-225551439 TTTAAAAAATTTGAGGACGTAGG + Intronic
922483251 1:225954114-225954136 TTTAAAAAACAGCAAGAGAAGGG - Intergenic
922843083 1:228660429-228660451 TTCCAAAAACTTGAAGAGGAGGG + Intergenic
922850149 1:228726083-228726105 ATAATAAAACATAAGGAGGAAGG - Intergenic
922950108 1:229551940-229551962 TTTAGAAAACTAGAGGAGGAGGG - Intronic
923035440 1:230281832-230281854 TTTTAAAAACAGGAGTGGGAGGG - Exonic
923112746 1:230905168-230905190 ATTATCAAACATGAGGAGGGAGG + Intergenic
923154158 1:231261832-231261854 ATTAAAAGGGATGAGGAGGAAGG - Intronic
923311670 1:232741574-232741596 TTTAAACAACATTAGGAGGTAGG - Intergenic
923364061 1:233242282-233242304 TTTAAAAAATAAGAGTAGGATGG - Intronic
923366889 1:233270547-233270569 TTTAAAAATGATGAGGTAGATGG + Intronic
1063686088 10:8238299-8238321 TTTAAAAAAGTTAATGAGGAAGG + Intergenic
1063891631 10:10635581-10635603 TTTAAAAAATATGTGTAGAAAGG + Intergenic
1063898814 10:10710804-10710826 TTTAAAAAAGAAAATGAGGAGGG - Intergenic
1064470529 10:15630728-15630750 ATTAAAAAACATGCAGAGGGAGG + Intronic
1064615053 10:17144945-17144967 TTTAAAAAACATGCAAAGGGAGG + Intronic
1064777811 10:18798686-18798708 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1064781465 10:18843897-18843919 TTATAAAAACATGAGGCAGAAGG + Intergenic
1065059644 10:21886435-21886457 TTCCAAAAAACTGAGGAGGAAGG + Intronic
1065499991 10:26370729-26370751 TTCCAAAAAAATGAGGAGGAGGG - Intergenic
1066144138 10:32539019-32539041 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1066162596 10:32750152-32750174 TTTAAAAAGCAAGATGAGAAAGG - Intronic
1066165271 10:32781264-32781286 TTTCAAAAAACTGAAGAGGAGGG + Intronic
1066522856 10:36242154-36242176 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1066753033 10:38679198-38679220 TTCCGAAAAAATGAGGAGGAAGG + Intergenic
1067265499 10:44738915-44738937 TTCAAAAAAGTTGAAGAGGAGGG + Intergenic
1067512800 10:46909760-46909782 TTTCACAAACATGAGCAGCATGG - Intergenic
1067649445 10:48142062-48142084 TTTCACAAACATGAGCAGCATGG + Intergenic
1067819404 10:49514131-49514153 TTAAAAAAACATCAGGACTAAGG + Intronic
1068462666 10:57347952-57347974 TTTTAAAAAATTGAGGAGGAGGG - Intergenic
1069148093 10:64920900-64920922 TTTCAAAAACTGGAGGAGTAGGG + Intergenic
1069234725 10:66056565-66056587 TTTCTAAAATGTGAGGAGGAGGG - Intronic
1069355984 10:67585371-67585393 TTACAAAAAATTGAGGAGGAAGG - Intronic
1069582371 10:69574611-69574633 TTCAAAAGACACGAGGGGGAGGG - Intergenic
1070191960 10:74119175-74119197 TTTAGAAAGGATGTGGAGGAAGG - Exonic
1070434731 10:76379262-76379284 TTCCAAAAAATTGAGGAGGAAGG - Intronic
1070652182 10:78245444-78245466 TTGAGAAAACATGAAGAGAAAGG - Intergenic
1070876179 10:79812857-79812879 TATAAAAAGCATGTGGAGGCAGG + Intergenic
1070886963 10:79909107-79909129 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1070936422 10:80300800-80300822 TTTAAATAAAATGAGAAAGAGGG - Intergenic
1071199492 10:83203050-83203072 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1071357826 10:84816156-84816178 TTTCAAAATATTGAGGAGGAAGG - Intergenic
1071454036 10:85828914-85828936 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1071611428 10:87034934-87034956 TTCCAAAAAAGTGAGGAGGAGGG - Intergenic
1071891820 10:90016533-90016555 TTCAAAAAAATTGAAGAGGAAGG - Intergenic
1072368530 10:94740409-94740431 TTCCCAAAAAATGAGGAGGAGGG - Intronic
1072827756 10:98625804-98625826 TTTAAAACACATGAATAGGCCGG + Intronic
1072862138 10:99017560-99017582 TTTCAAAAAATTGAGGAGGAGGG - Intronic
1072945016 10:99801960-99801982 TTTAAAAATCAACTGGAGGAAGG - Intronic
1073497158 10:103903112-103903134 TTTAAAAAACAGGCTGTGGATGG - Intronic
1074000294 10:109365405-109365427 TTTCAAAAAATTGAGGAAGAGGG - Intergenic
1074013887 10:109512908-109512930 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1074176372 10:111008325-111008347 TTTAAAAAACATGGATATGAAGG - Intronic
1074332954 10:112538030-112538052 TTTTAAAAACACGAAGTGGATGG + Intronic
1074640599 10:115376153-115376175 CTTATAAAACAGGAGGAAGAAGG - Intronic
1074721627 10:116270610-116270632 TGGAAAACCCATGAGGAGGACGG - Intronic
1075012032 10:118881116-118881138 TTAAAAAAAATTGAAGAGGAGGG + Intergenic
1075073619 10:119335657-119335679 TTTAAAGAACATGCGCAGGCTGG - Intronic
1075497387 10:122936001-122936023 TTTTAAAAACTAGAAGAGGAGGG - Intronic
1075511636 10:123077276-123077298 TTTAAAAAACAAGAACAGGCTGG - Intergenic
1075543855 10:123338664-123338686 TCCAAAAAAATTGAGGAGGAGGG + Intergenic
1075828428 10:125381511-125381533 TTACAAAAAATTGAGGAGGAGGG - Intergenic
1075841548 10:125508885-125508907 TTTCCAGAAGATGAGGAGGAAGG + Intergenic
1075851359 10:125590414-125590436 TTTAAAATAAAAGAGAAGGAGGG - Intronic
1075947483 10:126448992-126449014 TTCAAAAAAATTGAAGAGGAGGG + Intronic
1076113213 10:127876863-127876885 TTAAAAAATCATGAGTAAGAAGG + Intergenic
1076210543 10:128640207-128640229 TTTAGAAAACAGGAGGACTAGGG - Intergenic
1077260586 11:1617319-1617341 TATTAAAAACAAGAAGAGGAAGG + Intergenic
1077596194 11:3533801-3533823 TTTAAAAAAGAAGAAGAGGCTGG - Intergenic
1077763094 11:5125057-5125079 TTCCAAAAAGTTGAGGAGGAGGG + Intergenic
1077821288 11:5744313-5744335 TTTCAAAAAATTGAAGAGGAGGG + Intronic
1078235225 11:9478120-9478142 TTTAAAAAACATTAACAGGCCGG - Intronic
1078244097 11:9557709-9557731 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1078304584 11:10171673-10171695 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1078454389 11:11463896-11463918 TTTCAAAATCATGAGCATGACGG - Intronic
1078816408 11:14826774-14826796 TTACAAAAAAATGAGGAGGAAGG + Intronic
1079193542 11:18303195-18303217 TTTCGAAAACATGAAGAGGAGGG - Intronic
1079667937 11:23131376-23131398 TTCCAAAAATTTGAGGAGGAAGG - Intergenic
1079757617 11:24284623-24284645 TTTCAAAAAATTAAGGAGGAAGG + Intergenic
1079777209 11:24546807-24546829 TTTTAAAAAATTGAGGAGGAAGG - Intronic
1079920951 11:26433933-26433955 TATCAAAAAATTGAGGAGGAAGG - Intronic
1079975011 11:27080022-27080044 TTTAAAAAGAAAGAGCAGGATGG - Intronic
1080018903 11:27537937-27537959 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1080094344 11:28387650-28387672 TTTCAAAAAACTGAAGAGGAAGG + Intergenic
1080790757 11:35520616-35520638 TTTAAAATAAAAGAGGAGGGAGG + Intronic
1081010058 11:37799826-37799848 TTCTCAAAAAATGAGGAGGAGGG + Intergenic
1081026624 11:38022744-38022766 TTCAAAAAAATTGAGAAGGAGGG + Intergenic
1081083639 11:38773396-38773418 TTTTAAATAATTGAGGAGGAAGG + Intergenic
1081201639 11:40223295-40223317 TTTAAAAATCAGTAGGAGAAAGG + Intronic
1081389371 11:42511566-42511588 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1081543956 11:44056534-44056556 TTTAAAATACAGGATGAGGCCGG + Intronic
1082645311 11:55716677-55716699 GCTAAAAAACATGAGGCGAATGG - Intergenic
1082886110 11:58084397-58084419 TTCTAAAAAATTGAGGAGGAGGG + Intronic
1083040787 11:59684040-59684062 TTTCAAAAAATTGAAGAGGAGGG + Intergenic
1083076075 11:60040182-60040204 TGTTACAAACATCAGGAGGATGG - Intergenic
1083536420 11:63471809-63471831 TTTAAAAAACATTAATAGGCTGG + Intronic
1086015712 11:82164774-82164796 TTCCATAAACTTGAGGAGGAGGG + Intergenic
1086902019 11:92378567-92378589 TTTAAAAATCTTTAAGAGGATGG - Intronic
1086932392 11:92706744-92706766 TTTTAAAGACATGAGGTGAAGGG - Intronic
1087155865 11:94902482-94902504 TTCATAAAACTTGAGGAGGAGGG + Intergenic
1087310075 11:96531209-96531231 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1087337249 11:96860223-96860245 TCCAAAAAAAATGAGGAAGAGGG - Intergenic
1087513236 11:99125071-99125093 TTACAAAAAATTGAGGAGGAAGG + Intronic
1087555856 11:99720131-99720153 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1088083225 11:105945555-105945577 ATTAAAAAACAGGTGGGGGAGGG - Intronic
1088314713 11:108496316-108496338 TTAAAAAAAAAAAAGGAGGAGGG + Intronic
1088446939 11:109941020-109941042 TTTGAAAACAAGGAGGAGGAAGG + Intergenic
1089803328 11:121057592-121057614 TTGAAAATACATGGGGAAGAAGG + Intronic
1090105316 11:123848539-123848561 TTTCAAAAAACTGAGGAGGAGGG - Intergenic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090572589 11:128063907-128063929 TTTCAAAAAATTGAGAAGGAGGG + Intergenic
1090573941 11:128079818-128079840 TTCCAAAAACCTGAGGAAGAGGG + Intergenic
1091398109 12:166334-166356 TTTAAAAAAAATGAAGTGGAGGG - Intronic
1091528941 12:1335759-1335781 TTCAAATAAATTGAGGAGGAGGG - Intronic
1092393869 12:8107407-8107429 TTCCAAAAATTTGAGGAGGAAGG - Intergenic
1092694775 12:11158986-11159008 AATAAAAAAAAGGAGGAGGAAGG + Intronic
1092711159 12:11339285-11339307 TTGAAAAAAGATGAGAAGAATGG - Intergenic
1093052823 12:14522466-14522488 TTCAAAAGACATGAAGAGGAGGG + Intronic
1093060391 12:14596256-14596278 TCCAAAAAAACTGAGGAGGAGGG - Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093096861 12:14981825-14981847 TTTATTAAATATGAGGAGGTGGG - Exonic
1093100822 12:15026834-15026856 ATTACAAAAATTGAGGAGGAGGG - Intergenic
1093219729 12:16405521-16405543 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1093452247 12:19329371-19329393 TTCCAAAAAAATAAGGAGGAGGG - Intronic
1093659116 12:21734107-21734129 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1094225920 12:28045963-28045985 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1094305870 12:29018541-29018563 TTTAATATATATGAAGAGGAAGG - Intergenic
1094595352 12:31860760-31860782 TTTAAAAAACATCAGGAATGAGG + Intergenic
1095244969 12:39908833-39908855 TATGAAAAGCATGAGGAAGATGG + Intronic
1095364449 12:41385771-41385793 TTCCAAAAAGTTGAGGAGGAAGG + Intronic
1095459340 12:42425681-42425703 TTTTAAAAACCTGAGGAGGCTGG - Intronic
1095551526 12:43447095-43447117 ATTTAAAAAATTGAGGAGGAGGG + Intronic
1095558720 12:43539724-43539746 TTTAAAAAGCATGCTGAAGAGGG + Intronic
1095625904 12:44314793-44314815 TTTCAAAAAATGGAGGAGGATGG - Intronic
1095680145 12:44964803-44964825 TTTCAACAAACTGAGGAGGAGGG + Intergenic
1096035320 12:48463524-48463546 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1096087253 12:48874056-48874078 CTAAAAAAAAATTAGGAGGAAGG + Intergenic
1097046957 12:56194152-56194174 TCTAAAAAACTTCAGGAGGCCGG - Intergenic
1097365052 12:58702558-58702580 TTGAAAAAACATTAGGTGAATGG + Intronic
1097426607 12:59453547-59453569 TTAAAAAAACAAAAGAAGGAGGG + Intergenic
1097498305 12:60371857-60371879 TTAAAATAAGATTAGGAGGAAGG + Intergenic
1097558950 12:61177180-61177202 TTTCAAAAAACTGAGGAGGAGGG - Intergenic
1097567112 12:61284865-61284887 TTTAAAAAACCTAAGGAAGATGG + Intergenic
1097729688 12:63114368-63114390 TTCCAAAAACTTGAGGAGGAGGG + Intergenic
1098145470 12:67493266-67493288 TTTTAAAAAGTTGAGGAGGATGG + Intergenic
1098268236 12:68745210-68745232 TTTAAAATAAATGAGGAAGTAGG - Exonic
1098347570 12:69522297-69522319 TCCAAAAAAACTGAGGAGGAGGG - Intronic
1098359376 12:69639963-69639985 TTCAAACAACCTGACGAGGAAGG + Intergenic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098734668 12:74084182-74084204 CTTAAACAACATGAGGGTGAGGG + Intergenic
1098947110 12:76601299-76601321 AATAAAAAACATGATGAGGCTGG + Intergenic
1099032343 12:77542530-77542552 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1099130859 12:78828927-78828949 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1099321537 12:81156861-81156883 TTTAAAATAGAAGAGGAGGCAGG + Intronic
1099323125 12:81176774-81176796 TTTCAAAAAGTTGAGGGGGAGGG + Intronic
1099421829 12:82471317-82471339 GGTAACAAACATGAGGAGGCAGG - Intronic
1099497885 12:83375250-83375272 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1099559227 12:84151471-84151493 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1099706465 12:86159559-86159581 TTCCAAAAAGTTGAGGAGGAGGG - Intronic
1099845383 12:88021948-88021970 TTTCAAAAAATTGAGGATGAAGG + Intronic
1100024872 12:90115752-90115774 TGAAATAAACATGAGGATGAAGG + Intergenic
1100082543 12:90870541-90870563 TTTAAACAACATGAGTATAATGG - Intergenic
1100505160 12:95212807-95212829 TTTTAAAAAAAAGAGGAGTAGGG + Intronic
