ID: 1037287266

View in Genome Browser
Species Human (GRCh38)
Location 8:17314755-17314777
Sequence GCTCAGGGCAGGCATTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037287266_1037287274 20 Left 1037287266 8:17314755-17314777 CCTTCCAAATGCCTGCCCTGAGC 0: 1
1: 0
2: 2
3: 32
4: 248
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287266_1037287272 19 Left 1037287266 8:17314755-17314777 CCTTCCAAATGCCTGCCCTGAGC 0: 1
1: 0
2: 2
3: 32
4: 248
Right 1037287272 8:17314797-17314819 ACCTGATATGCAGTCGGTGAAGG No data
1037287266_1037287271 13 Left 1037287266 8:17314755-17314777 CCTTCCAAATGCCTGCCCTGAGC 0: 1
1: 0
2: 2
3: 32
4: 248
Right 1037287271 8:17314791-17314813 CTGAAGACCTGATATGCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037287266 Original CRISPR GCTCAGGGCAGGCATTTGGA AGG (reversed) Intronic
901185035 1:7367530-7367552 GCTCTGGGCAGGGATTGAGATGG + Intronic
902668170 1:17953700-17953722 GCACAGGGCAGGGGTCTGGAAGG + Intergenic
903729287 1:25478831-25478853 CCACAGGGCAGGCCTTTGTAAGG + Intronic
904296284 1:29521659-29521681 GCTCAGGGCTGGGGTTTGGCTGG - Intergenic
904410043 1:30319786-30319808 GCTCAGGGCTGGGGTTTGGCTGG + Intergenic
904603902 1:31688755-31688777 TCTCAGGGCAGGGATCAGGAGGG - Intronic
904811059 1:33163741-33163763 CCTCAGGCCAGGCCATTGGAGGG + Intronic
907283943 1:53368574-53368596 GGAAAGGGCAGGCAGTTGGAAGG - Intergenic
907697760 1:56751077-56751099 CCTCAGGGCAGGGATTTGTCTGG + Exonic
908602732 1:65758637-65758659 ACTGAGAGCAGGCATTTTGAAGG - Intergenic
909540931 1:76790775-76790797 GCTGAGGGGAGGCATTTGAGAGG + Intergenic
909977890 1:82066603-82066625 GATAAGGGCAGGGATTTAGAAGG - Intergenic
910124838 1:83829353-83829375 GCTCAGGGCAGGGGTCTGGCTGG - Intergenic
910705619 1:90126496-90126518 GATCAGGGCATGCTCTTGGAAGG + Intergenic
911057676 1:93722142-93722164 GCTAAGGACAGGCCTATGGAAGG + Intronic
912254097 1:108041409-108041431 GCACAGGGAAGGCATTTGGCTGG + Intergenic
915063356 1:153204870-153204892 GGGCAGGGCAGGCACTTGGGTGG - Exonic
916069612 1:161162171-161162193 GCTTGGGGAAGGCATGTGGAAGG + Intronic
916794622 1:168154281-168154303 GGTCCGGGCAGGCATTGGGATGG - Intergenic
918344865 1:183598189-183598211 GCTTGGGGCAGGAATTTGGATGG - Intronic
922516607 1:226212717-226212739 GCTCAGGTCAGGAACTTTGATGG + Intergenic
922561712 1:226574599-226574621 GCTCAGGCCATGAATTTGGGTGG - Intronic
923154656 1:231267865-231267887 GCTTAACCCAGGCATTTGGAGGG + Exonic
923629304 1:235639462-235639484 GGACAGGGAAGGCATCTGGAAGG - Intronic
924644683 1:245866767-245866789 GCTTAAAGCAGGCATTTGAAGGG - Intronic
1064029859 10:11877026-11877048 GCTCAGTGTCGGCATATGGAAGG - Intergenic
1064730296 10:18324296-18324318 GGTCAGGGAAGGCATCTGAAAGG + Intronic
1064798106 10:19036744-19036766 GCTCAGGGGAGACACTTAGATGG - Intergenic
1065388235 10:25155588-25155610 TCTCAGGGCAGGCACGTGGCAGG + Intergenic
1065936208 10:30522686-30522708 TCTCAGGGCAGCCATTTGAGAGG - Intergenic
