ID: 1037287265

View in Genome Browser
Species Human (GRCh38)
Location 8:17314745-17314767
Sequence GGCATTTGGAAGGAAGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037287265_1037287274 30 Left 1037287265 8:17314745-17314767 CCAAAATCTTCCTTCCAAATGCC 0: 1
1: 0
2: 2
3: 33
4: 291
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287265_1037287271 23 Left 1037287265 8:17314745-17314767 CCAAAATCTTCCTTCCAAATGCC 0: 1
1: 0
2: 2
3: 33
4: 291
Right 1037287271 8:17314791-17314813 CTGAAGACCTGATATGCAGTCGG No data
1037287265_1037287272 29 Left 1037287265 8:17314745-17314767 CCAAAATCTTCCTTCCAAATGCC 0: 1
1: 0
2: 2
3: 33
4: 291
Right 1037287272 8:17314797-17314819 ACCTGATATGCAGTCGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037287265 Original CRISPR GGCATTTGGAAGGAAGATTT TGG (reversed) Intronic
901945120 1:12695758-12695780 AACATTTGGAAGGAAGATGGAGG + Intergenic
902225470 1:14993933-14993955 GGCTTGTGGAAGGGAGATTACGG + Intronic
903513436 1:23893673-23893695 GCCATTTGTAAAGAAGATTGGGG + Intronic
904715408 1:32464262-32464284 GGCATCTGAAAGCAAGATGTTGG - Intergenic
905807796 1:40889544-40889566 GACATTTAAAAGGAAGTTTTGGG - Intergenic
906839889 1:49125804-49125826 GGAACTTGGAAGAAAGATTTGGG - Intronic
906847202 1:49206028-49206050 GGGAATAAGAAGGAAGATTTAGG + Intronic
908409478 1:63848470-63848492 GGTATTTCGAAGGAAGCTTCAGG + Intronic
911847780 1:102776364-102776386 GGCATTTGTAATCAAGAGTTTGG - Intergenic
911885678 1:103296192-103296214 GGCAGGTGGAAGGAAGTGTTTGG - Intergenic
913050038 1:115109563-115109585 GGTATTTGGAGGGAGGTTTTTGG - Intergenic
913547153 1:119880384-119880406 TGAATTTGGAAGGAGGAGTTAGG - Intergenic
914832186 1:151178441-151178463 GGCATTTGTAGAGGAGATTTTGG - Intronic
915330938 1:155112034-155112056 GGCAGAGGGAAGGAAGATCTTGG + Intergenic
918114571 1:181485135-181485157 GGACTTTGGGAGGGAGATTTGGG + Intronic
918230560 1:182527356-182527378 TCCATTAGGAAGGAAGATATTGG + Intronic
918381439 1:183959672-183959694 TGCATTTAGAAGGATCATTTGGG - Intronic
919209582 1:194462935-194462957 GGCATTTGGAAGCAAAAAGTGGG + Intergenic
920950584 1:210568481-210568503 GGCATTTTGAACAAAGAATTGGG + Intronic
923141618 1:231164530-231164552 GGCATTTGGATGGGAAATTTAGG - Intronic
923247127 1:232143433-232143455 GGCATTTTAAAGGAAGAATAAGG + Intergenic
1063490560 10:6459792-6459814 GACATTTGGAAGCAAGATGTGGG - Intronic
1064962154 10:20977141-20977163 GGCCTTTGGAAGGTAGATGCTGG - Intronic
1065588832 10:27245509-27245531 AGCACTTGGGAGGAAGAATTTGG + Intergenic
1066394825 10:35009390-35009412 GGCATATAGAAGGAATATGTTGG + Exonic
1066800944 10:39189586-39189608 GGAATCTGGAAGGAATATTTGGG - Intergenic
1067687422 10:48475479-48475501 GCTATTTGGAAGGAAGATATGGG - Intronic
1067796976 10:49327732-49327754 GGGATTTGGAGGGAAGTGTTGGG + Intergenic
1068751068 10:60592942-60592964 GGCCTTTGGAAAGAAGGTTAGGG - Intronic
1068770874 10:60819301-60819323 GGGATGTGGAAGGAACATTTAGG - Intergenic
1069597773 10:69683646-69683668 GGCATTTGGGAGGATGTTTGAGG - Intergenic