1100878516 12:98990398-98990420 TTTCAAAAAAATGAGGCTGATGG + Intronic
1101255772 12:102974999-102975021 ATTAAAAAACATGGAGAGAATGG + Intergenic
1102194563 12:111015805-111015827 CTTAAAGAACATAAGGAGGTCGG + Intergenic
1102653428 12:114460283-114460305 TTTAAAAAAAAAAAGGAAGAAGG + Intergenic
1102911587 12:116718787-116718809 TTTAAAGGAAATGAGGAGGAAGG - Intronic
1103104027 12:118206889-118206911 TTTAAAAACAATGAGGAGGCCGG - Intronic
1103280687 12:119755820-119755842 CTTCAAAAACATAAGGAGGCTGG - Intronic
1103534500 12:121625737-121625759 TTTAAAAAATATCAGGTGGCCGG + Intergenic
1103653512 12:122452190-122452212 GTTTAAAAAAATGAGGAGGCTGG - Intergenic
1103998904 12:124847697-124847719 TTTAGAAAGCAGGTGGAGGAAGG + Intronic
1104119487 12:125785602-125785624 TTTTCAAACCATGAGGAAGAGGG - Intergenic
1105063584 12:133176877-133176899 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1106387865 13:29305743-29305765 TTTCAAAAAATTGAAGAGGAGGG + Intronic
1106414142 13:29531975-29531997 TTTAATAAACCTGAGAGGGAGGG - Intronic
1106723442 13:32459762-32459784 TCCAAAAAAAATGAAGAGGAGGG + Intronic
1106843788 13:33714846-33714868 TATAAAAAGCATGAGGTGGTTGG + Intergenic
1107005533 13:35605553-35605575 TTGAAAAAAGATGATCAGGATGG + Intronic
1107157683 13:37188762-37188784 TATAAAAAAATTGAGGAGAAGGG + Intergenic
1107211186 13:37856485-37856507 TTCCAAAAAACTGAGGAGGAGGG + Intronic
1107223705 13:38019774-38019796 TTTTGAAAACATATGGAGGATGG - Intergenic
1107310948 13:39077035-39077057 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1107468437 13:40668807-40668829 TTTAAAAAAATTGACGAGGCAGG + Intergenic
1107574348 13:41701342-41701364 TTAAAAAAACATGTGCAGGAAGG + Intronic
1107776967 13:43854582-43854604 TTCCAAAAAATTGAGGAGGATGG + Intronic
1108031818 13:46239594-46239616 TCCAAAAAAATTGAGGAGGAGGG + Intronic
1108097516 13:46919296-46919318 TTTAAAAAAATTGAGGAGGAGGG - Intergenic
1108273568 13:48786281-48786303 TGTAAAAATAATGAGAAGGAGGG + Intergenic
1108491727 13:50988847-50988869 ATTAAAAAATCTGAAGAGGATGG - Intergenic
1108855150 13:54784178-54784200 GTTAAAGAACATGAGGTGCAGGG - Intergenic
1109057655 13:57572371-57572393 TTTCAAAAAATTGAGGAGAAAGG - Intergenic
1109065776 13:57688079-57688101 TTTAAAAAAAATGGGGTGGGGGG - Intronic
1109325816 13:60866595-60866617 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1109332893 13:60952311-60952333 TTTAAAAAAAAGGAGGAGGGTGG - Intergenic
1109363363 13:61324826-61324848 TTGAAAAAAGATGAGAAGAATGG + Intergenic
1109374994 13:61480938-61480960 TTTCAAAAAGTTGAGGAGGAGGG - Intergenic
1109436038 13:62304021-62304043 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
1109528138 13:63603505-63603527 TTCCAAAAACTTGAGGAGGAAGG + Intergenic
1109695782 13:65955333-65955355 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1109910958 13:68909305-68909327 TTTCAAAAAATGGAGGAGGAGGG - Intergenic
1110307023 13:74000053-74000075 TTTAAAAAAAGTGGGGAGGAGGG - Intronic
1110576758 13:77065620-77065642 TTTAAAAACCATGAGGACTGAGG + Intronic
1110600602 13:77368188-77368210 TTTCAAAAAATTGAGGAGAAGGG + Intergenic
1110729312 13:78861061-78861083 TTTAAAATACATGAGGGAGGTGG + Intergenic
1111029579 13:82577665-82577687 TTTCAAAAAACTAAGGAGGAGGG - Intergenic
1111431135 13:88149657-88149679 TATAGAAAACATGAAGAGGCAGG + Intergenic
1111539032 13:89647371-89647393 TTTCCAAAACTTGAAGAGGAAGG + Intergenic
1111606099 13:90541224-90541246 TTTCCAAAACTTGAGTAGGATGG + Intergenic
1111703156 13:91715927-91715949 TTTTAAAAACAAGATGAGCATGG - Intronic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1111757191 13:92413608-92413630 TTTAAACAAAATGAGGATCAAGG + Intronic
1112254070 13:97812684-97812706 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
1112578907 13:100661689-100661711 TTAAAAAGATATCAGGAGGAGGG + Intronic
1112658410 13:101477941-101477963 TTTCAAAAAATGGAGGAGGAGGG + Intronic
1113031551 13:105998992-105999014 TTTTAAAAACCTGTGGAGGATGG + Intergenic
1113273805 13:108705941-108705963 TTTTAAAAATATGAACAGGAAGG + Intronic
1113540569 13:111104807-111104829 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1114033565 14:18598200-18598222 TCCAAAAAAACTGAGGAGGAGGG + Intergenic
1114078355 14:19177396-19177418 TCCAAAAAAACTGAGGAGGAGGG + Intergenic
1114125134 14:19717151-19717173 TCCAAAAAAACTGAGGAGGAGGG - Intergenic
1114274305 14:21128383-21128405 TTCAAAAAAATTGAAGAGGAAGG + Intergenic
1114360291 14:21964676-21964698 TACAATAAACATGAGGAGGCAGG + Intergenic
1114680188 14:24477805-24477827 TGTATAAAACAAGAGGAGGCTGG - Intergenic
1114779883 14:25526971-25526993 TTTAAAAAAAATGAGGACACTGG + Intergenic
1114907337 14:27146785-27146807 TTCAAAAAAATTGAGCAGGAGGG - Intergenic
1115021545 14:28686888-28686910 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1115078837 14:29425280-29425302 TTTAAAAAACTTGAGCGGAAAGG - Intergenic
1115114921 14:29869144-29869166 TTTAAAAAAGAAGAAGAGGCTGG + Intronic
1115139211 14:30149273-30149295 TTCAAAAAAATTGAAGAGGAGGG + Intronic
1115182599 14:30646654-30646676 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1115862925 14:37709673-37709695 TTTACAAAACATGATTGGGAAGG - Intronic
1115885423 14:37966458-37966480 TCCAAAAAAATTGAGGAGGAAGG - Intronic
1116077957 14:40136087-40136109 TTCCACAAAAATGAGGAGGAAGG - Intergenic
1116089941 14:40292284-40292306 TTCCAAAGACTTGAGGAGGAGGG - Intergenic
1116148432 14:41105422-41105444 TTTCAAAAAATTGAGGAGGATGG + Intergenic
1116342556 14:43743336-43743358 TCTAAAAAACATTAGAATGAAGG - Intergenic
1116431429 14:44849578-44849600 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1116471649 14:45292640-45292662 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1116578647 14:46609098-46609120 TTAAAAAAAATTGAGGAGAAGGG + Intergenic
1116796555 14:49397034-49397056 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1117262958 14:54055583-54055605 TTTAAAATACATGACAAGGATGG - Intergenic
1117363097 14:54997614-54997636 ATTAAAAAAAATGGGGAGGCCGG + Intronic
1117639213 14:57779539-57779561 TTCCAAAAACCTGAAGAGGAAGG + Intronic
1117856902 14:60043842-60043864 TTTAAAAAAATTGAAGAGGAAGG - Intronic
1117948962 14:61061468-61061490 TCCAAAAAAATTGAGGAGGAGGG - Intronic
1117978904 14:61322506-61322528 TTTGAAAAACATAAGGGGAACGG - Intronic
1118522970 14:66607536-66607558 TTCAAAAAAATTGAGGAGGAGGG - Intronic
1118561462 14:67087860-67087882 TTAAAAAAAGAGGAAGAGGAAGG - Intronic
1118613614 14:67560337-67560359 GTTAAAAAGAATGAAGAGGATGG - Intronic
1118764622 14:68901541-68901563 TTTAAAATGCATGATGAGGCCGG - Intronic
1118856901 14:69630200-69630222 TTAAAAAAACTTGCCGAGGATGG + Intronic
1118944428 14:70371199-70371221 TTAAAAGAACATGAACAGGATGG + Exonic
1119135503 14:72214793-72214815 TTAAAAAAACATGGGGAGTAGGG + Intronic
1120115931 14:80617548-80617570 TTTAAAGAACATAAGGTGGGGGG + Intronic
1120306031 14:82771715-82771737 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
1120566863 14:86070693-86070715 TTTAAAACACATGGGGAAAAAGG + Intergenic
1120627122 14:86841820-86841842 TTTAAAAAATGTGAGAAGGGTGG - Intergenic
1121741611 14:96256502-96256524 TTTCCAGAACAGGAGGAGGAGGG + Intronic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1122120160 14:99548850-99548872 TCTCAAAAACATGAAGAGGATGG + Intronic
1122401037 14:101467567-101467589 TTTAGAGAGCATGGGGAGGAGGG - Intergenic
1123739008 15:23217002-23217024 TATAAAAACCCTTAGGAGGAGGG + Intergenic
1123796441 15:23775917-23775939 TTCCAAAAATTTGAGGAGGAGGG - Intergenic
1124290227 15:28445972-28445994 TATAAAAACCCTTAGGAGGAGGG + Intergenic
1124293011 15:28471596-28471618 TATAAAAACCCTTAGGAGGAGGG - Intergenic
1124477486 15:30047348-30047370 TTTAAAAAACATGTTTAGGACGG - Intergenic
1124858942 15:33419030-33419052 TATAAAACACATAAGCAGGATGG - Intronic
1124930785 15:34117280-34117302 ATTAAAAAACAAGAAGAGGCAGG - Intergenic
1125010777 15:34871671-34871693 ATTAAGAAACATGAGGAAGGAGG - Intronic
1125074452 15:35596940-35596962 TAAAAAAAATGTGAGGAGGAAGG + Intergenic
1125103428 15:35942628-35942650 AATCAAGAACATGAGGAGGAAGG + Intergenic
1125247971 15:37663610-37663632 TTTCAAAAAAATGAGGAGGAGGG - Intergenic
1125558098 15:40602874-40602896 ATTAGAAAACATGAGGAAAAAGG - Intronic
1125818192 15:42604537-42604559 TTGAAAAAACGTGAAGAGGGAGG + Intronic
1125885998 15:43229995-43230017 TTAAAAAAACAAGAGTATGAAGG + Intergenic
1125914098 15:43469443-43469465 TTTAAAAAACATAAGCATGTGGG + Intronic
1126054049 15:44712700-44712722 TTTTGAAAACATGAGGGGGTTGG + Intronic
1126165859 15:45653332-45653354 ATTATAGAACCTGAGGAGGATGG - Intronic
1126429984 15:48572908-48572930 TTTAAAAAACAAGAGGCGAAGGG + Intronic
1126781295 15:52140959-52140981 TTTTAATAACATGAGAAGGTTGG - Intronic
1126880322 15:53087860-53087882 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1126902353 15:53327280-53327302 ATTAATAAAAATGAAGAGGATGG + Intergenic
1126976076 15:54182545-54182567 TTCCAAAAAACTGAGGAGGACGG - Intronic
1127021941 15:54757956-54757978 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1127097104 15:55523467-55523489 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1127143747 15:56003271-56003293 ATTAAAAAAAATGAAGAGGCCGG - Intergenic
1127330719 15:57937021-57937043 TTCCAAAAAGCTGAGGAGGAGGG - Intergenic
1127376912 15:58393498-58393520 TTTAAAAAAAATGAGGTGGGTGG + Intronic
1127378673 15:58408830-58408852 TTTCAAAAACCTGAGATGGATGG + Intronic
1127400643 15:58582103-58582125 TTAAAAAAAAAAGAAGAGGAGGG + Intergenic
1127812245 15:62574279-62574301 TTTAAAAAACATGATTAGCCAGG + Intronic
1127978040 15:64013511-64013533 TTAAGAAAACATGAGGAGAAGGG + Intronic
1128164835 15:65454875-65454897 TTTAAAAAATTTGAGGGAGAGGG - Intronic
1128850639 15:70952296-70952318 TTTCAAAAAATTGAGAAGGAGGG - Intronic
1129534318 15:76299576-76299598 TTTAAGAAACATCAGGAGGCAGG - Intronic
1129564925 15:76611534-76611556 TTGCAAAAAATTGAGGAGGAGGG + Intronic
1129649793 15:77476183-77476205 TTTAAAAAACTAGTGGAGGCTGG + Intronic
1130185824 15:81680805-81680827 TTTCAAAAAACTGAGGAGGAGGG + Intergenic
1130366697 15:83247124-83247146 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1130619730 15:85449952-85449974 TTACAAAAAATTGAGGAGGAAGG - Intronic
1130835433 15:87645520-87645542 TTTTAAAAGCATGAGGAGAGGGG + Intergenic
1131804862 15:96110610-96110632 TTCAAAAAACATCAGGCGGAGGG - Intergenic
1131849242 15:96521003-96521025 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
1131959815 15:97777526-97777548 TTCCAAAACCATAAGGAGGAGGG + Intergenic
1131974597 15:97932023-97932045 TTTTAAAAACAAGAGGTGCAAGG + Intergenic
1132100571 15:99020240-99020262 TTTAAAAAACCAGAGGCGGGTGG + Intergenic
1132353447 15:101154717-101154739 TTTAAAGAAAATGAGAAGGGCGG - Intergenic
1133067620 16:3220556-3220578 TTTAAAAAACATTATCAAGACGG - Intergenic
1133114968 16:3573108-3573130 ATTAAAAAACATCAAAAGGAGGG + Intronic
1133713826 16:8427966-8427988 TTTAAAAAAAAAAAGGAAGAGGG + Intergenic
1134377512 16:13691257-13691279 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
1134423833 16:14119420-14119442 TTTAAAATACATAAGGAGGCAGG + Intronic
1134556620 16:15171246-15171268 TTAAAAAAATAAGAGGAAGAGGG - Intergenic
1134917200 16:18082959-18082981 TTAAAAAAATAAGAGGAAGAGGG - Intergenic
1135230877 16:20706637-20706659 TTCAACAAACATGAGGCAGATGG - Intronic
1135232053 16:20717805-20717827 TTAAAAAAAGAAGAAGAGGAAGG + Intronic
1135794827 16:25431828-25431850 TTTAAAAAAGGTGGGGAGCAGGG + Intergenic
1135800064 16:25485679-25485701 TTCCAAAAACTTGAGGAGGAGGG - Intergenic
1135838710 16:25853890-25853912 TTTCAAGAACTTGAAGAGGAGGG - Intronic
1136145368 16:28313312-28313334 TTTAAAAAACGACAGGAGGCTGG + Intronic
1136643192 16:31585581-31585603 TTCCAAAAACATGAAAAGGACGG - Intergenic
1136659704 16:31746723-31746745 CCTGAAAAACATGAGGAGAATGG - Intronic
1136708508 16:32211648-32211670 TATAAAAACCCTTAGGAGGAGGG - Intergenic
1136729661 16:32397793-32397815 TTCTGAAAAAATGAGGAGGAAGG - Intergenic
