ID: 1037282459

View in Genome Browser
Species Human (GRCh38)
Location 8:17257438-17257460
Sequence CAGTGAAAACACATGGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037282457_1037282459 1 Left 1037282457 8:17257414-17257436 CCATATAAATATTAGGATTATGA 0: 1
1: 0
2: 12
3: 153
4: 1221
Right 1037282459 8:17257438-17257460 CAGTGAAAACACATGGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037282459 Original CRISPR CAGTGAAAACACATGGATAC AGG Intronic
No off target data available for this crispr