1069969098 10:72150268-72150290 TTCATTTGGAAGCAAGTTTTGGG - Intronic
1070841540 10:79491069-79491091 GGCAGTTGGAAGGGACATTTAGG - Intergenic
1071451119 10:85792117-85792139 GGCCTGTGGCAGGAGGATTTGGG - Intronic
1075089098 10:119433275-119433297 GGCAGTGGGGAGGAAGGTTTCGG - Intronic
1075958169 10:126543453-126543475 GACATTTGGAAAGCAGATGTAGG + Intronic
1076141384 10:128081126-128081148 AACATTTGGCAGGGAGATTTTGG + Intronic
1078354781 11:10625516-10625538 GGCATCAGGAAGGAAGGCTTGGG + Intronic
1078403607 11:11048400-11048422 GGCTTTTGGAAGGAATGTTGTGG - Intergenic
1078494287 11:11800450-11800472 GGACTTTGGAAGTAAGGTTTGGG + Intergenic
1078559714 11:12360421-12360443 GGCATTTAGAGGTAAGATTATGG + Intergenic
1079085251 11:17440446-17440468 GAAATTTGGAAGGAACATCTAGG - Intronic
1079559911 11:21809138-21809160 GCCATTTGGAGATAAGATTTGGG + Intergenic
1080780716 11:35427422-35427444 GGCTGTTGGAAAGAACATTTTGG - Intergenic
1080980512 11:37398704-37398726 GGCATGGGGAAGGAAGTTTCTGG + Intergenic
1081304008 11:41489215-41489237 GGAATTTGGTAGGAATTTTTTGG - Intergenic
1081567813 11:44270616-44270638 GGCATCTGGAAGGGAGCTCTCGG - Intronic
1081804328 11:45882144-45882166 GGCAGTGGGAAGGAAGAGGTGGG - Exonic
1083929134 11:65829830-65829852 GGCAATTGGAAGCACAATTTGGG - Intronic
1085010292 11:73135743-73135765 GGCATTTGGAAGCTAGTATTTGG - Intronic
1086373944 11:86181581-86181603 GGCATGTTGAAGGAAGATGGAGG + Intergenic
1086730956 11:90249160-90249182 CTGATTTGGAAGGAAGATATAGG - Intergenic
1088319001 11:108535542-108535564 GGCATTTGGAAGGAGGAGGGAGG + Intronic
1088348128 11:108853744-108853766 GGGAAATGGAAGGAAGAGTTTGG - Intronic
1088622592 11:111701531-111701553 GGGTTCTGGAAGGAAGATTCCGG + Exonic
1088842565 11:113639163-113639185 GGAATTTGGGAGGAGGGTTTGGG + Intergenic
1088912850 11:114205107-114205129 GGCATTTGAAAAAAAAATTTCGG + Intronic
1089802049 11:121040284-121040306 GTAATTTGGATGAAAGATTTGGG + Intronic
1089878867 11:121754014-121754036 TGCCTTTGGTGGGAAGATTTTGG + Intergenic
1089892055 11:121891323-121891345 GGAATTTGAAAGCAAGATTGGGG - Intergenic
1090049894 11:123368773-123368795 GGCCATTGGAGTGAAGATTTGGG + Intergenic
1090612452 11:128483602-128483624 GGCCTTAAGAAGGAAGATTAGGG + Intronic
1090986146 11:131767895-131767917 GTCATTTGTAAGGTAGTTTTAGG + Intronic
1091165393 11:133471241-133471263 AGAACTTGAAAGGAAGATTTTGG + Intronic
1091228850 11:133974844-133974866 GGCAGTTGGAAGAGAGACTTCGG - Intergenic
1091491657 12:937755-937777 GGCATTTGGAAGTCAGAATAGGG - Intronic
1092520924 12:9272010-9272032 GGCATTTGGGAAGAAGAGCTGGG - Intergenic
1094803050 12:34060477-34060499 GGCATTAGAAATCAAGATTTGGG - Intergenic
1095153194 12:38819804-38819826 AGTGTTTGGAAGGAACATTTGGG - Intronic
1095839958 12:46682290-46682312 GGCATGTAGAAGGAAGTTCTAGG + Intergenic
1096289232 12:50326888-50326910 GGCATTTTGAACAAAGAATTGGG - Intronic
1097155246 12:57007223-57007245 AGCATTTGAAAAGATGATTTGGG - Intergenic
1097590420 12:61567648-61567670 TGCATTTTGAAGGATCATTTGGG - Intergenic