1136774003 16:32861498-32861520 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1136808708 16:33152622-33152644 TATAAAAACCCTTAGGAGGAGGG - Intergenic
1136896606 16:34000021-34000043 TTTGAAAAGCATGTGGAGGCTGG + Intergenic
1137418157 16:48304812-48304834 TTTAACAAACATGAGTTGTAGGG + Intronic
1137451026 16:48573941-48573963 TTTGAATAAGCTGAGGAGGAGGG + Intronic
1137671130 16:50279978-50280000 TTCAAAAAAATTGAGGAAGAGGG - Intronic
1138129518 16:54467760-54467782 TTTAAAAAAGAAAAGGAGGAAGG - Intergenic
1138161117 16:54755753-54755775 TTTGAAAAACAGGAGGTAGAAGG - Intergenic
1138339425 16:56279041-56279063 TGAAAAAAACATGAGAGGGAAGG - Intronic
1138812861 16:60171294-60171316 TTTAAAAACCATGATGAGGCCGG + Intergenic
1138883544 16:61047094-61047116 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1139186894 16:64816943-64816965 TTTCAAATAATTGAGGAGGAGGG - Intergenic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140494328 16:75370406-75370428 TTTAAAAATAATGTGGAGGGAGG + Intronic
1140509580 16:75497179-75497201 TTTAAAAATCATGAACAGGCCGG - Intergenic
1140595306 16:76402077-76402099 TTCCAAAAAACTGAGGAGGAAGG - Intronic
1141061801 16:80880152-80880174 TTTAAATAAAATGAAGAGAATGG - Intergenic
1141258691 16:82430299-82430321 TTCAAAAAAATTCAGGAGGATGG + Intergenic
1141661386 16:85443445-85443467 TCTCAGTAACATGAGGAGGAAGG - Intergenic
1202996735 16_KI270728v1_random:119501-119523 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
1203023422 16_KI270728v1_random:431843-431865 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
1203061552 16_KI270728v1_random:978073-978095 TATAAAAACCCTTAGGAGGAGGG + Intergenic
1203076425 16_KI270728v1_random:1123609-1123631 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1143200521 17:5110186-5110208 ATGAAAAAAGAAGAGGAGGACGG - Intronic
1143257334 17:5570697-5570719 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1143915346 17:10288061-10288083 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1144137469 17:12311505-12311527 TTCCAAAAAGTTGAGGAGGAGGG - Intergenic
1144518960 17:15941779-15941801 TTCAGGAAACACGAGGAGGAAGG - Intergenic
1144531437 17:16042965-16042987 ATTATAAGACATGAGGAGAAAGG + Intronic
1144956272 17:19020382-19020404 GTTGACACACATGAGGAGGATGG - Exonic
1145284767 17:21497221-21497243 TTTAACTAACATGAGAAGCAGGG - Intergenic
1145392756 17:22468542-22468564 TTTAACTAACATGAGAAGCAGGG + Intergenic
1145914398 17:28563009-28563031 TATTAAAAATATGTGGAGGACGG + Intronic
1146068026 17:29652950-29652972 TTTAAATAAAATAAGGAGGCCGG - Intronic
1146070565 17:29677253-29677275 TTCTAAAAACATTAGGAGGTAGG + Intronic
1146415548 17:32629371-32629393 CTTAAAAAAAATTAGGAGGTTGG + Intronic
1146543080 17:33714595-33714617 TTTAAAAACCATGAACAGGAAGG + Intronic
1146810257 17:35897629-35897651 ACTAAAAAAAATGAGGAGGCCGG + Intergenic
1147507617 17:41035108-41035130 TTTAAGAAACATGAGGAGTTAGG - Intergenic
1147733916 17:42622098-42622120 TTCAAAAAACAAGTGGAGGCTGG + Intergenic
1148402183 17:47374765-47374787 TTTAAAAAACATTCAGAGAAGGG + Exonic
1148549292 17:48541263-48541285 TTAAAGAAACCTAAGGAGGATGG + Intronic
1148650071 17:49244121-49244143 ATTAAAAGACATGAGGGGGCTGG - Intergenic
1149014100 17:51888178-51888200 TTTAAAAAAAAGGAGAAGAAAGG + Intronic
1149060085 17:52411464-52411486 TTTAGAAAACAGGGGAAGGATGG - Intergenic
1149114518 17:53076297-53076319 TTCAAAAAAATTGAGGAGAAGGG - Intergenic
1149127932 17:53257854-53257876 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1149505901 17:57193699-57193721 TCTACAAAAAATGAGGTGGAAGG + Intergenic
1149546930 17:57510722-57510744 TTTTAAAACCAAGAGGAGGCCGG - Intronic
1149894212 17:60416495-60416517 ATTAAAAAAAATGTGGTGGAGGG + Intronic
1150062489 17:62080720-62080742 GGTAAAAAACATGATGTGGAAGG - Intergenic
1150090655 17:62322307-62322329 ATTAAAAAGTTTGAGGAGGAGGG + Intergenic
1150441510 17:65195270-65195292 TTTAAATAAAATGGGGAGCATGG + Intronic
1150517822 17:65832809-65832831 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1150533468 17:66010993-66011015 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1150940195 17:69684709-69684731 TCCAAAAAAACTGAGGAGGAGGG - Intergenic
1150968743 17:70002644-70002666 TGTCAAAAAAATGATGAGGAAGG + Intergenic
1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG + Intergenic
1151418951 17:73985003-73985025 TTTAATAAACGTGAGGTGGATGG - Intergenic
1151544444 17:74784021-74784043 TTTTTAAAGCATGAAGAGGACGG - Intronic
1152204957 17:78969761-78969783 AACAAAAAACATGTGGAGGAGGG + Intergenic
1152986131 18:322922-322944 TTTAAAAAAAATGAGTATGAAGG + Intronic
1153008725 18:518818-518840 TTAATAAAACCTGAGGAAGAGGG + Intergenic
1153097986 18:1430950-1430972 TTTAAATAAAATGATGAGGGTGG + Intergenic
1153402485 18:4695914-4695936 TTGAAAAAAGATGAGAAGCATGG + Intergenic
1153411047 18:4793251-4793273 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
1153462160 18:5347806-5347828 TTCCAAAAAAATGAGGAGGAGGG + Intergenic
1153876913 18:9382199-9382221 TAGAAAAAACAAGAGGAGGCTGG + Intronic
1155463525 18:26110220-26110242 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1155529403 18:26750821-26750843 TTTAAAAGAAATGATGAGGCTGG - Intergenic
1155609228 18:27644638-27644660 TTCAAAAAACATGAAGAATATGG + Intergenic
1155855689 18:30831298-30831320 TTCCAAAAAGTTGAGGAGGAGGG + Intergenic
1156696132 18:39770484-39770506 TTTAAAAGACAGGAAGAGAAGGG - Intergenic
1156702270 18:39840229-39840251 TTTCAAAATGATGAGGAGGTGGG - Intergenic
1156770829 18:40722033-40722055 TTTCAAAAAATTGATGAGGAGGG + Intergenic
1156883632 18:42109276-42109298 TTTAAAACACAAGAGAAGGAAGG - Intergenic
1157429267 18:47611204-47611226 CTTAAAAAATATCTGGAGGATGG - Intergenic
1158052142 18:53234982-53235004 TTTGAAAAACCTCATGAGGATGG + Intronic
1158063021 18:53369993-53370015 TTTCAAAAAACTGAAGAGGAGGG - Intronic
1158278773 18:55797821-55797843 TTTAAAAAACAGATGGAGCAAGG - Intergenic
1158951838 18:62502431-62502453 CTTCATACACATGAGGAGGATGG + Intergenic
1159302640 18:66595772-66595794 TTTCAAAAATTTGAGGAGGATGG + Intronic
1159375653 18:67589191-67589213 TTTAAAAAACAGGAAGAGAAAGG - Intergenic
1159397412 18:67879957-67879979 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1159439902 18:68464818-68464840 TTTAAAAAAAATTAGAAGGAAGG + Intergenic
1159504647 18:69319663-69319685 TTCAAAAAAATAGAGGAGGAGGG - Intergenic
1159606672 18:70481416-70481438 TTTAAAATTCATGTGGAGGTTGG - Intergenic
1159606758 18:70482451-70482473 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1159799588 18:72880895-72880917 TTTCAAAAACATGGATAGGACGG - Intergenic
1160120800 18:76129092-76129114 TTTAAAATACATTAGGATTATGG - Intergenic
1160301181 18:77680582-77680604 TTTAAAAAAAAAGAAGAGAATGG + Intergenic
1160434921 18:78842712-78842734 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1160884305 19:1338202-1338224 TTCGGAAAAGATGAGGAGGATGG - Intergenic
1161081920 19:2315511-2315533 TTTCAGAAACTAGAGGAGGAAGG - Intronic
1161904223 19:7143122-7143144 TTTAAAAAAAATGATGGTGATGG - Intronic
1163055499 19:14714642-14714664 TTTAAAAAAAGTGAGGGGAAAGG + Intronic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164496687 19:28771226-28771248 TTCAAAAAAATTGAGGAGAAGGG - Intergenic
1164523392 19:28995864-28995886 TTAAAAAAAAATGAAGAGGGGGG + Intergenic
1165531065 19:36402170-36402192 TTTAAAATAGATTAGGAGGCCGG + Intronic
1165548234 19:36560574-36560596 TTAAAAAAAAATGAGAAGAAAGG - Intronic
1166176164 19:41072459-41072481 TCCAAAAAAAATGAGCAGGAAGG - Intergenic
1166176614 19:41077049-41077071 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1166326839 19:42056294-42056316 TTTTTTAAACAGGAGGAGGAAGG + Intronic
1166403269 19:42500157-42500179 TTTAAAAAAGAAGAGGAGGGAGG - Intergenic
1167946514 19:52992999-52993021 TTTAAAAAGCACGGGGTGGAGGG + Intergenic
1168196649 19:54779518-54779540 TTTTCAAAAGATGAGGAAGAAGG - Intronic
1168205005 19:54843774-54843796 TTTTCAAAAGATGAGGAAGAAGG - Intronic
925051462 2:819013-819035 TTTAAAGCATTTGAGGAGGATGG - Intergenic
925074303 2:1000722-1000744 ATTTTAAAAAATGAGGAGGAAGG + Intronic
925798984 2:7578011-7578033 TTTAAAAAGCAAGAGAAGAAAGG - Intergenic
926626178 2:15091827-15091849 TTAAAAAAACACAAGGAGGCTGG - Intergenic
926772456 2:16390672-16390694 TTTAGAAATCAGGAAGAGGATGG + Intergenic
927565448 2:24108399-24108421 TTACAAAAAATTGAGGAGGAGGG + Intronic
927981462 2:27377515-27377537 TGTATAAAACATGGGGAAGAAGG + Exonic
928041249 2:27879946-27879968 TTCCAAAAAACTGAGGAGGAGGG + Intronic
928250010 2:29667821-29667843 TTCAAAAAAATTGAAGAGGAGGG - Intronic
928589067 2:32795041-32795063 TTCCAAAAAATTGAGGAGGAAGG + Intronic
928680310 2:33694450-33694472 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
928734251 2:34267289-34267311 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
928834409 2:35525888-35525910 TTCAAAAAAATAGAGGAGGAGGG - Intergenic
929003684 2:37373833-37373855 TTTAAGAAATGTGAGGAGGCTGG - Intergenic
929100393 2:38306346-38306368 TTCCAAAAACCAGAGGAGGAGGG + Intronic
929180858 2:39037220-39037242 TTTCAAAAACAACAAGAGGATGG + Intronic
929371616 2:41231242-41231264 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
929522209 2:42664088-42664110 TCTAACAAAAATGAGGTGGAAGG - Intronic
929532016 2:42758720-42758742 TTTTAAATACAGGAGGAGAAGGG - Intergenic
929608889 2:43255092-43255114 TTTTAAAAACCTGGGGAGGTGGG + Intronic
929752317 2:44728454-44728476 TTCCAAAAAATTGAGGAGGAGGG - Intronic
929844212 2:45504897-45504919 TTTAATAAAAACGAGGAGTAAGG + Intronic
929939836 2:46325123-46325145 CTTAAAAAGCATGGTGAGGAAGG + Intronic
930211113 2:48638186-48638208 TTTCAAAAAATTGAGGAGGAAGG + Intronic
930370615 2:50496535-50496557 TTAGAAAAACATGTGGAGCAGGG - Intronic
930482678 2:51968804-51968826 TTTATTAAACACAAGGAGGAGGG + Intergenic
930845246 2:55896528-55896550 TTTATCAAACATAAGGAGTAGGG - Intronic
931095122 2:58931019-58931041 GTGAAAGAAAATGAGGAGGAGGG - Intergenic
931526478 2:63160777-63160799 TTTAAAAAACATCAGGTGAAAGG + Intronic
931545906 2:63387093-63387115 TTCCAAAAAAATGAGAAGGAAGG + Intronic
931784008 2:65602883-65602905 TAGATAAAACATGAGGAGGTTGG + Intergenic
931857915 2:66323247-66323269 TTTAAAAAAAATGAAGAGAGGGG + Intergenic
932280586 2:70488621-70488643 TTTCAAAAAAATGAGGGGTAGGG - Intronic
932371730 2:71195256-71195278 TTCTAAAAAATTGAGGAGGAGGG - Intronic
932482823 2:72058078-72058100 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932602357 2:73136841-73136863 TTTAAAAAAGATGAAAAAGAAGG - Intronic
932752856 2:74382774-74382796 TTTAAAAAATATGTGGAGGCCGG + Intronic
933118451 2:78503782-78503804 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
933294268 2:80471801-80471823 TTTAACAAACTTGAGGACAAAGG - Intronic
933337006 2:80971430-80971452 TTTAAAGTAATTGAGGAGGAGGG + Intergenic
933619615 2:84523001-84523023 TCTAAAAAAAATGAGGAAGGGGG - Intronic
933625142 2:84589764-84589786 CTCAAAAAACATGAAGAGAAAGG + Intronic
933638805 2:84737362-84737384 TTCCAAAAAATTGAGGAGGAGGG - Intronic
934185966 2:89675836-89675858 TTCCAAAAAAATGAGGACGAAGG - Intergenic
934987896 2:98900501-98900523 TTTGAAAAGCCAGAGGAGGAGGG - Intronic
935440647 2:103091541-103091563 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
935491605 2:103727779-103727801 TTTTGAAAAGTTGAGGAGGAGGG - Intergenic
935834977 2:107040652-107040674 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
936000450 2:108823229-108823251 TTCGAAGAATATGAGGAGGATGG - Intronic
936022711 2:109006864-109006886 TTATACAAACATGAGGAAGACGG + Intergenic
936390899 2:112072313-112072335 TTCCAAAAAATTGAGGAGGAGGG - Intronic
936402834 2:112178458-112178480 TTCCAAAAAACTGAGGAGGATGG + Intronic
936444211 2:112583841-112583863 TTTAAGACAGATGAGAAGGAAGG + Intergenic
936838277 2:116735616-116735638 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
937034564 2:118769998-118770020 TTTAAAACACATGGGGACAAGGG - Intergenic