1066647349 10:37623301-37623323 GCCAAGGGCAGGCATATGGAAGG + Intergenic
1069604939 10:69733019-69733041 GCCCAGGGCCGGCATCGGGAAGG - Intergenic
1069945294 10:71981386-71981408 GCTGAGGGCTGGCTTCTGGAGGG - Intronic
1070358416 10:75663178-75663200 TCTTAGGGCAGGGATTGGGATGG + Intronic
1070769083 10:79071784-79071806 GCCCAGGGAATGCATTTGGAGGG + Intronic
1072663850 10:97380200-97380222 GCTCAGGCCAGGCCTCTTGATGG + Intronic
1073175364 10:101553023-101553045 GCAGAGAGCAGGCATTAGGAAGG + Intronic
1073289473 10:102406242-102406264 GATCAGGGAAGGCTTTTGGAGGG - Intronic
1074279865 10:112040840-112040862 CCCCAGGGCAGGCAGTTGGTAGG + Intergenic
1074477503 10:113785844-113785866 GCATAAGGCAAGCATTTGGAAGG - Intergenic
1075343637 10:121666582-121666604 GCCAAGGGCAGCCATTTGTAGGG - Intergenic
1075677316 10:124304419-124304441 GGTGAGGGAAGGCTTTTGGAAGG - Intergenic
1076688656 10:132209549-132209571 CCTCAGGGCAAGCTTGTGGACGG + Intronic
1077159049 11:1104326-1104348 GCTCAGGGCTGATATTGGGAGGG + Intergenic
1077303683 11:1858470-1858492 GCTGAGGGCTGGGATTTGGGCGG - Intronic
1078578805 11:12523340-12523362 GCTCAGGGCTGGCAGCTGGTGGG - Intronic
1078731274 11:13976275-13976297 TCTCAGGGGAGGCAATTGGGAGG + Intronic
1081229532 11:40567952-40567974 CATCAGTGAAGGCATTTGGAAGG + Intronic
1081864092 11:46350271-46350293 GCTGGGGGCAGACATGTGGAAGG + Intronic
1083160403 11:60850741-60850763 GCTCAGAGCAGCCTTTGGGAAGG - Exonic
1084596111 11:70118010-70118032 GGTCAGGACAGGCCTGTGGAGGG - Intronic
1085740121 11:79071125-79071147 GCTCAAAGAAGACATTTGGAGGG - Intronic
1085837552 11:79972961-79972983 GCTCAGGGGAGGGATGTGGCTGG - Intergenic
1088768977 11:113014288-113014310 GCTCAGGGCAAGCCGTTTGATGG + Intronic
1089339356 11:117747056-117747078 GCTCAGGGGTGGCAGTTAGATGG - Intronic
1089386429 11:118071186-118071208 CCTCAAGTCAGGCATGTGGAAGG + Intergenic
1090410101 11:126502122-126502144 GGCCAGGGCAGGCACATGGATGG - Intronic
1090726452 11:129531274-129531296 GCTCAAGCCAGGCACTTGGGAGG + Intergenic
1091049120 11:132351933-132351955 GCTTAGGGCTGCTATTTGGAAGG + Intergenic
1091239840 11:134044999-134045021 GATCAGGGAAGGCTTTGGGAAGG + Intergenic
1091775658 12:3183120-3183142 GCTCAGAGAAGGCTTCTGGAGGG + Intronic
1091874636 12:3923922-3923944 ACACAGTGCAGGCATGTGGAGGG + Intergenic
1092140278 12:6179002-6179024 GGTCAGGGCAGGCATTCTGGGGG - Intergenic
1092173464 12:6387789-6387811 GCTCAGGGCAGGTTCTAGGAGGG - Intronic
1092181491 12:6450021-6450043 GCAAAGGGCAGGCCTTTGCAGGG + Intronic
1092458309 12:8664688-8664710 ACTCAGGCCAGTCATTTGGCAGG + Intergenic
1092777823 12:11959529-11959551 GGTCAGGGAAGGCACTGGGAGGG + Intergenic
1093945265 12:25100543-25100565 CCTCAAGGCAGGCAGTTGGAAGG - Intronic
1094219058 12:27974206-27974228 GCCAAGGGCAGGCATCTGGCTGG - Intergenic
1097024317 12:56043043-56043065 GTTCAGGGTAGGCATTAGGGCGG + Intronic
1098079272 12:66766585-66766607 TCACAGGGCAGCCATTTGGAAGG - Intronic