1098163869 12:67673397-67673419 GGCATGTGGAAGGGAGATGTAGG - Intergenic
1098400432 12:70069492-70069514 GGCAATTGGTTGGAAGAGTTAGG + Intergenic
1099162843 12:79266364-79266386 GACATTTGGAAGAAATCTTTTGG + Intronic
1100214084 12:92429436-92429458 GTGTTTTGGAAGGGAGATTTTGG - Exonic
1101458418 12:104862114-104862136 GGCATTTTCCTGGAAGATTTGGG - Intronic
1102522933 12:113490453-113490475 GGCCTTTGGATGGAAGCTCTGGG + Intergenic
1102994454 12:117337776-117337798 GACACTTGGAAGCAAGATTTTGG - Intronic
1104375818 12:128265509-128265531 GGCAGTTGTAAAGTAGATTTGGG - Intergenic
1105287852 13:19021747-19021769 CGCATTAGCAAGGAAGCTTTTGG + Intergenic
1106217450 13:27715831-27715853 GGGAGTTGGAAGGAAGATGGAGG + Intergenic
1106769655 13:32949486-32949508 TGCTTTTGGAAAGAAGTTTTAGG + Intergenic
1106826604 13:33529216-33529238 GGGATTTGGAAGAGATATTTGGG - Intergenic
1107094447 13:36519542-36519564 TGCATTTTAAAGGCAGATTTGGG + Intergenic
1107575962 13:41722815-41722837 GGCATATGGAAGGAAGAGGCAGG + Intronic
1108332216 13:49399353-49399375 GGTATTTGGAAGGATGCTTATGG - Intronic
1108697942 13:52919417-52919439 GGACTTTGTAAGGCAGATTTTGG + Intergenic
1109605158 13:64684781-64684803 GGCATTTGCAAAACAGATTTTGG - Intergenic
1109893571 13:68652438-68652460 GGAATTTGGAAGATAAATTTTGG - Intergenic
1110407863 13:75170522-75170544 GGCATTTGGTTGGCAGCTTTAGG + Intergenic
1110623976 13:77630926-77630948 GGCATTTGAGAGGAATAATTTGG + Intronic
1110700791 13:78545745-78545767 GGCAATTGGAAGTAAGAATCTGG + Intergenic
1111127486 13:83930376-83930398 GGCAGTTTGAGGGAAGATGTGGG + Intergenic
1112224118 13:97520980-97521002 GGCATTTGGAGGAAACATTTGGG + Intergenic
1112289900 13:98136785-98136807 GCCATTTGGAAAAAAGATGTTGG + Intergenic
1113137752 13:107112970-107112992 GGCAGTTGGAAAGAACATTGTGG + Intergenic
1113146883 13:107217509-107217531 AGCATTGGTAATGAAGATTTAGG - Intronic
1113149618 13:107248258-107248280 GAAATTTGGAAGGAAATTTTAGG + Intronic
1113502884 13:110792376-110792398 GACATTTGGAGGGAAGTCTTTGG - Intergenic
1113966279 13:114155489-114155511 GGCATGGGGATGGAAGATTAGGG + Intergenic
1116856216 14:49954776-49954798 GGCAGTTGGAAGGGAGAGTTGGG + Intergenic
1117702825 14:58431962-58431984 GGCATTTTGTAGGAATCTTTAGG + Intronic
1117738006 14:58787258-58787280 GTAATTTGGAAGATAGATTTGGG + Intergenic
1117904289 14:60568220-60568242 GGAGTTTGGAAGGGAGATTTGGG + Intergenic
1119018771 14:71087234-71087256 GGCATTTTGAAAAAAAATTTGGG - Intronic
1119565571 14:75626290-75626312 GGCATTAAGAATGCAGATTTTGG - Intronic
1120173227 14:81267496-81267518 GGCATTTGTAAGGGGCATTTGGG - Intronic
1123781523 15:23633542-23633564 GGCATTTTGTAGGCAGATTTTGG + Intergenic
1124531589 15:30512824-30512846 TCCATTTTGTAGGAAGATTTGGG + Intergenic
1124767069 15:32494871-32494893 TCCATTTTGTAGGAAGATTTGGG - Intergenic
1126681319 15:51204970-51204992 GGCCATTGAAAGGATGATTTGGG - Intergenic
1128064229 15:64754629-64754651 GGCATGTAGTAGGAAGACTTGGG - Intronic