937196126 2:120158203-120158225 TTTCAAAAAATTGAGGAGGAGGG + Intronic
937483161 2:122284204-122284226 TTTATAAAACATGAGAATGAGGG + Intergenic
937739825 2:125337585-125337607 TTTCAAAAAGTAGAGGAGGAAGG + Intergenic
937865191 2:126745675-126745697 TTTAAAAAAATTGAGGTGGCTGG - Intergenic
938178094 2:129154641-129154663 TATAAAAAACATGGTGAAGATGG + Intergenic
938423590 2:131165284-131165306 TTAAAAAAACATGATGCAGACGG - Intronic
938507256 2:131899271-131899293 TTTGAAAAAAATGAGAAGGAAGG + Intergenic
939108144 2:137973805-137973827 TTTCAGAAACATGAGCAGGGAGG + Intronic
939190891 2:138915481-138915503 TTAGAGAAAGATGAGGAGGAAGG - Intergenic
939202188 2:139051312-139051334 TTTAAAATGCATGGGGAGTAAGG + Intergenic
939236447 2:139500340-139500362 TTTCAAAAAATTGAGAAGGAGGG + Intergenic
939315722 2:140547188-140547210 TACAAAAAAATTGAGGAGGAGGG - Intronic
939484280 2:142790438-142790460 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
939698872 2:145363866-145363888 TTTAAAAATAATGAGTAGGCCGG + Intergenic
939762658 2:146201914-146201936 TTAAAAGAACAAGAGTAGGAGGG - Intergenic
939949271 2:148449273-148449295 TTGAAAATACATAAGGAGGTGGG - Intronic
940208501 2:151231669-151231691 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
940328923 2:152453873-152453895 TTTCAAAAACATGAGAAATAAGG + Intronic
940412355 2:153380310-153380332 TTTAAAATATATGAGGAGGCTGG + Intergenic
940438705 2:153687177-153687199 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
940447225 2:153790039-153790061 TTTCAAAAAATTGATGAGGAGGG + Intergenic
940456640 2:153909964-153909986 TTCCAAAAAAATGAGGAAGAGGG - Intronic
940530633 2:154872608-154872630 TTTCAAATAAATGTGGAGGAGGG - Intergenic
940535253 2:154932993-154933015 TTACAAAAAATTGAGGAGGAGGG - Intergenic
940576101 2:155505998-155506020 CCAAAAAAAAATGAGGAGGAGGG + Intergenic
940628856 2:156211998-156212020 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
940708224 2:157130236-157130258 TTTTAAAAAATTGAGGAGGAGGG + Intergenic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941048943 2:160709348-160709370 TTCCAAAAAAACGAGGAGGAGGG - Intergenic
941103330 2:161322684-161322706 TTAAAAAAACATGACCAGGCCGG - Intronic
941221891 2:162792317-162792339 TCCAAAAAAATTGAGGAGGAGGG - Intronic
941329568 2:164163705-164163727 TTTAAAAAAACAGAAGAGGAGGG - Intergenic
941392392 2:164930357-164930379 TTCCAAAAAATTGAGGAGGAGGG + Intronic
941497838 2:166229102-166229124 TTTAATAAACATGAGTCGGCTGG - Intronic
941573738 2:167203587-167203609 CTTAAAAAACATGGAGAAGAAGG - Intronic
941747058 2:169098087-169098109 TTTAAAATACATGAGAAGGTGGG + Intergenic
942538647 2:176992337-176992359 TTTCAAAAAATTGAAGAGGAGGG + Intergenic
942759880 2:179385628-179385650 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
942813990 2:180030048-180030070 TTTTAAAAAACGGAGGAGGAAGG - Intergenic
942819562 2:180096139-180096161 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
942869145 2:180713903-180713925 TTCCAAAAAAATGAGGAAGAGGG + Intergenic
942882366 2:180876576-180876598 TTTCAAAAAGTAGAGGAGGAGGG + Intergenic
942894749 2:181038910-181038932 ATAAAAAAACAGGATGAGGAAGG + Intronic
943057260 2:182997786-182997808 TTTCAAAAAGTTGAGGGGGAGGG + Intronic
943188813 2:184649916-184649938 TACAAAAAATTTGAGGAGGAGGG + Intronic
943265762 2:185729908-185729930 TTAAAAAATCATGAGGAGAAAGG + Intergenic
943459286 2:188150845-188150867 TTTAAAAGATATGGGGAGAAGGG + Intergenic
943511422 2:188831757-188831779 TTTAAAAAATATGAAGGAGAGGG - Intergenic
943607033 2:189987980-189988002 TTTAAAAACAATTAGGTGGATGG + Intronic
943611660 2:190042052-190042074 TTCCAAAAAACTGAGGAGGAGGG - Intronic
943688341 2:190842922-190842944 TTTAAAATGCATGGGGAGGGTGG + Intergenic
944213883 2:197234603-197234625 ATTAAAAAGAATGAGGTGGATGG - Intronic
944338482 2:198566182-198566204 TTTGAAAAAATTAAGGAGGAGGG - Intronic
944601854 2:201311251-201311273 TTCCAAAAAAATGAGGAGGAGGG + Intronic
944788837 2:203102842-203102864 TTCCAAAAAATTGAGGAGGAAGG - Intronic
944861421 2:203819143-203819165 ATTACCAAACTTGAGGAGGAAGG - Intergenic
945031589 2:205669450-205669472 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
945363609 2:208923884-208923906 TCTCAAAAAATTGAGGAGGAGGG - Intergenic
945430547 2:209758612-209758634 TTCCAAAAACCTGAGGAGGAGGG + Intergenic
946103428 2:217348042-217348064 TTCCAAAAAATTGAGGAGGAAGG - Intronic
946640871 2:221782364-221782386 TTTTAAAAACAGGAGGTAGAAGG + Intergenic
947266440 2:228287455-228287477 TTCAAAAATTTTGAGGAGGAGGG - Intergenic
947281190 2:228457088-228457110 AAAAAAAAAAATGAGGAGGAGGG - Intergenic
947438246 2:230091836-230091858 TTCAAAAACACTGAGGAGGAGGG + Intergenic
947490184 2:230587221-230587243 TTAAAAAAAAATCAGGAGGCCGG + Intergenic
948532740 2:238622194-238622216 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
948875054 2:240821579-240821601 ATTAAAAAGCATGAGGAAAACGG - Intergenic
1169105890 20:2994173-2994195 TTAAGAAAAGATGAGGAGGGAGG + Intronic
1169188284 20:3638623-3638645 TTTAAAAAATATAAGGACAATGG + Intronic
1169442199 20:5641870-5641892 TTTTAAAAAGGTGAGGAGGCTGG + Intergenic
1169494504 20:6102025-6102047 TCTAAAAAACAGTAGGCGGATGG - Intronic
1169631324 20:7635643-7635665 TTTAAAAATGAGGAGGAGAATGG - Intergenic
1169678347 20:8180488-8180510 TTCTAAAAATCTGAGGAGGAGGG - Intronic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1169993574 20:11530854-11530876 TTCCAAAAACTTGAGGAGGAAGG + Intergenic
1170049844 20:12129900-12129922 TTTAAAAAATAAGAGGAACAAGG + Intergenic
1170477687 20:16732225-16732247 TTTAAAGACCATGAAGATGAGGG + Exonic
1170508409 20:17052796-17052818 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
1170862374 20:20119154-20119176 TTCAAAAAAATTGAAGAGGAGGG - Intronic
1171027295 20:21642424-21642446 TTTAAAATACAGGTGGGGGATGG - Intergenic
1171567858 20:26210525-26210547 TTTAAAAAACATTACTAAGAGGG - Intergenic
1171725326 20:28613668-28613690 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1171789527 20:29508156-29508178 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1171858007 20:30366292-30366314 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
1172105433 20:32514556-32514578 TCTTAAAAAAAGGAGGAGGAGGG - Intronic
1173008756 20:39161563-39161585 TTCAAAAAAACTGAAGAGGAAGG - Intergenic
1173195158 20:40908185-40908207 TTTAAATACCTTGAGGGGGAGGG - Intergenic
1173581536 20:44150197-44150219 CATAAAAAAAATGAGGAGGATGG + Intronic
1173695276 20:45005348-45005370 TTTAAAAAACATTAGCAGCTGGG + Intronic
1173772185 20:45670267-45670289 TTCCAAAAACTTGAGGAGGAGGG + Exonic
1174215181 20:48911138-48911160 TTTAAGACAAATGAGGTGGAAGG - Intergenic
1174908732 20:54582392-54582414 TTCAAAAAAACTGAAGAGGAAGG - Intronic
1174976649 20:55343293-55343315 TTTAAAAAGCATGTGTATGAAGG - Intergenic
1174983962 20:55428716-55428738 TATAAGAATCTTGAGGAGGAAGG + Intergenic
1175868381 20:62193941-62193963 TTTAAAACAAATGCGGAGGCTGG + Intronic
1176688528 21:9876681-9876703 TCTAAAATAATTGAGGAGGAGGG - Intergenic
1176786373 21:13261055-13261077 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1176881459 21:14199706-14199728 TCCAGAAAAAATGAGGAGGAGGG + Intronic
1176923388 21:14717166-14717188 TTTAAAACTCATGAGGAGGCTGG - Intergenic
1176939526 21:14907228-14907250 TTTCAAAAAGTAGAGGAGGAGGG - Intergenic
1177325474 21:19582826-19582848 TTTTAAAGACATGAAGAGTAGGG + Intergenic
1177438221 21:21083706-21083728 TTTAAAAAAGATGAGGCTGGGGG - Intronic
1177984983 21:27963126-27963148 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1178046534 21:28700749-28700771 TTTCAGAAAATTGAGGAGGAGGG + Intergenic
1178168082 21:30005610-30005632 TTTGAAATAAAAGAGGAGGAAGG - Intergenic
1178344335 21:31811984-31812006 TTTAAAAACTATGAGATGGATGG - Intergenic
1178399167 21:32268982-32269004 TTTAACAAATAAGGGGAGGAAGG + Exonic
1178539419 21:33436814-33436836 TTTTAAATACTTGAGGAGGTTGG - Exonic
1179290227 21:40012074-40012096 TTTAAAAAACAGCAGGAGGCTGG + Exonic
1180112265 21:45665726-45665748 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1180178367 21:46102957-46102979 TTCAAAAAACTTGAAGAGAAGGG - Intronic
1180206159 21:46262260-46262282 TTTCAAAAAACTGAAGAGGAGGG + Intronic
1180457681 22:15525259-15525281 TCCAAAAAAACTGAGGAGGAGGG + Intergenic
1180542805 22:16467248-16467270 TCTGAAAAAAATGAGGAGGAAGG + Intergenic
1180572743 22:16743793-16743815 TTTCAAGAAACTGAGGAGGAGGG + Intergenic
1180646129 22:17340637-17340659 TTTAAAAAATATGTTGAGGCTGG + Intergenic
1180735532 22:18013792-18013814 TTTAAAAAAATAGAGGGGGAGGG - Intronic
1181893863 22:26088979-26089001 TTTATAAAACATGAGGAAATTGG - Intergenic
1182018058 22:27057529-27057551 TTTACAAAACAGGAGGTGGCTGG + Intergenic
1182929355 22:34158077-34158099 TTAAAAAACCCTGAGGAGGCCGG + Intergenic
1182986067 22:34718106-34718128 TTTGAAAATATTGAGGAGGAGGG + Intergenic
1183889778 22:40917410-40917432 TTTAAAAAACACAAGGAATAGGG + Intronic
1184618044 22:45651455-45651477 TATAAAAAAAAGAAGGAGGAAGG + Intergenic
1185209053 22:49556557-49556579 TTTAAAAAACATCAGAAAGCTGG - Intronic
949499994 3:4670707-4670729 CCTAGAAAACAAGAGGAGGAGGG - Exonic
949601503 3:5603538-5603560 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
949629666 3:5910607-5910629 TTCAAAAAAATTGAGGAAGAAGG - Intergenic
949651976 3:6170416-6170438 TTTTAAAAACAATAGGCGGACGG + Intergenic
949661767 3:6287228-6287250 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
950518572 3:13482905-13482927 TATCAAAAACATGAGGTGGGAGG - Intronic
950942733 3:16910251-16910273 TTTAAAAAAAAACAGGAGCAAGG - Intronic
951283700 3:20783233-20783255 CTCCAAAAACATGAGGAGGAGGG + Intergenic
951296955 3:20949163-20949185 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
951620481 3:24596015-24596037 TTTGCAAAACATGACAAGGAGGG + Intergenic
951661255 3:25069056-25069078 TTTAAAAACCATGATGAGTATGG - Intergenic
951782036 3:26374400-26374422 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
952008506 3:28871733-28871755 TTCCAAAAACTAGAGGAGGATGG - Intergenic
952277857 3:31894936-31894958 TCTAAAAAGCAAGTGGAGGAGGG - Intronic
952294981 3:32053676-32053698 ATTAAAAAAAATAATGAGGATGG + Intronic
952389450 3:32867175-32867197 TCTAAAAAAGAGGAGGGGGAGGG - Intronic
952469463 3:33630909-33630931 TGTAAAACACAAAAGGAGGAAGG + Intronic
952548022 3:34443831-34443853 TTTAAAATATATGTAGAGGAGGG - Intergenic
952572063 3:34729714-34729736 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
953224607 3:41006166-41006188 TTCCAAAAACTTGAAGAGGAGGG - Intergenic
953459444 3:43070966-43070988 TTTAAAAAAAATAATGAGGTGGG - Intergenic
953602072 3:44376790-44376812 TTTAAAAAACATGATTTGGCCGG + Intronic
954363736 3:50135584-50135606 CTTAAAAAAGAAGTGGAGGAAGG + Intergenic
954417721 3:50402023-50402045 TTTTAACATCAAGAGGAGGAAGG + Intronic
954893521 3:53955082-53955104 TTTAAATAACAGGAGGAAAATGG + Intergenic
955075157 3:55606822-55606844 TGTAAAGAAGAAGAGGAGGAGGG - Intronic
955229168 3:57083920-57083942 GTTAGAAAACCTGAGGAGCAAGG + Intergenic
955719836 3:61869019-61869041 TTCATAAAGCATTAGGAGGACGG + Intronic
955806511 3:62741230-62741252 TTCCAAAAAATTGAGGAGGAGGG + Intronic
955886428 3:63603886-63603908 TTTCAAAAAATTGAGGAGGAAGG - Intronic
956112532 3:65883987-65884009 TTTAAAAAAAATCAGAAAGAAGG + Intronic
956547643 3:70423007-70423029 TGTAAAAAACATTAGGGGCAGGG + Intergenic
956834663 3:73086819-73086841 ATTAAGAGCCATGAGGAGGAAGG + Intergenic
957021589 3:75134352-75134374 TTAAAAAAACATCAAGAAGAGGG + Intergenic
957195126 3:77057876-77057898 TTTAAAAAATATGTGGCTGACGG + Intronic
957265016 3:77952088-77952110 TTTATAAAAGATGACAAGGAAGG - Intergenic
957699108 3:83686587-83686609 TTTAGAAAACATAAGCAAGAAGG + Intergenic
957881736 3:86223669-86223691 TCTAAAAAAACTGAAGAGGAGGG + Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
958497091 3:94859195-94859217 TTTCAAAAACTCTAGGAGGACGG - Intergenic
958608323 3:96389642-96389664 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