1098360244 12:69647409-69647431 CAGAAGGGCAGGCATTTGGAAGG + Intronic
1099382412 12:81971146-81971168 GCTCTGGGCTGGTACTTGGAGGG - Intergenic
1101877149 12:108603460-108603482 GCACAGGCCTGGCCTTTGGAGGG + Intergenic
1102465329 12:113127751-113127773 GCCCAGGGTGGGCATTTGCAGGG - Intronic
1102781661 12:115570860-115570882 ACACAGGTCATGCATTTGGAAGG + Intergenic
1103845382 12:123898652-123898674 GCTCAGTGCAAGCGTCTGGATGG + Exonic
1104233058 12:126904073-126904095 CCAGAGGGCATGCATTTGGAAGG - Intergenic
1104593066 12:130100008-130100030 GCTCAGGGCAGGCACACGGTAGG - Intergenic
1105376063 13:19845829-19845851 GCTCAGTGCAGCCTTTTGGTTGG - Intronic
1105477162 13:20738505-20738527 GCTCGGGGCAGCCAGTTGCATGG + Intronic
1108062313 13:46545659-46545681 GCACAGGGCATGCATAAGGATGG - Intergenic
1114527132 14:23373411-23373433 ACACAGGGCAGGCATTCGGGAGG - Intronic
1116440171 14:44942018-44942040 GCTCAGGGCTGGAAATTTGAAGG - Intronic
1117093716 14:52275515-52275537 GACCAGGTCAGGCAGTTGGAGGG + Exonic
1119406264 14:74401559-74401581 GCTCAGGGCAGGCAAAAGCAAGG + Intergenic
1119821296 14:77618273-77618295 TTTCAGGGCAGGAATCTGGATGG + Intergenic
1120808927 14:88782658-88782680 GCTCAGGCCATGGCTTTGGAGGG + Intronic
1121120310 14:91372082-91372104 TCCCAGGGCAGGCATCTGGAGGG + Intronic
1121272352 14:92646358-92646380 GCACATGGCGGGCATGTGGAGGG - Intronic
1121515894 14:94549630-94549652 CCTCAGGGCAAGCGTTTGGCGGG - Intergenic
1121527423 14:94628748-94628770 GCTCAGGGCCTGCATTTGGAGGG - Intergenic
1121568630 14:94929816-94929838 TCTCAGGGCTGGCAGATGGAGGG - Intergenic
1121807533 14:96843310-96843332 GCAGAGGTCAGGCTTTTGGATGG + Intronic
1122825611 14:104369045-104369067 GCCCAGGGCTGGCACCTGGAGGG + Intergenic
1122843172 14:104476629-104476651 GCCCATGGCAGCCATGTGGACGG + Intronic
1122861577 14:104584969-104584991 GTTCAGGGCAGGCCTGTGGGAGG - Intronic
1126125924 15:45294243-45294265 GCTCAGGAGAGTCATATGGAAGG - Intergenic
1128223168 15:65982758-65982780 GCTTAGGGCAGCCATTTGGTTGG - Intronic
1129172196 15:73815030-73815052 GCTCAGGCCAGGCTGGTGGATGG + Intergenic
1129242928 15:74262171-74262193 GCTCAGGGCAGGGGTAGGGATGG - Intronic
1129678366 15:77644386-77644408 GCTCAGGGCAGCCATGTTGAGGG - Intronic
1132239304 15:100245345-100245367 GCTCTGGGCCTGCATTTGAAAGG + Intronic
1132333965 15:101031506-101031528 GCTCTTGATAGGCATTTGGATGG + Intronic
1132399728 15:101497897-101497919 GAACAGGGAAGGCATTTAGAAGG - Intronic
1134019087 16:10909019-10909041 GCTCAAGGCAGCCCTGTGGAGGG - Exonic
1134133925 16:11667763-11667785 ATACAGGGCAGGCATTTGGTGGG + Intergenic
1135158729 16:20074847-20074869 CCTCAGGGCAGGCAGGTGGAGGG + Intergenic
1135632736 16:24048802-24048824 GCAAAAGCCAGGCATTTGGAAGG - Intronic
1135905387 16:26507296-26507318 GCTTTGGGCAGGGATATGGAAGG - Intergenic
1137526034 16:49237095-49237117 GCAAAGGGCAAGCATTTGGGAGG + Intergenic
1137560451 16:49498997-49499019 TCACAGGGCAGGCATTTAGAGGG - Intronic