1129087055 15:73105177-73105199 GGCATTTGTTAGGATGATATGGG + Intronic
1130836997 15:87661020-87661042 TGTATTTGGATGGGAGATTTGGG - Intergenic
1136027719 16:27480690-27480712 GGCATTTGGAAGAAGAATCTTGG - Intronic
1137380045 16:47989516-47989538 GGCATTGGGAGGGAAGGATTAGG + Intergenic
1138329767 16:56204320-56204342 GGCATTTAGAAGAGAGATCTGGG + Intronic
1139242231 16:65404837-65404859 GGCATTTGGACCCAGGATTTGGG + Intergenic
1139574405 16:67832084-67832106 GGCATCAGGATGGAAGATTCTGG + Exonic
1139925939 16:70486625-70486647 GGGTTTTGGAAGTAAAATTTGGG - Intronic
1143289358 17:5817284-5817306 GGCATTTTGATGGAGGAATTAGG + Intronic
1143646973 17:8236563-8236585 TGTATTTTGAAGGAAGTTTTAGG - Intronic
1144073827 17:11699592-11699614 AGCATTTAGAAGGAAGTTTGTGG - Intronic
1144944946 17:18965118-18965140 GGCTTGTGCAAGGAAGATCTGGG - Intronic
1146371896 17:32269860-32269882 AGCTTTTAGTAGGAAGATTTTGG + Intronic
1146482595 17:33216940-33216962 GGCAGTTGGGAGGGAGATTTAGG + Intronic
1148731829 17:49841519-49841541 GGCATGTTGAAGGCAGGTTTGGG + Intronic
1148764466 17:50029071-50029093 GCCATTTGGAAGGAGGATTTGGG - Intergenic
1149292843 17:55234092-55234114 GGAAATTGGGAGGAAGTTTTGGG - Intergenic
1149293949 17:55243762-55243784 TGCATTTGAAAGGAACAATTCGG + Intergenic
1149352991 17:55810672-55810694 AGTATTTGGAAAAAAGATTTTGG + Intronic
1151440885 17:74128364-74128386 GGCATTTGGAAGGACATTCTGGG + Intergenic
1152542787 17:80984920-80984942 GGCCTTTGTAAGGAATGTTTTGG - Intergenic
1156649142 18:39203591-39203613 GCAATATGTAAGGAAGATTTTGG - Intergenic
1156803688 18:41149973-41149995 TGAATTTTGAAGGAAGATTGGGG + Intergenic
1157156770 18:45275520-45275542 AGGATTTGGAAGGAAGATAGCGG + Intronic
1158054537 18:53262727-53262749 TGAATTTTGAAGGAAGATTAAGG + Intronic
1158326089 18:56315170-56315192 GGCAGTAGGGAGGTAGATTTGGG - Intergenic
1159005126 18:63004403-63004425 GAGATTTGGAAGGAAGATAGTGG + Intergenic
1159094646 18:63888652-63888674 GGCACAGGGAAGGAAGAATTTGG - Intronic
1162699435 19:12502577-12502599 GGCATTTGGGAGCAGGAGTTTGG + Intronic
1163057947 19:14735455-14735477 GGCATTTGCTTGGAATATTTAGG + Exonic
1166403956 19:42505839-42505861 GTCATATGCAAGAAAGATTTCGG + Intergenic
1168509168 19:56960886-56960908 GGGACTTGGAGGGAAGTTTTGGG + Intergenic
925036897 2:694043-694065 GGCATTTGGACGGAAAATAAAGG - Intergenic
925225692 2:2182574-2182596 TGGATTTGGATGGAGGATTTAGG + Intronic
926575199 2:14572487-14572509 GGCATTTTGGAGGTAGATGTTGG - Intergenic
926694450 2:15761392-15761414 TGCAGGAGGAAGGAAGATTTGGG + Intergenic
927527825 2:23763699-23763721 GCCATTTGGAAGGCCGAGTTGGG - Intronic
929948583 2:46389084-46389106 GGAGGCTGGAAGGAAGATTTGGG - Intergenic
930140292 2:47944645-47944667 GGCAGTTGGATAGAAGATTCTGG - Intergenic
930728383 2:54705105-54705127 GACATTTTTAAGGAAAATTTGGG + Intergenic
931347055 2:61456385-61456407 GACATTTGTCAGGAAGGTTTTGG + Intronic
932011126 2:67978214-67978236 GGCACTAAGAAGGAAGATTTAGG - Intergenic
932170565 2:69551741-69551763 GACATTTGGAGGGTAGGTTTTGG - Intronic