958825883 3:99030422-99030444 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
958960023 3:100500795-100500817 TTTAAAAAAAATGACCAGCAAGG + Intronic
959034657 3:101346937-101346959 GTTTAAAAAAAGGAGGAGGAGGG + Intronic
959163798 3:102751145-102751167 TTTAAAAAATATGGATAGGATGG + Intergenic
959330669 3:105000728-105000750 TGCAAAAAAATTGAGGAGGAGGG + Intergenic
959519842 3:107313022-107313044 TTGCAAAAACTTGAGGAGGAAGG - Intergenic
959663248 3:108892699-108892721 TCTAAATAAAATCAGGAGGAAGG - Intergenic
959679951 3:109083618-109083640 TTCAAAAAAACTGAAGAGGAAGG + Intronic
959821879 3:110745042-110745064 TTTCAAAAAATAGAGGAGGAGGG + Intergenic
959861383 3:111219257-111219279 TTTAAAAATTAAGAGGAGGCAGG + Intronic
959881740 3:111451291-111451313 TTTCAAAAACTTGAGGAGGAGGG + Intronic
959977910 3:112482795-112482817 TTTCAAAAAAATGAAGAGAAAGG + Intronic
959998748 3:112708022-112708044 TTTCAGAAAGTTGAGGAGGAGGG - Intergenic
960176800 3:114526926-114526948 TTGAAAAAAGATCTGGAGGAGGG - Intronic
960645186 3:119872532-119872554 TTTGACAGAAATGAGGAGGATGG + Intronic
960685967 3:120293950-120293972 TTCCAAAAAAGTGAGGAGGAGGG + Intergenic
960738266 3:120804177-120804199 TTAATAAAACCTGAGGAGGGGGG - Intergenic
960999818 3:123366661-123366683 ATTTAAAACCATGGGGAGGAGGG + Intronic
961417484 3:126770862-126770884 TTTCAAAAAATTGAGGAGGAGGG - Intronic
961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG + Intergenic
961932766 3:130551204-130551226 TTTCTAAAACTTGAGGTGGAGGG - Intergenic
962082393 3:132154210-132154232 ATGAAAAAACGTGAGGGGGAGGG + Intronic
962323206 3:134407956-134407978 TTTAAAAAAAACAAGGAGGCAGG - Intergenic
962433203 3:135339375-135339397 TATAAAACACATGAGGAAAAGGG - Intergenic
962464582 3:135645682-135645704 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
962832156 3:139153171-139153193 TTCCAAAAAATTGAGGAGGAGGG + Intronic
962869387 3:139475023-139475045 TCTAAAGAACATGAAGAGGCCGG + Intronic
962911238 3:139852391-139852413 TTCAAATAAATTGAGGAGGAGGG - Intergenic
963516900 3:146320306-146320328 TTTCAAAAAGTTGAGGAGGAGGG + Intergenic
963532878 3:146493251-146493273 TTGCAAAAAATTGAGGAGGAGGG + Intronic
963632371 3:147749281-147749303 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
964206705 3:154182958-154182980 TTTAAAAAACGTTAGAAGAAAGG + Intronic
964706724 3:159626439-159626461 TTCAAGAAACATGGGCAGGAAGG - Intronic
964828806 3:160860232-160860254 TTTAAAAATGATTTGGAGGAAGG - Intronic
965098832 3:164271391-164271413 TTTAAAAGAGCTGAAGAGGATGG + Intergenic
965126789 3:164640591-164640613 TTTAAGAAACATGAGGGAGGAGG - Intergenic
965293532 3:166914736-166914758 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
965294004 3:166919486-166919508 TTGCAAAAAATTGAGGAGGAAGG + Intergenic
965606545 3:170503157-170503179 TTTACAAAGCAAGGGGAGGAGGG - Intronic
965649774 3:170921578-170921600 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
965730740 3:171769771-171769793 TTAAAAAAAATTGAGGGGGAAGG - Intronic
965748195 3:171947496-171947518 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
965956081 3:174371452-174371474 GTTCAAAAAAATGAAGAGGAAGG + Intergenic
966081052 3:176001475-176001497 TTTATATAAAATGAGGAGTATGG + Intergenic
966102559 3:176289678-176289700 TTTAAAAAAAATATTGAGGATGG - Intergenic
966238146 3:177725743-177725765 ATAAAGAGACATGAGGAGGATGG + Intergenic
967006234 3:185385525-185385547 TCCAAAAAAAATGAAGAGGAGGG + Intronic
967039755 3:185680410-185680432 TTCCAAAAAAATGAAGAGGAGGG + Intronic
967490391 3:190083979-190084001 TTTAAAAAACATAATGAGAATGG - Intronic
967575115 3:191080493-191080515 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
967581565 3:191162267-191162289 TTTAAAAAGCATGATGTGGCTGG - Intergenic
967709708 3:192692104-192692126 TTTAAAATAGATGAATAGGATGG - Intronic
968177894 3:196567346-196567368 TGAAAAAGACATGAGGAGAAGGG + Intronic
969178218 4:5416265-5416287 TTCAAGAAACATGACAAGGAAGG - Intronic
969954768 4:10877566-10877588 ATTATACAACATGAGGAGAAGGG + Intergenic
970210106 4:13700900-13700922 TTCCAAAAAACTGAGGAGGAAGG - Intergenic
970668748 4:18371082-18371104 TTCTAAAAAACTGAGGAGGAGGG + Intergenic
970744415 4:19277942-19277964 CTTACAAAACATGAAGAAGATGG - Intergenic
970860942 4:20701550-20701572 ATTAAATAACATGTAGAGGATGG - Intronic
971583922 4:28380645-28380667 TTTAAAGAACCTAAGGAGGCTGG + Intronic
971729406 4:30358033-30358055 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
971938486 4:33185547-33185569 TTTAAAAAAAATTAGGACCAGGG + Intergenic
972121330 4:35708140-35708162 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
972540544 4:40035402-40035424 TTTAAAAAAGAAGTGGAGGCTGG + Intergenic
972727013 4:41753575-41753597 TTTATAATACATGTGGAAGAGGG + Intergenic
972971911 4:44586856-44586878 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
973020455 4:45199242-45199264 TTCAGAAACCATGAGGATGAAGG - Intergenic
973078875 4:45964731-45964753 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
973145799 4:46824273-46824295 TTCCAAAAAACTGAGGAGGAGGG + Intronic
973877664 4:55236431-55236453 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
973895717 4:55410727-55410749 TTTAAAAAACATTTGAACGACGG - Intronic
974297191 4:60016059-60016081 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
974499116 4:62675322-62675344 CTTCAAAAACTTAAGGAGGATGG - Intergenic
974501890 4:62715636-62715658 TTTCAAAAAATTGAAGAGGACGG - Intergenic
974583753 4:63841894-63841916 ATTAAGAAACAAGTGGAGGATGG - Intergenic
974728034 4:65822019-65822041 CTTAAAAAATAAAAGGAGGAAGG - Intergenic
974846542 4:67357711-67357733 TTTAAAAAGCATGAGGTTGGAGG - Intergenic
975001336 4:69226168-69226190 TTTCAACAAATTGAGGAGGAGGG + Intergenic
975004107 4:69266068-69266090 TTTCAACAAATTGAGGAGGAGGG - Intergenic
975012509 4:69375081-69375103 TTTCAACAAATTGAGGAGGAGGG - Intronic
975158616 4:71100059-71100081 TTCCAAAAAATTGAGGAGGATGG + Intergenic
975793246 4:77978367-77978389 CTTAAAAAAATTGAAGAGGAAGG + Intergenic
975918322 4:79351710-79351732 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976025024 4:80676491-80676513 TTCAAAAAAATTGAAGAGGAGGG - Intronic
976249524 4:83035673-83035695 ATCAAAAAAAAAGAGGAGGAAGG - Intronic
976411394 4:84717093-84717115 TTTTAAACACATGAACAGGATGG + Intronic
976446328 4:85134007-85134029 TTTTAAAGACATAAGGAGAAAGG - Intergenic
976559373 4:86483870-86483892 TTTATAAAAGAAGAGGGGGAGGG + Intronic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
977001782 4:91513497-91513519 TTCAAAAAAACTGATGAGGAGGG - Intronic
977005657 4:91566423-91566445 TTCCAAAAAATTGAGGAGGAGGG - Intronic
977028509 4:91852072-91852094 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
977051516 4:92133860-92133882 GAAAAAAAAAATGAGGAGGAGGG + Intergenic
977225850 4:94390892-94390914 TATAAAAAAAATGAGTAGTAGGG + Intergenic
977304572 4:95306495-95306517 TATAAAATACATGAAGAGGCAGG - Intronic
977508419 4:97931776-97931798 TTAAAAAAAATTGAGGAGAAGGG - Intronic
977778296 4:100949789-100949811 GTTGAATAACATGAGGATGATGG + Intergenic
977846132 4:101769640-101769662 TTATAAAAACTTGAGGAGGAGGG - Intronic
977927324 4:102716011-102716033 ATTAAAAAGAATGAGGAGGCCGG + Intronic
977948300 4:102939510-102939532 TTCCAAAAAAATGAGGAGGAAGG + Intronic
978029959 4:103929124-103929146 TACAAAAAAATTGAGGAGGAGGG + Intergenic
978278953 4:106986272-106986294 TTTATAAAACATGAAGAAGGAGG - Intronic
978320370 4:107487021-107487043 TTTAAAAATTTTGAGGAAGAAGG + Intergenic
978952594 4:114579109-114579131 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
979012187 4:115386525-115386547 TTCCAAAAATATGAGAAGGAGGG - Intergenic
979178532 4:117695793-117695815 TTCAAAAAAATTGAGGAGAAGGG + Intergenic
979289678 4:118965928-118965950 TTTAAAAAAAATTAGCTGGATGG + Intronic
979629967 4:122889578-122889600 TTTTAAAAAAATGAGTAGTAGGG - Intronic
979647634 4:123090059-123090081 TTTAAAACACATCAGAAGGTAGG - Intronic
979757519 4:124360606-124360628 TTAAAGAAACAAGAGAAGGAGGG + Intergenic
979779254 4:124629129-124629151 TTTAAAAAACATTAGCACTAAGG - Intergenic
979874310 4:125868168-125868190 TCCAAAAAAACTGAGGAGGAAGG + Intergenic
980241660 4:130185088-130185110 TGTAAAAAACATTAGGAAGGAGG + Intergenic
980319161 4:131245622-131245644 TTTAAAAAGCATGTGGAAGGAGG - Intergenic
980328328 4:131377439-131377461 TTTAAAAAAGAAGAAGAGCATGG - Intergenic
980351913 4:131694480-131694502 TCTAAAATAATTGAGGAGGAGGG - Intergenic
980547741 4:134290811-134290833 TGTTAAAAAAATGTGGAGGATGG - Intergenic
980555790 4:134402421-134402443 TTGTAAAAAATTGAGGAGGAGGG - Intergenic
980573791 4:134659369-134659391 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980713121 4:136596261-136596283 TTTCAAAAAATTGAGGAAGAAGG - Intergenic
980729014 4:136803612-136803634 TTTATGATACATGAGCAGGAAGG + Intergenic
980815219 4:137938540-137938562 TTTCAAAAAAGTGAAGAGGAAGG + Intergenic
980863342 4:138525116-138525138 TTCCAAAAAGTTGAGGAGGAGGG + Intergenic
980907292 4:138961028-138961050 ATTCAGAAACAAGAGGAGGAGGG - Intergenic
980907449 4:138962265-138962287 TTTAAAAATCATGAGGAGGCCGG + Intergenic
980912567 4:139006894-139006916 TCTCAAAAAAAGGAGGAGGATGG - Intergenic
980939484 4:139260208-139260230 TCTAAAAAACAGAAGAAGGAAGG + Intergenic
981067058 4:140496956-140496978 TTTATAGAAAATGAAGAGGAGGG + Intronic
981275654 4:142895976-142895998 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
981520293 4:145654261-145654283 TTTAAAAATCATGACAAAGACGG + Intronic
981643399 4:146970614-146970636 TTTTAAAAACATGAGAAGAGGGG - Intergenic
981850332 4:149222001-149222023 TTGAAAAAAAATGGGGAAGAGGG + Intergenic
982213821 4:153063206-153063228 TTTAAAAAAAAGGTGGAGGGGGG + Intergenic
982306620 4:153938890-153938912 TTTTAAAAACCTTAAGAGGAAGG - Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982355185 4:154459270-154459292 TTTAAAAACCCTGAGAGGGAAGG + Intronic
982526274 4:156483239-156483261 TTTTAAAATCAAGAAGAGGAAGG - Intergenic
982611557 4:157580619-157580641 TATAGAAAAGTTGAGGAGGATGG + Intergenic
982868460 4:160546701-160546723 TTTAAATGAGAGGAGGAGGAAGG - Intergenic
982879275 4:160690588-160690610 TTTCAAAAAATTGAAGAGGAAGG + Intergenic
982939634 4:161533680-161533702 TTCAAAAAAATTGAGGAGGAGGG + Intronic
982955162 4:161755607-161755629 TTTATAAAGTATGTGGAGGAAGG + Intronic
983010993 4:162546952-162546974 TCTTAAAAAATTGAGGAGGAGGG - Intergenic
983443063 4:167812957-167812979 TTTAAGAAAGAAGATGAGGAAGG - Intergenic
983785398 4:171723355-171723377 TTCCAAAAACTTGAGGAGTAGGG + Intergenic
983876766 4:172886078-172886100 TTTCAAAAAATTGAAGAGGAGGG - Intronic
984054188 4:174905811-174905833 TTTAAAAAATTTCAAGAGGAAGG - Intronic
984746922 4:183230121-183230143 TTAAAAAAACAATAGGAGGCTGG - Intronic
984913082 4:184693521-184693543 TTTAAAAAACAAGATGAAGCAGG - Intronic
985435253 4:189924103-189924125 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
985831309 5:2234141-2234163 TTCCAAAAAATTGAGGAGGATGG - Intergenic
986060403 5:4184353-4184375 TTCCAAAAATTTGAGGAGGAGGG - Intergenic
986083820 5:4422230-4422252 TTTAAAAATCATTATGAAGAGGG - Intergenic
986979523 5:13431015-13431037 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987583798 5:19828323-19828345 TTTCAAAAAATTGAGAAGGATGG + Intronic
987665503 5:20933289-20933311 TGTGAAAAATATGAGGATGAAGG - Intergenic
987989773 5:25195360-25195382 TTTAAGAAATATGATGAGTAGGG - Intergenic
988048800 5:25996521-25996543 TATACAAATGATGAGGAGGAGGG + Intergenic
988306026 5:29495251-29495273 TTTCAAAAAAGTGAGGAGAAGGG - Intergenic
988348919 5:30075257-30075279 ACAAAAAAAAATGAGGAGGAGGG + Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988651349 5:33155117-33155139 ATTCAAAAAATTGAGGAGGAGGG + Intergenic
988757192 5:34268889-34268911 TGTGAAAAATATGAGGATGAAGG + Intergenic
988865315 5:35327956-35327978 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