1137874713 16:51984941-51984963 ACTCTGGGCAGGCTTTGGGAGGG + Intergenic
1138492184 16:57383103-57383125 GCTCAGGCCAGGCCCTTGGGTGG - Exonic
1141866189 16:86751730-86751752 GCTCAGGGGAGGCAGTTCCAGGG + Intergenic
1142420548 16:89966977-89966999 GATCAGGGCAGGCGTGTGGGAGG + Exonic
1143474815 17:7196539-7196561 GCTCATGGCTGGCATTTCGGAGG + Exonic
1143873378 17:9973993-9974015 GACCTGGGCATGCATTTGGAGGG - Intronic
1147423424 17:40333934-40333956 GCTCAGGGTAGGATTTTTGACGG + Intronic
1147924465 17:43938220-43938242 GCGCAGAGCAGGCGTCTGGAGGG - Intergenic
1148505183 17:48121576-48121598 GCACAGGGCAGGTATGTGGGAGG + Exonic
1148874828 17:50680752-50680774 GCTCAGTGCAGGCATGAAGAAGG - Intronic
1149529585 17:57384189-57384211 TCTCAGGTCAGAAATTTGGATGG + Intronic
1150281721 17:63932787-63932809 ACCCAGGTCAGGCATCTGGAGGG + Intergenic
1150837654 17:68579039-68579061 GCTCAGTGAAGGCATTTGCTAGG + Intronic
1151188124 17:72378853-72378875 GCCCAGGGCAGGCATAGGCAGGG - Intergenic
1152176299 17:78789854-78789876 GCTCAGGGAAGGCAATGTGAAGG + Intronic
1152346941 17:79758572-79758594 GCTAAGACCAGGTATTTGGAAGG - Intergenic
1152357620 17:79814456-79814478 CCTCAGGCCTGGCATTGGGATGG + Intergenic
1152477402 17:80527058-80527080 GCTGAGCCCAGGCATTTGGGAGG - Intergenic
1152708797 17:81860112-81860134 GCGCAGGGCGGGCATCGGGACGG + Intronic
1156859429 18:41818734-41818756 GCTCAGGGCTGGCTTCTGGGAGG - Intergenic
1157348962 18:46868158-46868180 CCTTAGGTCAGGAATTTGGAAGG - Intronic
1157548807 18:48566478-48566500 CCTCAGGGGAGGCCTTTCGAGGG + Intronic
1157643176 18:49238913-49238935 GCTGAGGGGCAGCATTTGGAGGG - Intronic
1159884036 18:73887232-73887254 GCTGAGAGCAGGCATTTTGGAGG - Intergenic
1160364758 18:78314414-78314436 GCTCAGTGCAGGCTGTTGAAGGG - Intergenic
1160970180 19:1764506-1764528 GGGCAGGGCAGGCATGGGGAGGG + Intronic
1160997020 19:1887304-1887326 GGTCAGGGCAGGCCTTTCTAAGG + Intergenic
1162420758 19:10565105-10565127 GCTCAGCGTAGGGATTAGGATGG + Intronic
1163233807 19:16019935-16019957 GGTCAAGGCAGGCGTGTGGATGG + Intergenic
1163429101 19:17256351-17256373 GCTGAGTGCAGGCATTGTGAAGG - Intronic
1163659278 19:18567226-18567248 ACCCAGGGCAGGCTTCTGGAAGG + Intronic
1163683643 19:18697811-18697833 GCACTGGGCAGGCATTTGGCAGG + Intronic
1164587387 19:29484466-29484488 GCTCAGGGAAGGCACTGGGCTGG + Intergenic
1164930867 19:32174818-32174840 GCTTTGGGGAGGCATTTGGTTGG - Intergenic
1165321692 19:35089327-35089349 TCTCAGGTCAGGCATTCTGAGGG - Intergenic
1165362781 19:35346951-35346973 TGTCAGGGCAGGTATTTAGATGG - Exonic
1167511535 19:49897683-49897705 GCTCAGGGCAGGGAGTGGGGCGG + Intronic
1167514115 19:49913028-49913050 GCTCAGGGCAGGCACAGGGCCGG + Intronic
925386936 2:3468429-3468451 GCTCACGGCAGGCGGTTGTATGG - Intronic
925983544 2:9196454-9196476 GCTCAGGGCAGGGAAGGGGATGG - Intergenic
929095862 2:38262736-38262758 GCTCAGGCCAAGAATGTGGAGGG - Intergenic
934989031 2:98908392-98908414 GGACAGGGCAGGCATTTGCCAGG - Intronic