933316478 2:80721253-80721275 GGGATTTGGAAGAGAGATTCAGG - Intergenic
933331020 2:80893315-80893337 TGAGTTTGGAAGAAAGATTTAGG - Intergenic
933658249 2:84906271-84906293 GGGATTTAGAAGGAAGCTTGGGG - Intronic
935525437 2:104160725-104160747 AGCTTTTGGAAGAAAGGTTTAGG + Intergenic
936801268 2:116269292-116269314 GGCATTTTGAACAAAGAATTGGG - Intergenic
939282973 2:140088907-140088929 CGCATTTGGCAGGATGAGTTTGG + Intergenic
939456207 2:142439689-142439711 GTCATTTGTAAGGATGGTTTGGG - Intergenic
939459264 2:142478261-142478283 GGCATTTGTAAGATATATTTTGG - Intergenic
940512791 2:154640481-154640503 GGCATTTGGAAATAAGAATTTGG + Intergenic
941504842 2:166329770-166329792 GGACTTAGGAAGAAAGATTTTGG + Intronic
941515181 2:166464757-166464779 ATCATTTGGAAAGAAGTTTTGGG - Intronic
941543175 2:166812576-166812598 GGTTTTGGGAAGGAAGATCTTGG - Intergenic
942223980 2:173798593-173798615 AGGATTATGAAGGAAGATTTTGG + Intergenic
942855778 2:180545793-180545815 AGCAATTTGAAAGAAGATTTGGG + Intergenic
942930842 2:181490570-181490592 GGTATTAGGAAGGGAAATTTGGG + Intronic
943018855 2:182548428-182548450 GGAATTTGGAAGGCAGATTAGGG + Intergenic
943056837 2:182992340-182992362 GGCATGGAGAAGGCAGATTTGGG - Intronic
943805341 2:192117995-192118017 GGCATTTGGAACAAAGAATTAGG - Intronic
944006393 2:194913212-194913234 GGTATTTGAAACCAAGATTTGGG + Intergenic
945593613 2:211765279-211765301 GCTTTTTGGAAGGAAGATTCAGG + Intronic
946180635 2:217947045-217947067 GGGGCTTGGAAGGAAGAGTTGGG - Intronic
946437698 2:219668932-219668954 GGCCCATGTAAGGAAGATTTGGG + Intergenic
946704632 2:222446002-222446024 GCCATGTGGAAGGAACATTTGGG + Intronic
1169277770 20:4244949-4244971 ACCATTAGGAAGGAGGATTTAGG + Intronic
1169282076 20:4276592-4276614 AGTATTTGGAAAGGAGATTTGGG - Intergenic
1169719683 20:8661029-8661051 AGCATTTGGAAAGAAGAATCTGG + Intronic
1169774828 20:9241050-9241072 GACCTATGGAAGGAATATTTAGG + Intronic
1170126967 20:12974521-12974543 GGCTTTTGGAAGGAGCCTTTAGG + Intergenic
1173398628 20:42704268-42704290 GGGCTTTGGATGGATGATTTTGG - Intronic
1173479601 20:43388728-43388750 AGCACTTGGAAGGAACACTTGGG + Intergenic
1173688521 20:44940870-44940892 GGCATTTTGAAAGAAGCCTTAGG - Intronic
1174124237 20:48290973-48290995 GTCATTTGGCTGGAAGAGTTAGG + Intergenic
1175049694 20:56143275-56143297 GGCTTTTTGAATGAAGACTTTGG + Intergenic
1175384709 20:58586887-58586909 GGCATTTGGAATTCAGATGTGGG + Intergenic
1175426225 20:58868979-58869001 GTCCTTGGGAAGGAGGATTTAGG - Intronic
1178024079 21:28445327-28445349 GGCATTTGAAATGACTATTTAGG - Intergenic
1178730714 21:35100438-35100460 GGAATTTGTGAGGATGATTTGGG - Intronic
1183119252 22:35717430-35717452 GGCTTTTGGAAGGATGATTTAGG - Intergenic
1184880117 22:47299346-47299368 GCCATTTTGAAGGAAGATTCCGG - Intergenic
949242137 3:1886008-1886030 GGCATTTGGAAGGAACAGAAAGG - Intergenic
950222154 3:11204799-11204821 GGGATTTGGAATCAAGCTTTGGG - Intronic
953164621 3:40453692-40453714 GGTGTTTGGGAGTAAGATTTTGG + Intergenic