988870895 5:35388371-35388393 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
988897354 5:35692092-35692114 TTTAAAAAACGTGATAAGGCTGG - Intronic
988966910 5:36428421-36428443 TTCCAAAAAGTTGAGGAGGAAGG - Intergenic
989010010 5:36859682-36859704 TTTAAAAACCATGAAGTGGCAGG - Intergenic
989079710 5:37605012-37605034 TTTAAAAAAAAAAAGAAGGAGGG - Intronic
989299466 5:39872356-39872378 TTGCAAAAAATTGAGGAGGAAGG - Intergenic
989313614 5:40051002-40051024 TTGAAAAAACATCAGGAAAATGG + Intergenic
989555176 5:42786147-42786169 TTCCAAAAAATTGAGGAGGAGGG - Intronic
989714000 5:44437842-44437864 TATTAAAAACATGAGTAGCAAGG + Intergenic
989757963 5:44979006-44979028 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
989789750 5:45383397-45383419 TTTAAATTCCATGAGGAGGCTGG + Intronic
990132388 5:52602450-52602472 TTTAAAAACAATGAGAAGAATGG + Intergenic
990167825 5:53014633-53014655 TTCCAAAAAATTGAGGAGGAGGG - Intronic
990215299 5:53524921-53524943 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
990898033 5:60720160-60720182 TTCAAAAAAATTGAGGAGGAAGG + Intergenic
991027706 5:62048568-62048590 TTTCAAACAATTGAGGAGGAGGG - Intergenic
991174491 5:63670870-63670892 TTCCAAAAAACTGAGGAGGAGGG + Intergenic
991238079 5:64422456-64422478 GTTCCAAAAAATGAGGAGGAGGG + Intergenic
991335404 5:65541206-65541228 TTAATTAAACCTGAGGAGGAGGG + Intronic
991504666 5:67311911-67311933 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992031830 5:72728845-72728867 TTGAAAAAAGATGAGAAGAATGG + Intergenic
992032533 5:72736809-72736831 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
992382578 5:76252908-76252930 TTTTAATAACATGAAGTGGAGGG - Intronic
992562046 5:77962564-77962586 TTTCAAAAATGTGAGGCGGAGGG - Intergenic
992751605 5:79867606-79867628 TTAAAAGAACATGAGGATCAGGG + Intergenic
992811177 5:80390187-80390209 TTTAAAAATCAGGGAGAGGAGGG - Intergenic
993018978 5:82567924-82567946 TTCCAAGAAAATGAGGAGGAGGG + Intergenic
993408090 5:87537342-87537364 TTTACTAAATAAGAGGAGGAAGG + Intergenic
993692090 5:91014410-91014432 TTCAAAAAAATTGAGGAGGAAGG - Intronic
993785859 5:92134679-92134701 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
993797321 5:92283620-92283642 TCCAAAAAAACTGAGGAGGAGGG + Intergenic
993811940 5:92490839-92490861 CTTAAAAAAGATTAGAAGGATGG - Intergenic
993941718 5:94066791-94066813 TTCCAAAAAAATGAAGAGGAGGG + Intronic
993944294 5:94099084-94099106 TTCCAAAAAATTGAGGAGGAAGG + Intronic
993995260 5:94715042-94715064 TTAAAGGAAGATGAGGAGGAAGG + Intronic
994096970 5:95856300-95856322 GTTTATAAACATGTGGAGGAAGG - Intronic
994119657 5:96099863-96099885 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
994134499 5:96269857-96269879 TTTAAAAAAATTGAGAAGGAGGG + Intergenic
994159135 5:96536055-96536077 TTAAAGAAAAAGGAGGAGGAGGG + Intronic
994236906 5:97373497-97373519 TTTCAAAAATTTGAGGAGGAGGG + Intergenic
994262391 5:97675243-97675265 TTTCAAAAAAATGAGGAGAAGGG + Intergenic
994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG + Intergenic
994409011 5:99382668-99382690 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
994503615 5:100611636-100611658 TTCCAAAAATTTGAGGAGGAGGG - Intergenic
994591342 5:101777082-101777104 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
994603619 5:101939677-101939699 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
994899327 5:105749806-105749828 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
995099546 5:108282129-108282151 TTTCAAAAAATTGAGGAGGATGG + Intronic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995325906 5:110889574-110889596 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
995455858 5:112351570-112351592 TTTCAAAAACCTGAAGAGGAGGG + Intronic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996071916 5:119140712-119140734 TTCCAAAAAATTGAGGAGGAGGG + Intronic
996615309 5:125434373-125434395 CTTAAAAAAAAAGTGGAGGAGGG + Intergenic
996861839 5:128076032-128076054 TTTTAAAAACATGAGTATGAAGG - Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997183916 5:131861985-131862007 TTTCAAAAAGTTGAAGAGGAGGG - Intronic
997281488 5:132650464-132650486 TTTAAAAAAAATGAGGGACAAGG + Intergenic
997909555 5:137856749-137856771 TTTAAAAAAAAAGCGGGGGAGGG + Intergenic
998039065 5:138939713-138939735 TTTAAAAAATATGTTGAGGTCGG - Intergenic
998275578 5:140749956-140749978 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
998589365 5:143461125-143461147 TTAAAAAAAAATTAGGAAGATGG - Intergenic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998614386 5:143723954-143723976 TTTCAAAAACTTGAGAAGAAGGG - Intergenic
998630443 5:143892280-143892302 ATTAATAAACATGAGTGGGAAGG + Intergenic
998977609 5:147665150-147665172 TTATAAAAACAGGAGCAGGATGG - Intronic
999109154 5:149102280-149102302 TTCCAAAAACTTGAAGAGGACGG + Intergenic
999450789 5:151676313-151676335 AGTGAAAAACATGAGGAGGTTGG + Intronic
999451481 5:151681593-151681615 ATTAAAAAACAAGAGCAGGCTGG + Intronic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
999851911 5:155549842-155549864 TTTCCAAAATAGGAGGAGGAGGG - Intergenic
1000237331 5:159374242-159374264 TAAAAAAAAATTGAGGAGGAAGG - Intergenic
1000395263 5:160768157-160768179 TTTAAAATTCATGATGATGATGG - Intronic
1000444810 5:161306441-161306463 AATAAAAAACAAGAGGAGGTAGG - Intronic
1000466933 5:161590923-161590945 TTCAAAAAAATTGAGGAGGGGGG - Intronic
1000479532 5:161754611-161754633 TTCCAAAAACTTGAAGAGGAGGG - Intergenic
1000581882 5:163044999-163045021 TTCCAAAAACATGAGGAGAAGGG + Intergenic
1000693458 5:164350792-164350814 TTAAAAAAACATGTGGGGTAGGG + Intergenic
1001375818 5:171257029-171257051 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1001840563 5:174873026-174873048 CTTAAAATGCATGAGGGGGAGGG - Intergenic
1002296973 5:178237137-178237159 ATTAAAAAACATTAGTAGGGTGG - Intergenic
1003038378 6:2664879-2664901 TTTAAAAATCAGGGAGAGGAGGG - Exonic
1003071901 6:2951441-2951463 TTTAAAAAAAATTAGGTGGTGGG + Intronic
1003137194 6:3442797-3442819 TTTAAATAAAGTGGGGAGGAGGG - Intronic
1003333856 6:5152461-5152483 TTAAAAAAATATTAGAAGGATGG - Intronic
1003918723 6:10811901-10811923 TATAAACTACAGGAGGAGGATGG + Intronic
1004174167 6:13324440-13324462 TTTAAGAAAGAAAAGGAGGATGG + Intronic
1004231519 6:13837949-13837971 TTTAAAGAAAATGATAAGGAAGG - Intergenic
1004416999 6:15433853-15433875 TTTAAAAAACAGGGGTATGATGG - Intronic
1004599667 6:17136152-17136174 TCCAAAAAAAATGAGGAGGAGGG + Intergenic
1004634372 6:17452934-17452956 TTTTAAAAAAAAGTGGAGGAGGG + Intronic
1004826267 6:19424817-19424839 TTTAAAAACCACCTGGAGGAAGG + Intergenic
1005097090 6:22128849-22128871 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1005250476 6:23940521-23940543 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1005366093 6:25078888-25078910 TTTAAAGAAGATGAGGAATAAGG - Intergenic
1005581500 6:27239328-27239350 TTTTAAAAAATTGGGGAGGACGG - Intergenic
1005766747 6:29018452-29018474 TTAAAAAAAATTGAAGAGGAGGG - Intergenic
1005880359 6:30053422-30053444 TTAAAAAAAACTGAAGAGGAAGG + Intergenic
1007874613 6:45082246-45082268 TTCCAAAAAAATGAGGAAGAGGG + Intronic
1008119469 6:47595402-47595424 TTTAAAAAGCATGATGGTGAAGG - Intronic
1008332122 6:50258025-50258047 TTTCAAAAAATTAAGGAGGAGGG - Intergenic
1008423947 6:51334621-51334643 ATTAAAGAAGATGAGGAAGAAGG - Intergenic
1008530105 6:52449050-52449072 TTCCAAAAAGTTGAGGAGGAGGG - Intronic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1008938366 6:57017759-57017781 TTTAAAAACCATAAATAGGATGG - Intronic
1009358068 6:62776803-62776825 TTTAAAATAGATTAGGAGGGTGG - Intergenic
1009639522 6:66314859-66314881 TTTAAAAGATCTGAGGAGGCCGG - Intergenic
1010005345 6:70989965-70989987 TGAAAAAAACCTGAGGATGAAGG + Intergenic
1010019882 6:71146895-71146917 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1010023098 6:71184142-71184164 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1010050588 6:71499252-71499274 TTTAAAAAGCATGAGATGAAAGG - Intergenic
1010104725 6:72153703-72153725 TTTAGAAAACATTCAGAGGAGGG + Intronic
1010340941 6:74751643-74751665 TTTAAAAAACATGTGTCGGCTGG - Intergenic
1010544059 6:77127988-77128010 TCCAAAAAAAATGAAGAGGAAGG + Intergenic
1010605573 6:77886195-77886217 TCCAAAAAAGTTGAGGAGGAGGG - Intronic
1010638372 6:78288416-78288438 TTTAAAAAAACTGAAGAGGAGGG - Intergenic
1010648450 6:78422610-78422632 TTCCAAAAAGATGAGGAGTAGGG + Intergenic
1010767689 6:79795041-79795063 TTTAAAAAACATGAAGTGATAGG - Intergenic
1010779763 6:79932242-79932264 TTTATAAAAAATGAGGGGGCCGG + Intronic
1010906583 6:81499016-81499038 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1011232261 6:85175696-85175718 TTTCAAAAAACAGAGGAGGAAGG - Intergenic
1011552160 6:88539778-88539800 TTAGGAAAACAAGAGGAGGAAGG + Intergenic
1011732851 6:90283669-90283691 TTAAAAATGCATGAGGAGGCCGG - Intronic
1011922983 6:92605493-92605515 TTTCAAAAAATAGAGGAGGAGGG + Intergenic
1011928265 6:92675258-92675280 TTTCAAAAAATTGAGGAGGAAGG + Intergenic
1011955429 6:93019418-93019440 ATTAAAAAACATAGGGTGGAAGG + Intergenic
1012129502 6:95472674-95472696 TTGAAAAAACATTAGAAGAATGG + Intergenic
1012337709 6:98081641-98081663 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1012345142 6:98176460-98176482 TTCCAAAAAATTGAGGAGGATGG + Intergenic
1012383733 6:98652666-98652688 TTTAAAAAAAAAAAAGAGGAAGG + Intergenic
1012420681 6:99061591-99061613 TTTAAAAACCAGATGGAGGAAGG - Intergenic
1012532527 6:100255131-100255153 CATATACAACATGAGGAGGATGG + Intergenic
1012689078 6:102291868-102291890 ATTAAAAAACAAAAGGAGGTGGG - Intergenic
1012743885 6:103057795-103057817 TTTCAAAAAATTGAGGAAGATGG - Intergenic
1012765316 6:103359964-103359986 TTCAAAAAAAATCAAGAGGAAGG + Intergenic
1012770507 6:103427332-103427354 TTCCAAAAATTTGAGGAGGAGGG + Intergenic
1012845671 6:104385022-104385044 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1012845987 6:104389368-104389390 TTCAAAAAAATTGAAGAGGAAGG + Intergenic
1013073202 6:106747788-106747810 TTTAAAAGAGAAAAGGAGGATGG + Intergenic
1013340462 6:109209958-109209980 TTCCAAAAACATGAAAAGGAGGG - Intergenic
1013393419 6:109710489-109710511 TCCAAAAAAACTGAGGAGGAGGG - Intronic
1013477675 6:110524169-110524191 TTTTAAAAACCTGATGATGAGGG - Intergenic
1013564101 6:111339914-111339936 TTGACAAAGCATTAGGAGGATGG - Intronic
1013654581 6:112232390-112232412 CTTAAATAACATGAAAAGGATGG - Intronic
1013738222 6:113252192-113252214 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1013876878 6:114842322-114842344 TTTCAAAAAATTGAGGAGGAAGG + Intergenic
1013968929 6:115991805-115991827 TTCAAAAAAATTGAGGAGGAGGG - Intronic
1014217008 6:118762099-118762121 TTTAAAAAAAAAAAGGAGGGGGG - Intergenic
1014364826 6:120526074-120526096 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1014562802 6:122911690-122911712 TTCCAAAAACTTGAAGAGGAGGG - Intergenic
1015034667 6:128638761-128638783 TTCAAAATACATTAGGACGAAGG + Intergenic
1015488283 6:133796699-133796721 TTTCAAAAAATTGAGGAGAAGGG - Intergenic
1016087513 6:139932582-139932604 TTAAAAAAAAATGAGGAAGGTGG - Intergenic
1016793626 6:148094026-148094048 TTCAAAAAAATTGAGGAGAATGG + Intergenic
1016902018 6:149112525-149112547 TTTAAAGACCATGAAGATGAGGG - Intergenic
1017161472 6:151369674-151369696 CTTAAAAAACAGGTGGAGGCTGG + Intronic
1017247328 6:152240492-152240514 TTTCAAAAACATTAGTAGGATGG - Intronic
1017305330 6:152911722-152911744 TTCAAAAAAATTGAGAAGGAGGG - Intergenic
1017515816 6:155154867-155154889 TTTTAAAATCATAAAGAGGACGG + Intronic
1017615016 6:156237288-156237310 TTCCAAAAACTTGAGGAGGAGGG - Intergenic
1018128789 6:160707885-160707907 TTTATAAGACCAGAGGAGGAAGG + Intronic
1018132345 6:160744194-160744216 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1018405757 6:163480436-163480458 CTTAAAAGACATGAGGCGGAGGG - Intronic
1019066636 6:169306230-169306252 TCTAAAAAAAATGAGGAGGAGGG + Intergenic
