ID: 1037281850

View in Genome Browser
Species Human (GRCh38)
Location 8:17250056-17250078
Sequence GTGAGGGTCTTCAGGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037281844_1037281850 -7 Left 1037281844 8:17250040-17250062 CCCGGGCTCATATGGAGTGAGGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG No data
1037281840_1037281850 8 Left 1037281840 8:17250025-17250047 CCTCTAGTGGACCGGCCCGGGCT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG No data
1037281846_1037281850 -8 Left 1037281846 8:17250041-17250063 CCGGGCTCATATGGAGTGAGGGT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG No data
1037281842_1037281850 -3 Left 1037281842 8:17250036-17250058 CCGGCCCGGGCTCATATGGAGTG 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037281850 Original CRISPR GTGAGGGTCTTCAGGGCGGA AGG Intronic
No off target data available for this crispr