953507283 3:43498520-43498542 GGCATATGGAGGGAAGAGTAGGG + Intronic
953960874 3:47264798-47264820 GGCATCTGGATGGAGGACTTGGG + Intronic
955073194 3:55588920-55588942 GGCATTTCGGAGGACCATTTTGG + Intronic
956193298 3:66627415-66627437 GGCATGTGGAAGAAAGATCATGG + Intergenic
956435806 3:69233370-69233392 GGTACTTGGAAGGATGAGTTGGG + Intronic
956885509 3:73555189-73555211 GACATTTTTAAGGAACATTTTGG + Intronic
958870151 3:99548798-99548820 GGCATTTGGAGGAACTATTTGGG + Intergenic
959960267 3:112290055-112290077 GCCATTAGGAAAGAACATTTTGG + Intronic
961043580 3:123693967-123693989 GGCATTGGGAGGGAAGAGCTGGG + Intronic
965666138 3:171095378-171095400 GGCTTCTGGAAGAAGGATTTTGG + Intronic
968223120 3:196953225-196953247 GACATTTGCAAGGAAGATCAGGG + Intronic
968264034 3:197348929-197348951 GCCATTTGCAGGGCAGATTTAGG - Intergenic
969583546 4:8079192-8079214 GGCATTTGGAAGTAAGCCTGAGG - Intronic
973282639 4:48375958-48375980 GGCAATGGAAAGGAAGAGTTAGG - Intronic
973986431 4:56358967-56358989 TGTATTTGGAAGCAAGTTTTAGG + Intronic
974237808 4:59204865-59204887 GGCAATTGAAAGGAAGTTATTGG + Intergenic
974593306 4:63983727-63983749 GGAATGGAGAAGGAAGATTTTGG - Intergenic
974924293 4:68278226-68278248 TACATTTGGAAGGAAGACTGTGG - Intergenic
975018712 4:69459879-69459901 GTGATTTAGAAGGAAGGTTTGGG - Intergenic
975472084 4:74781556-74781578 GGATTTTAGATGGAAGATTTGGG - Intronic
978044058 4:104105257-104105279 GTCTTTTGGAAGGAGTATTTAGG - Intergenic
978487059 4:109266935-109266957 GCCATTTAGCAGGCAGATTTAGG - Intronic
980878389 4:138685273-138685295 GTGATTTTGAAGGAATATTTTGG + Intergenic
981086762 4:140691327-140691349 GCCATTTATAAGGAACATTTGGG - Intronic
981945464 4:150338112-150338134 AGCATTTGGAAGGATAAATTTGG + Intronic
982252582 4:153422073-153422095 GCCATATGGAATGAAGACTTAGG - Intergenic
983487857 4:168353126-168353148 GGCATTTGGACAGCAGATTAAGG - Intergenic
983910750 4:173236059-173236081 GGCATTTGAAAGGAATGTCTAGG + Intronic
984955450 4:185040905-185040927 GGCATTGGGAAAACAGATTTTGG + Intergenic
986019757 5:3790265-3790287 GGCATTTGGAAGAGAGAATTGGG + Intergenic
988885321 5:35550923-35550945 GTCATTTGCAAGGTACATTTTGG + Intergenic
989788124 5:45356610-45356632 AGCATGAGAAAGGAAGATTTGGG - Intronic
989857053 5:46310180-46310202 GGAATCTGGAAGGCATATTTTGG - Intergenic
992499858 5:77331218-77331240 TGCATCTGGAAGGTAGATGTGGG + Intronic
992512197 5:77448427-77448449 GCTATTTGGGAGGAAGATTTTGG + Intronic
992848475 5:80779416-80779438 AACATTTGGAAGTAAGTTTTAGG + Intronic
992927120 5:81599668-81599690 TGAATTTTGAAGGAAGGTTTTGG - Intronic
992998614 5:82357422-82357444 TGCATTTGGAAGGAAGTTGCAGG + Intronic
993737615 5:91496664-91496686 GGAATTTAGAAAGAAGTTTTAGG + Intergenic
994366155 5:98919887-98919909 GGCATTAGAAACCAAGATTTGGG - Intronic
994680153 5:102876629-102876651 GGCATTTTAAAGGGAGAATTAGG + Intronic
996117587 5:119634815-119634837 GGTCTCTGTAAGGAAGATTTGGG + Intronic
997052227 5:130396728-130396750 GGATTATGAAAGGAAGATTTTGG + Intergenic