1020245596 7:6426810-6426832 TTTAAAAAACAAAAAGAGGCCGG + Intronic
1020425909 7:8065935-8065957 TTCAAAAAAATTGAGGGGGAGGG - Intronic
1020536919 7:9410644-9410666 GTTAAAAATCATGAGGGTGAGGG - Intergenic
1020580763 7:9997458-9997480 TTCCAAAAACCTGAAGAGGAAGG + Intergenic
1020686735 7:11305543-11305565 TTTTAAAAACATGAGAAATATGG + Intergenic
1021238933 7:18177189-18177211 AATAAAATACGTGAGGAGGAAGG + Intronic
1021446983 7:20744326-20744348 TTTAAAGAACATGAGGAGACTGG - Intronic
1021689238 7:23216164-23216186 TTTAAAAAAGAGGAAGAGGGTGG + Intergenic
1022273511 7:28833286-28833308 TTTAAAAATCATGATGAGGCTGG - Intergenic
1022381344 7:29862826-29862848 GATAAAAAAAATAAGGAGGAAGG - Intronic
1022545388 7:31183121-31183143 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023136405 7:37057050-37057072 TATAGAAAAGATGAGGAAGAGGG + Intronic
1023645505 7:42309189-42309211 TTTCAAAAAACTGAGAAGGAAGG + Intergenic
1023928350 7:44687717-44687739 TTTAAAAAAGTTGAGCAGGCGGG - Intronic
1024165750 7:46728151-46728173 TTCCAAAAAACTGAGGAGGAGGG + Intronic
1024438285 7:49384853-49384875 CAGAAAAAACTTGAGGAGGAGGG - Intergenic
1024445765 7:49476652-49476674 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1024848492 7:53679969-53679991 TTCCAAAAATTTGAGGAGGAGGG - Intergenic
1025248628 7:57336886-57336908 TTAAAAAAAAATGAGAAAGATGG - Intergenic
1025582810 7:62741672-62741694 TTGAAAAAACATTAGAAGAATGG - Intergenic
1025736153 7:64148736-64148758 TTTAAAAAAAAGGAGGCGGCGGG + Intronic
1025839905 7:65136503-65136525 TTTAAAAAACATGATGAGGCCGG - Intergenic
1025883161 7:65559462-65559484 TTTAAAAAACATGATGAGGCCGG + Intergenic
1025890285 7:65643144-65643166 TTTAAAAAACATGATGAGGCCGG - Intergenic
1026509191 7:71014239-71014261 TTAGAAACACATGAAGAGGAAGG - Intergenic
1026922269 7:74164707-74164729 TTTAAAAAACATGAGGGAGCGGG + Intergenic
1027299927 7:76821463-76821485 TTTTTAAAAAATTAGGAGGAAGG + Intergenic
1027357043 7:77367736-77367758 TTTCAAAAAATTGAGGAGGATGG - Intronic
1027368687 7:77485205-77485227 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1027508109 7:79044033-79044055 TTTCAAAAAATTGAGGAGGTGGG + Intronic
1027627155 7:80560476-80560498 TTCCAAAAAATTGAGGAGGAAGG - Intronic
1027683205 7:81246517-81246539 TTACAAAAAATTGAGGAGGAGGG - Intergenic
1027873723 7:83743413-83743435 TTTAAGAGACATCAGCAGGAAGG - Intergenic
1027874434 7:83750324-83750346 TTTAAGAGACATCAGCAGGAAGG - Intergenic
1027895683 7:84040813-84040835 TGTAAAAAACAAGAGGAAAAAGG + Intronic
1028176644 7:87668020-87668042 TTCCAAAAAAATGAGGAAGAGGG - Intronic
1028334490 7:89635159-89635181 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1028337581 7:89676477-89676499 TTCAGAAAAATTGAGGAGGAAGG + Intergenic
1028346972 7:89795148-89795170 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1028387283 7:90270510-90270532 TTTAAAAAGTAAGAAGAGGAAGG - Intronic
1028567732 7:92251262-92251284 TTTAAAATCCATGAAGAGAAGGG + Intronic
1028780751 7:94733459-94733481 TCCAAAAAAATTGAGGAGGAGGG + Intergenic
1028949409 7:96618061-96618083 TTTTTAAAAAATGAGGAGGGGGG - Intronic
1029126492 7:98298315-98298337 TTTAAAAAACATTAGGGGCTGGG + Intronic
1029594335 7:101528843-101528865 TTTAAAAAAGAAAAGAAGGATGG - Intronic
1029939271 7:104462774-104462796 GACAAAAAAAATGAGGAGGAGGG - Intronic
1030462676 7:109860114-109860136 TTTAAAAAAAATGATGATGATGG - Intergenic
1030734085 7:113023865-113023887 TTTCAAAAAGCAGAGGAGGAGGG - Intergenic
1030942545 7:115671607-115671629 TTTAAAAGACAGAAGAAGGACGG - Intergenic
1031039465 7:116823862-116823884 TTTCAGAAAATTGAGGAGGAGGG - Intronic
1031145556 7:117993840-117993862 TTTCAAAACCTTGAGGGGGATGG + Intergenic
1031250464 7:119373520-119373542 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1031294715 7:119986773-119986795 TTCTAACAACTTGAGGAGGAAGG + Intergenic
1031370815 7:120963751-120963773 TGTAACTAACATGAGGAAGAAGG - Intronic
1031378053 7:121051338-121051360 TTTAAAAAATGGGAGGAGGTGGG - Intronic
1031429730 7:121652426-121652448 TTGCAAAAAATTGAGGAGGAGGG - Intergenic
1031536486 7:122940023-122940045 TTTCATAAAATTGAGGAGGAGGG - Intergenic
1031738150 7:125393630-125393652 TTCCAAAAAAGTGAGGAGGAGGG + Intergenic
1031852194 7:126878864-126878886 TTTAAAAAACATGATGAGGCCGG + Intronic
1031888754 7:127269421-127269443 TTCCAAAAATTTGAGGAGGAGGG - Intergenic
1031906062 7:127460783-127460805 TTCAAAAAAACAGAGGAGGAAGG + Intergenic
1031967916 7:128041291-128041313 TTTAAAAAATAAGAGGTGGAGGG + Intronic
1032134964 7:129267967-129267989 TTTAAGAAAAAAGAGGATGAGGG + Intronic
1032150265 7:129422999-129423021 ATTCGAGAACATGAGGAGGAGGG - Intronic
1032249622 7:130243734-130243756 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1032301731 7:130693884-130693906 TTTTAAAAATGTGAGGATGATGG - Intergenic
1032726922 7:134598602-134598624 TTCCAAAAAAATGAGGAGGAAGG - Intergenic
1032775307 7:135106748-135106770 TTTCAAAAAGCTGAGGAGGAGGG - Intronic
1032954529 7:136955177-136955199 TTTCAAAATCATGAGAAAGAAGG - Intronic
1032965876 7:137096833-137096855 TTCCAAAAAAATGAGGAGGAAGG + Intergenic
1033106394 7:138529754-138529776 TTTTAAAAAGCTGAGGAAGATGG - Intronic
1033358683 7:140622504-140622526 TTTAACAAGTCTGAGGAGGAGGG - Intronic
1033496313 7:141900146-141900168 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1033532267 7:142276564-142276586 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1033612688 7:142980779-142980801 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1034112659 7:148553261-148553283 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1034195933 7:149247278-149247300 TTTAAAAAAATTGTGGAGGTGGG + Intronic
1034887800 7:154811503-154811525 TTTAAAACAAATGAGTAGGTAGG + Intronic
1035086938 7:156268221-156268243 ATTGAAAAACATGAAGATGATGG - Intergenic
1036035629 8:5015483-5015505 TTTCAAAAACATGACGTGAAAGG - Intergenic
1036098893 8:5755881-5755903 TTTATAAAAGACGAGGTGGAAGG + Intergenic
1036508553 8:9379295-9379317 TTTAAAAGAAATGAGGAAGGTGG - Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037119826 8:15269442-15269464 TTCCAAAAAAATGAAGAGGAAGG + Intergenic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1037956221 8:23062064-23062086 TTTCAAAAACTTGAAGAGAAGGG - Intronic
1038872533 8:31510966-31510988 TTTCTAAAAATTGAGGAGGAGGG - Intergenic
1038889222 8:31700139-31700161 TTTAAGAAAAATGTGCAGGATGG + Intronic
1039627543 8:39069561-39069583 CTTAAAAAACCTTATGAGGAAGG + Intronic
1039790755 8:40873795-40873817 GTTAAAAATAGTGAGGAGGACGG - Intronic
1040540623 8:48351032-48351054 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
1040961855 8:53042736-53042758 TTCCAAAAACTTGAGGAGGAGGG - Intergenic
1040986625 8:53301318-53301340 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1041041687 8:53852890-53852912 TTAAAATAACATTAGGAGAAAGG - Intronic
1041180003 8:55237218-55237240 TTTAAAAAACATGAGGGTTAGGG + Intronic
1041372407 8:57176022-57176044 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1041470840 8:58207147-58207169 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1041616345 8:59911477-59911499 TTTCAAAAAATAGAGGAGGAGGG + Intergenic
1041770663 8:61469337-61469359 TTTACAGAACATAAGGATGAAGG - Intronic
1041887923 8:62833781-62833803 TTCAAAAAAATTGAGGGGGAGGG + Intronic
1042199210 8:66264039-66264061 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1042381770 8:68123871-68123893 TTTCAAAGAATTGAGGAGGAGGG + Intronic
1042390287 8:68226603-68226625 TTTTTAAAACATCAAGAGGATGG - Intronic
1042763900 8:72299938-72299960 TTTAAGAAACATGAGCTGGCTGG - Intergenic
1042923381 8:73941630-73941652 TTAAAAAAACCTGAGGGTGAAGG + Intronic
1043240245 8:77924474-77924496 TTTCAAAAAAATGAGGAGGAGGG + Intergenic
1043270415 8:78326406-78326428 TTTGAAAAACTTGAGGAAGGAGG - Intergenic
1043396908 8:79846676-79846698 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1043497535 8:80818971-80818993 TTTAAAAAAAATGATGATGAGGG - Intronic
1043640891 8:82449013-82449035 TCCAAAGAAAATGAGGAGGAAGG - Intergenic
1043943907 8:86228544-86228566 TTTAAGAAATCTGAGGAGGTGGG + Intronic
1044196389 8:89381430-89381452 TTTTAAAAAAATGAGAAGGAAGG - Intergenic
1044258006 8:90088608-90088630 CTTAAAAAAAATGAGGTGGGGGG - Intronic
1044272165 8:90258936-90258958 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1044339819 8:91033939-91033961 TTTAAAAACAAGGAGGAGGCTGG - Intronic
1044394829 8:91698914-91698936 TTCCAAAAACTAGAGGAGGAGGG - Intergenic
1044707377 8:95021795-95021817 ATTATCAAACCTGAGGAGGAAGG + Intronic
1044793821 8:95875719-95875741 ATTTCAAAAAATGAGGAGGAGGG + Intergenic
1045172994 8:99691439-99691461 GTTTAAAAACATGGGGAGAAAGG + Intronic
1045249253 8:100469427-100469449 TTTAAAAAAAAAGAAGAAGAAGG - Intergenic
1045673084 8:104578493-104578515 TTCAAAAAAATTGAAGAGGAAGG + Intronic
1045821513 8:106343841-106343863 TTAAAACAACATCATGAGGAAGG + Intronic
1045909762 8:107393506-107393528 TTTAAAAAAAATTAGGGGGATGG + Intronic
1045961748 8:107976791-107976813 TTTAAAAGAAAGGAAGAGGAGGG - Intronic
1046243000 8:111523346-111523368 TTTTAAAAAATTGAAGAGGAAGG - Intergenic
1046490065 8:114939981-114940003 TTTAAAAAAAAGGAGAAGAAAGG + Intergenic
1046656073 8:116896392-116896414 TTCAAAAAAACTGAAGAGGAAGG + Intergenic
1046895472 8:119467115-119467137 ATTCCAAAAAATGAGGAGGAGGG + Intergenic
1047213927 8:122862065-122862087 TTTGACAAAACTGAGGAGGAGGG + Intronic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047927454 8:129695443-129695465 GTTAAAAAACCAGAGGATGATGG - Intergenic
1048101596 8:131358135-131358157 TTTCAAAAAATTGAGGGGGAAGG - Intergenic
1048203985 8:132401031-132401053 TTCACAAAACAAGAGCAGGAAGG + Intronic
1048449750 8:134523106-134523128 TTTAAAAAACTTCAGGATGATGG - Intronic
1049568851 8:143358951-143358973 TTTAAAAAACATGAACATGATGG - Intronic
1049823370 8:144650357-144650379 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1050003850 9:1107205-1107227 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1050016030 9:1235616-1235638 TTTTAATCACATGAGGAAGAGGG + Intergenic
1050164765 9:2753430-2753452 TTTCAAAAAATTGAGGAGGAAGG + Intronic
1050398436 9:5225314-5225336 TCCAAAAAAATTGAGGAGGAGGG + Intergenic
1050510279 9:6387327-6387349 TTTTAAAAAATAGAGGAGGAGGG + Intergenic
1050565729 9:6880783-6880805 TTTAAAAAAAAGGAGGAAGGAGG - Intronic
1050675662 9:8049968-8049990 TTTGAAAAAACTGAGGAGGAGGG - Intergenic
1050878455 9:10670803-10670825 ATCAAAAAAATTGAGGAGGAGGG - Intergenic
1051036426 9:12751884-12751906 TTTAAAAAACAGGCTGAGCATGG - Intergenic
1051279689 9:15429600-15429622 TTTAAAAAATGTGAGTAGAAAGG + Intronic
1051317287 9:15854137-15854159 TTGAAAAAAAATGAAGAGAAGGG - Intronic
1051494430 9:17703405-17703427 TTTCCAAAAGTTGAGGAGGAGGG + Intronic
1051643086 9:19241725-19241747 TTTAAAAAACATAAGTAGAACGG + Intronic
1052078873 9:24178857-24178879 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1052385154 9:27813899-27813921 TTCTAAAAACTTGAAGAGGAAGG + Intergenic
1052524984 9:29605376-29605398 TTATAAAAAAATGAGGAGGTGGG - Intergenic
1052543634 9:29844294-29844316 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1052570805 9:30219924-30219946 TTTAAAAAATAACAGGTGGAAGG + Intergenic
1052584633 9:30410933-30410955 TGTCAAAAACTTGAAGAGGAAGG - Intergenic
1052635268 9:31095109-31095131 TTTAGAAAACAAGGGGAGAAGGG - Intergenic
1052699516 9:31920985-31921007 TTTAAATATCATAAGGAGCATGG - Intergenic
1052780077 9:32772984-32773006 TTCCAAAAAGTTGAGGAGGAGGG - Intergenic
1052964178 9:34326582-34326604 TGTAAAAATCAGGAGGAAGAGGG + Intronic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1053531138 9:38882621-38882643 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1053580592 9:39400027-39400049 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1053591999 9:39524319-39524341 GTTAAAGAAAATGAGGAGGCCGG + Intergenic
1053724262 9:40981567-40981589 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