997785820 5:136712411-136712433 GGCATTAGGAACCAAGATCTGGG - Intergenic
999955345 5:156695371-156695393 GCAATTTGGAAGGCAGTTTTTGG - Intronic
1000025085 5:157352109-157352131 GTCACTTGGAAGGCAGTTTTAGG - Intronic
1000392789 5:160742745-160742767 GGAATTTGGGGGGAGGATTTGGG + Intronic
1000440394 5:161256260-161256282 CGCATTTGGAAGCATGATTTTGG - Intergenic
1000642144 5:163715651-163715673 AGAATTTGGAAGGAAGATCTGGG + Intergenic
1001614099 5:173028396-173028418 GGAGTTTAGAAGGTAGATTTGGG + Intronic
1003498677 6:6686771-6686793 GGGATTTGGACTGAAGATGTGGG - Intergenic
1003572093 6:7262378-7262400 AGGATTTGGAAGAAGGATTTAGG - Intergenic
1003968523 6:11276854-11276876 GGAATTTGGAAGGAACATAATGG + Intronic
1004372407 6:15063776-15063798 GGGTTTTGGAAGGCAGATCTGGG + Intergenic
1004684012 6:17924635-17924657 TGCATTTGTAAGGAAGAATTGGG - Intronic
1006905440 6:37530194-37530216 GGGTGTTGGAAGGCAGATTTTGG - Intergenic
1009400074 6:63244308-63244330 GGCATTTGCAAGACAGATTTTGG + Intergenic
1011023466 6:82840141-82840163 GGCATTAGAAAGCAAGATCTGGG - Intergenic
1011759486 6:90545927-90545949 GGCAATAGGAAGGAAGACATGGG - Intronic
1012070203 6:94604597-94604619 GGCATATGGAAAGAAAATGTGGG - Intergenic
1013891028 6:115027360-115027382 GGCATTTGGATGGATGAATTTGG + Intergenic
1014323346 6:119960169-119960191 GGCATTTAGTAGTAAGCTTTAGG + Intergenic
1014993289 6:128108961-128108983 GGCATTTGGAGGTCAGAGTTTGG - Intronic
1015051638 6:128847974-128847996 TGCATTTGGAGGAAAGAATTAGG + Intergenic
1015105988 6:129537525-129537547 GGAATGTGGAAGGGAGCTTTTGG - Intergenic
1018083009 6:160275086-160275108 TGAGTTTGGAAGGAACATTTTGG - Intronic
1019814524 7:3189856-3189878 GGCATTGGCAAGGGGGATTTGGG - Intergenic
1021570019 7:22055762-22055784 GGATTTTGGAAAGAAGATTGTGG + Intergenic
1021580121 7:22143527-22143549 GGGATTTGTAAGGAAGTTGTGGG - Intronic
1021616765 7:22509672-22509694 GGCAGTTAGAAGGAACACTTTGG - Intronic
1022369604 7:29758212-29758234 GGCCTTTGGGAGGAAAACTTGGG + Intergenic
1022454553 7:30546983-30547005 GGCATTTGGGCTGCAGATTTGGG - Intronic
1022842856 7:34181290-34181312 CGCATTTGCTAGGAACATTTAGG - Intergenic
1023374549 7:39543005-39543027 AGCATTTGGATGGTAGAATTGGG - Intergenic
1024373925 7:48617403-48617425 GGGTTTTGGAGGGAAGATTATGG + Intronic
1026433170 7:70368474-70368496 GGCATTGGGCAGGATAATTTAGG + Intronic
1026563641 7:71471554-71471576 GGACTTTGGAAGGTAGAATTAGG - Intronic
1028375705 7:90144657-90144679 GGCAGTTAGAAGGAACACTTTGG + Intergenic
1028746588 7:94334286-94334308 GGCAGTGGTAAGGAAGATTAGGG - Intergenic
1030995498 7:116354329-116354351 GGGATTTGGCAGGAAGACTGTGG + Intronic
1031596195 7:123652095-123652117 GTAAAATGGAAGGAAGATTTTGG - Intergenic
1032173665 7:129606826-129606848 GACATTGGGAAGAAAGGTTTTGG - Intergenic
1032463322 7:132127457-132127479 GGAGTTTGGAAAAAAGATTTGGG + Exonic
1032886523 7:136145365-136145387 GTCATTTGTAAGAAATATTTTGG + Intergenic
1033596324 7:142862206-142862228 GGCCTTTGGGAGGAAATTTTAGG - Intronic
1033814255 7:145053125-145053147 GGCCTTTTGGAGGAAGAATTGGG + Intergenic
1033976406 7:147107508-147107530 TGCATTTGGAATGGAGAATTGGG - Intronic
1034712721 7:153208561-153208583 TGCATTAGCAAGGAAGCTTTTGG - Intergenic
1036922210 8:12868350-12868372 GGCAATTGCAATGAATATTTTGG - Intergenic
1037287265 8:17314745-17314767 GGCATTTGGAAGGAAGATTTTGG - Intronic
1038124540 8:24657160-24657182 TGCCTTTGGAAGAAATATTTTGG - Intergenic
1041838906 8:62247857-62247879 AGGATTTGGAAAGAAGATCTCGG - Intergenic
1044065306 8:87691352-87691374 GACATTTGAAAAAAAGATTTTGG + Intergenic
1044110487 8:88266994-88267016 TGCATATAGAAGGAAGATGTTGG + Intronic
1044427544 8:92070651-92070673 GGGCTTTGCAGGGAAGATTTTGG - Intronic
1045032934 8:98154606-98154628 GGTTATTGGAAGGATGATTTAGG + Intronic
1045111964 8:98944856-98944878 GCCCTTTGGAAGGAAGGGTTTGG + Intronic
1045412422 8:101932096-101932118 GGCAGTTGGAAGGCAGATCGAGG + Intronic
1046452403 8:114411399-114411421 GCTATTTGGAAGTAAGGTTTGGG - Intergenic
1047221905 8:122925620-122925642 GGCCTTTGATAGGAAGATTTTGG + Intronic
1047276979 8:123413253-123413275 GGCATTTGGAAAGAAGAATGAGG - Intronic
1048484914 8:134838401-134838423 AGCATTTGGCAGGAATAATTTGG - Intergenic
1049843343 8:144787937-144787959 GGCATCTGGAAAGAGGGTTTTGG - Intergenic
1049847926 8:144812776-144812798 CTCATTTGGAAGGAAGTATTTGG - Intergenic
1050530924 9:6588782-6588804 TGCATTTTGAAAGTAGATTTCGG - Intronic
1050609283 9:7334699-7334721 AGCATTTGGAAGAAAGATGCAGG - Intergenic
1055501094 9:76902882-76902904 GGTATTAGAAAGGGAGATTTAGG + Intronic
1057496140 9:95562941-95562963 GTAATTTGGCAGGAAGAATTAGG + Intergenic
1057548323 9:96034405-96034427 GGCATTGAGAAGGAAGCTTTAGG - Intergenic
1057939553 9:99269395-99269417 GCCATAGGGAAGGAATATTTGGG - Intergenic
1058008948 9:99953202-99953224 AGCTTTTGGAAGAAACATTTAGG + Intronic
1058044454 9:100341458-100341480 GTCATTTGGCAGGGAGAATTTGG - Intronic
1059498742 9:114732128-114732150 GGCATTTTGAAGGAAGACATGGG + Intergenic
1061950253 9:133932110-133932132 GGCATTTGGAGGGAGGATTCTGG - Intronic
1062148179 9:135002354-135002376 TGCAGTTTGAAGGGAGATTTGGG + Intergenic
1186507254 X:10102991-10103013 GTCATTTGAAAGGCAGATCTTGG + Intronic
1187261643 X:17690041-17690063 GGGGTTTGGAAGGAAGACTGTGG + Intronic
1187437724 X:19287916-19287938 GGTTTTTGGAGAGAAGATTTGGG - Intergenic
1189860301 X:45264635-45264657 AGCCTCTGGAATGAAGATTTGGG - Intergenic
1190230404 X:48577488-48577510 GCCATTTGGAAGGACGATCCTGG - Exonic
1190766337 X:53478800-53478822 GGCATTTTGAAGAAAGAATTGGG + Intergenic
1191776550 X:64821046-64821068 GGCATTTGGGAGAGAGTTTTTGG + Intergenic
1195889886 X:109681552-109681574 GGAATTTGTAAGGAAAACTTTGG - Intronic
1199220309 X:145309452-145309474 GACATGTGGAAGGAAAATGTGGG - Intergenic
1199411885 X:147533908-147533930 GGGCTGTGGAAGGAAAATTTAGG - Intergenic
1199801985 X:151260715-151260737 GAAACTTGGAAGGGAGATTTTGG - Intergenic
1199985628 X:152948061-152948083 GGTATTGAGAAGGAAAATTTTGG + Intronic
1200985083 Y:9295425-9295447 TGCACTTTGAAGGAGGATTTTGG - Intergenic