1053780805 9:41605217-41605239 TCTAAAATAATTGAGGAGGAGGG + Intergenic
1053845087 9:42228074-42228096 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1054102179 9:60958832-60958854 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1054168748 9:61815374-61815396 TCTAAAATAATTGAGGAGGAGGG + Intergenic
1054203360 9:62107053-62107075 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1054341707 9:63870434-63870456 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1054574305 9:66840970-66840992 GTTAAAGAAAATGAGGAGGCCGG - Intergenic
1054584180 9:66948031-66948053 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1054635002 9:67481311-67481333 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1054668783 9:67765437-67765459 TCTAAAATAATTGAGGAGGAGGG - Intergenic
1054771594 9:69088868-69088890 CTCAGAAAACAAGAGGAGGAAGG + Intronic
1055131623 9:72781918-72781940 TTTCAAAAACTTGAGGAGGAGGG + Intronic
1055225304 9:73988346-73988368 TTCCCAAAAAATGAGGAGGAAGG + Intergenic
1055229760 9:74048558-74048580 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1055692944 9:78853283-78853305 ATTAAAAAATATGAAGAAGAAGG - Intergenic
1055811346 9:80151889-80151911 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1055833851 9:80415974-80415996 CCTGAAAAAAATGAGGAGGAGGG - Intergenic
1055942590 9:81664563-81664585 TTTAAAAAATGTGGGGAGGTCGG + Intronic
1056127585 9:83551510-83551532 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1056885858 9:90443116-90443138 TTTAAAAAAGATGATGAGCCGGG + Intergenic
1057352487 9:94311029-94311051 TTCAAAGAACATTAGAAGGAAGG + Intergenic
1057403064 9:94741569-94741591 TTTAAAAAAAAGAAGGGGGAAGG - Intronic
1057536878 9:95918751-95918773 TTTAAAAAACACAATGAGAATGG - Intronic
1057655153 9:96945044-96945066 TTCAAAGAACATTAGAAGGAAGG - Intronic
1057658556 9:96978948-96978970 CTTAAAAAACAAAAGGAGGCCGG + Intronic
1057856046 9:98601595-98601617 TTTAAAGGACATAAGAAGGAAGG + Intronic
1058101553 9:100922936-100922958 TTTGAAAAAATTGAGGAGGAGGG + Intergenic
1058302623 9:103395151-103395173 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1058316711 9:103576993-103577015 TTCAAAAAATTTGAAGAGGAGGG + Intergenic
1058403190 9:104640867-104640889 TTCCAAAAAATTGAGGAGGATGG + Intergenic
1058570608 9:106338610-106338632 TTTAAAATACATGAACAGGTAGG - Intergenic
1058904769 9:109473868-109473890 TTTTAAAAAACTCAGGAGGATGG - Intronic
1058916494 9:109571587-109571609 TTCCAAAAACGTGAGGAGAAGGG + Intergenic
1059378918 9:113908343-113908365 TTTAAAAAAATGGAGGAGGGAGG + Intronic
1059506659 9:114805557-114805579 TCTAAAAAATATGAGGCTGAAGG + Intronic
1059526411 9:114994847-114994869 TTTAAAGAAGAGTAGGAGGAAGG - Intergenic
1059681867 9:116593408-116593430 TTTAACATACATGTGGAGAATGG - Intronic
1059807592 9:117820082-117820104 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1059990917 9:119864931-119864953 GTTCAAAAAATTGAGGAGGAGGG + Intergenic
1060164721 9:121401627-121401649 TTCAAAAAATTTGAGGAGGAAGG + Intergenic
1060373037 9:123092633-123092655 TATCAAAAACATGAGGACCAGGG + Intronic
1060774034 9:126356128-126356150 TTTGAAAAAGAGGAGAAGGAAGG - Intronic
1060838562 9:126776897-126776919 TTATAAAAACAGGAGGAGGCTGG - Intergenic
1061410889 9:130420894-130420916 TTAAAAAAAAATAAGGAGGCTGG - Intronic
1061765751 9:132880144-132880166 CTTAAAATAAATGAGGAGAAAGG - Intronic
1203450538 Un_GL000219v1:110452-110474 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1186098584 X:6130208-6130230 TTTAAAAAAGAAAAGGAGCATGG - Intronic
1186392567 X:9175492-9175514 ATTAAAAAACCTGAGTAGGATGG - Intergenic
1186441285 X:9588897-9588919 TTTAAAAATCAAAATGAGGACGG - Intronic
1187325496 X:18282901-18282923 TTCCAAAAACCTGAGGGGGAAGG + Intronic
1187357814 X:18594363-18594385 TTTAAATAAAATGAGGGGAAGGG - Intronic
1187620600 X:21049160-21049182 TTCTAAAAAAATGAGGAGGAGGG + Intergenic
1187624651 X:21097038-21097060 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1187696310 X:21924583-21924605 TTTAAAAATGATGATGATGAGGG - Intergenic
1187886749 X:23895873-23895895 TTTAAAAAAAAAAAAGAGGAAGG + Intronic
1188405047 X:29797480-29797502 TTTAACAAACAGAAGGATGAGGG - Intronic
1188710664 X:33393350-33393372 TTCTAAAAAACTGAGGAGGAGGG + Intergenic
1188739631 X:33762535-33762557 TTCTAAAAACATGAAGAGTAAGG - Intergenic
1188800538 X:34524488-34524510 TTTATCAAACTTGAGGAGGGGGG + Intergenic
1188843186 X:35040871-35040893 TCTAAAAAAAATGAGGAAAAGGG + Intergenic
1188900773 X:35730639-35730661 TTCCAAAAAACTGAGGAGGAGGG - Intergenic
1188922667 X:35996955-35996977 TTTAAAAAACAACAGGAGAATGG - Intergenic
1189235910 X:39487135-39487157 TTTTAAAAATGTGAGGATGAAGG - Intergenic
1189274227 X:39773108-39773130 TTTCAAAAAGATGAGGAGATGGG - Intergenic
1189613331 X:42761070-42761092 TTTGAAAAATATGATGAAGAAGG - Intergenic
1189653431 X:43214689-43214711 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1190027963 X:46943745-46943767 TCCAAAAAAATTGAGGAGGAGGG - Intronic
1190886205 X:54532411-54532433 GTTAAAGAACATTATGAGGAAGG - Intronic
1190978943 X:55437765-55437787 TTTCAAAAAGTAGAGGAGGATGG + Intergenic
1191175163 X:57491617-57491639 TTCCAAAAAATTGAGGAGGATGG - Intergenic
1191221770 X:57997216-57997238 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1191610884 X:63111757-63111779 CCGAAAAAAAATGAGGAGGAAGG + Intergenic
1191628307 X:63292574-63292596 TTCCAAAATCTTGAGGAGGAGGG + Intergenic
1191744532 X:64471710-64471732 TTCCAAAAACCTGAAGAGGAGGG - Intergenic
1191811431 X:65193196-65193218 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1191919229 X:66236648-66236670 TTGCAAAAAAATGAGAAGGAGGG - Intronic
1191921019 X:66256955-66256977 TTTCAAAAACAAGAGAAAGAGGG + Intronic
1191929621 X:66356382-66356404 TTCAAAAAAATTGAGGTGGAGGG + Intergenic
1192116755 X:68418972-68418994 TTTAAAAAAAAAGAAGTGGAGGG - Intronic
1192296829 X:69858766-69858788 TTTCAAAAAAATGATGAGGAGGG - Intronic
1192303893 X:69937629-69937651 TTTAAAAAACATGATGAGGAAGG - Intronic
1192311347 X:70017316-70017338 TTCCAAAAAGTTGAGGAGGAGGG + Intronic
1192700869 X:73470513-73470535 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1192752011 X:74002948-74002970 TTTATAAAAGTTGAAGAGGAGGG + Intergenic
1192756672 X:74053437-74053459 TTTCAAAAAATTGAGGAGAAGGG + Intergenic
1192766940 X:74149876-74149898 TTCCAAAAACTTGAGGAGAAGGG + Intergenic
1192892240 X:75402836-75402858 TTCCAGAAAAATGAGGAGGAAGG + Intronic
1193012703 X:76695661-76695683 TTTCAAAAACTTGAAGAGGAGGG + Intergenic
1193167435 X:78297422-78297444 TTTCAAAAAATAGAGGAGGAGGG - Intronic
1193359786 X:80567906-80567928 TTCCAAAAAATTGAGGAGGAGGG - Intergenic
1193391398 X:80932960-80932982 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1193448881 X:81642115-81642137 TTCCAAAACCTTGAGGAGGAAGG - Intergenic
1193455575 X:81727683-81727705 TCCCAAAAAAATGAGGAGGAGGG + Intergenic
1193458186 X:81756347-81756369 CTTGAAAAAGATGAGGAGCATGG + Intergenic
1193493481 X:82180648-82180670 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1193607541 X:83587056-83587078 TCCAAAAAAAATGAGGAGAAGGG + Intergenic
1193632142 X:83902693-83902715 TTTCAAAAATTAGAGGAGGAGGG + Intergenic
1193789906 X:85804944-85804966 TTACAAAAAATTGAGGAGGAAGG - Intergenic
1193823901 X:86198871-86198893 TTCCAAAAAGTTGAGGAGGAGGG + Intronic
1193863550 X:86700956-86700978 TTCCAAAAAATTGAGGAGGAGGG + Intronic
1194040490 X:88936239-88936261 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1194072678 X:89347044-89347066 TTTAAAAAAATAAAGGAGGAGGG - Intergenic
1194106833 X:89780000-89780022 TTTAAAAAACATGTGGAAGCAGG + Intergenic
1194137452 X:90163976-90163998 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1194251565 X:91581912-91581934 TTCCAAAAAGTTGAGGAGGAAGG - Intergenic
1194511990 X:94808178-94808200 TTTCAAAAAATTGAGGACGAGGG - Intergenic
1194550892 X:95297680-95297702 TTTAATAAAATTGATGAGGAGGG + Intergenic
1194553235 X:95326947-95326969 TTTAAAAAAATTGAGGAGAAGGG - Intergenic
1194574878 X:95600279-95600301 TTTCAAAAAATAGAGGAGGAGGG + Intergenic
1194781106 X:98026814-98026836 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1194962668 X:100253673-100253695 TTACAAAAAATTGAGGAGGAGGG + Intergenic
1194982664 X:100456239-100456261 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1195024198 X:100859471-100859493 TGCAAAAAAATTGAGGAGGAGGG - Intronic
1195382700 X:104285801-104285823 TTTAAAAAGCAAGATGAAGAAGG + Intergenic
1195409835 X:104557858-104557880 TTTAAAATATTTGAGGAGGGCGG - Intergenic
1195473146 X:105256181-105256203 TTCCAAAAAATTGAGGAGGAGGG - Intronic
1195554512 X:106206465-106206487 TTTGAAGAACTTGAGGAAGAAGG + Exonic
1195567540 X:106360071-106360093 TTCAAAAAATTTGAGGAGGAGGG - Intergenic
1195592382 X:106644802-106644824 TTCAAAAAAATGGAGGAGGAAGG - Intronic
1195597462 X:106708757-106708779 TTTAAAAAACTTTAAGAGGAAGG + Intronic
1195636809 X:107126735-107126757 TTTAAAAAACAACAAGAGGCTGG + Intronic
1195778290 X:108432537-108432559 CTTAAAAAACAAGAGGAGGCCGG + Intronic
1195784769 X:108507150-108507172 TTCCAAAAATTTGAGGAGGAGGG + Intronic
1196010751 X:110885383-110885405 TTACAAAAAATTGAGGAGGAAGG - Intergenic
1196144432 X:112301348-112301370 TTTAAACAACCTGATGAGGAAGG - Intergenic
1196152333 X:112388947-112388969 TTTCAAAAAATTGAGGAGAAAGG - Intergenic
1196468507 X:115997168-115997190 TTCAAAAAAAATTAGGAGGAGGG - Intergenic
1196584383 X:117412634-117412656 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1196746701 X:119077633-119077655 TTTCTAAAGCAGGAGGAGGAAGG + Intergenic
1196966496 X:121062366-121062388 TCAAAACAACTTGAGGAGGAAGG - Intergenic
1197063139 X:122206345-122206367 TTTAAAAAACATGTGTAGGTAGG + Intergenic
1197158808 X:123300261-123300283 TTCTAAAAAATTGAGGAGGAGGG - Intronic
1197259068 X:124297238-124297260 TTCCAAAAAACTGAGGAGGAGGG + Intronic
1197324602 X:125076779-125076801 GTTAACAAAAATGAGGAAGATGG - Intergenic
1197374647 X:125667169-125667191 ATTCCAAAAAATGAGGAGGATGG + Intergenic
1197478115 X:126948035-126948057 TTGAAAAAAGATGAGAAGAATGG + Intergenic
1197508577 X:127341365-127341387 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1197518054 X:127461234-127461256 TCCAAAAAAATTGAGGAGGAGGG - Intergenic
1198276639 X:135100282-135100304 TTAAAAACTCATGAGGAGGATGG - Intergenic
1198276812 X:135102357-135102379 TTAAAAACTCATGAGGAGGATGG + Intergenic
1198629775 X:138623337-138623359 TTCCAAAAAAATGAAGAGGAAGG - Intergenic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1198825887 X:140697417-140697439 TTTAGAAAAGTTGAGGAGGAAGG - Intergenic
1198974773 X:142324014-142324036 TTCCAAAAAATTGAGGAGGAAGG - Intergenic
1199098671 X:143771627-143771649 ACAAAAAAACCTGAGGAGGAGGG + Intergenic
1199113570 X:143962434-143962456 TTCCAAAAACTTGAGGAGAAGGG - Intergenic
1199228405 X:145407052-145407074 TTAAAAAAAAAAGAGGAGGCCGG + Intergenic
1199506950 X:148573600-148573622 AGAAAAAAACATGTGGAGGAAGG + Intronic
1199561228 X:149164821-149164843 TTCCAAAAAATTGAGGAGGAGGG + Intergenic
1199715771 X:150506418-150506440 TTTATAAAGAATGTGGAGGAAGG - Intronic
1200105957 X:153712575-153712597 TTTAAAAAGCATGTGGAGGCTGG + Intronic
1200336586 X:155357313-155357335 TTTCAAAAAATTGAGAAGGAGGG + Intergenic
1200349884 X:155483914-155483936 TTTCAAAAAATTGAGAAGGAGGG - Intergenic
1200483182 Y:3733907-3733929 TTCCAAAAAATTGAGGAGGAAGG + Intergenic
1200726918 Y:6682787-6682809 TTTAAAAAAATAAAGGAGGAGGG - Intergenic
1200728070 Y:6698562-6698584 TTTAAAAAAATAAAGGAGGAGGG - Intergenic
1200958283 Y:8972645-8972667 TTCAGAAATCATGAGGAGGCTGG - Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic
1201934943 Y:19400077-19400099 TTTCAAATAATTGAGGAGGAGGG + Intergenic
1202301935 Y:23425649-23425671 TTTCAAAAACTTAAGGAGAAAGG - Intergenic
1202568876 Y:26244949-26244971 TTTCAAAAACTTAAGGAGAAAGG + Intergenic
1202584220 Y:26407549-26407571 TTTGAAAAACAGGAGGGGGCCGG + Intergenic