935398959 2:102640582-102640604 GCACAGGGCAGGCATAGGGAGGG + Intronic
941506812 2:166356603-166356625 CCACAGGGGAGGAATTTGGATGG - Intronic
941545651 2:166847200-166847222 GGTCAGGGCATGCATTGGGTTGG - Intergenic
945101502 2:206266625-206266647 TCTCAGTGCAGGGATTCGGATGG + Intergenic
947047893 2:226008910-226008932 GGTGAGGACAGACATTTGGAAGG + Intergenic
947398563 2:229711165-229711187 GCACAGGGCAGGAGTTTGCATGG + Intronic
1169331196 20:4717660-4717682 ACTCAGGGCAGGGATTGGGGTGG - Intergenic
1170024364 20:11872923-11872945 GCTCAGGGGCAGCCTTTGGAAGG - Intergenic
1171481955 20:25460960-25460982 GCTCAGGGGATGCTTGTGGAGGG - Intronic
1172515319 20:35528975-35528997 GCCAAGGGCAGGGATTTGGGCGG + Intronic
1174402306 20:50282671-50282693 GCTCAGGGGAGGCCTTGGGGAGG - Intergenic
1174794928 20:53514042-53514064 TCTGAAGGCAGGCCTTTGGAAGG + Intergenic
1175366508 20:58459946-58459968 GCTGGGGGCAGGTCTTTGGAGGG - Exonic
1175975895 20:62710329-62710351 GGTCAGGGCAGGCAGCTGGGAGG - Intronic
1176659628 21:9622238-9622260 GCTCAGGGCAGGGTTTCAGAGGG + Intergenic
1180051291 21:45332088-45332110 GCTGAGAGCAGGCAGTGGGAGGG + Intergenic
1180248344 21:46563214-46563236 GCTCAGGGCAGGCAAGAGGAGGG - Intronic
1181755962 22:25025030-25025052 GCCCTGAGGAGGCATTTGGAGGG + Intronic
1183005256 22:34895896-34895918 GGTCAGGGCAGCTACTTGGATGG + Intergenic
1183209396 22:36441570-36441592 GCTCAGGGCTGGCATCAGGGAGG + Intergenic
1184859135 22:47163284-47163306 GATGAGTGCAGGCATTGGGAGGG - Intronic
1185150784 22:49162865-49162887 GCCCAGGGCAGGCAGCAGGAAGG + Intergenic
950090639 3:10291857-10291879 ACTCGGGGCAGGGCTTTGGAGGG + Intronic
950307217 3:11925250-11925272 GCTCTGGGAAGGCTTTTGGAAGG + Intergenic
950456087 3:13093520-13093542 GCTCAGGGCAGGAACTGGGGAGG + Intergenic
951926153 3:27910667-27910689 GACCAGGGCAGGCAGTTGGATGG + Intergenic
952886048 3:38011471-38011493 GCTCAGAGCAGGCCTTGGGCCGG + Intronic
953477986 3:43222082-43222104 GCACAGGGCATGGATCTGGAGGG + Intergenic
953869997 3:46618193-46618215 GCTCAGGAGAGGCTTTGGGAAGG - Intronic
954366840 3:50150997-50151019 GCTCGGGGCAGGCGGTTGGGTGG - Intergenic
954916053 3:54149450-54149472 GCTCAAGGCAAACATTTGGTTGG + Intronic
956432548 3:69201803-69201825 GCACAGGGCAGGCAGTTGAACGG + Intronic
957029002 3:75218363-75218385 GCCCAGGGCAGCAATTTGGTTGG + Intergenic
958877616 3:99633804-99633826 GCACACAGCAGGCATCTGGAAGG + Intergenic
959521630 3:107328371-107328393 GCTCATGCCAGGCATTTGGCAGG - Intergenic
960423177 3:117474405-117474427 GCTTAAGTCAGGTATTTGGAAGG + Intergenic
961376827 3:126472784-126472806 GGACAGGGCTGGCAGTTGGAGGG - Intronic
961635377 3:128329744-128329766 CCTCAGGGCAGGCTGCTGGATGG - Intronic
964177023 3:153836128-153836150 GCTCTGGGCAGGTATTAGGAAGG + Intergenic
965208240 3:165749745-165749767 GCTCTGTGCAGGAATTTGGGGGG - Intergenic
965814867 3:172625869-172625891 GCTCAGGAGAGACATCTGGAAGG + Intergenic
966864285 3:184248602-184248624 GCTCAGGTAAGGGATATGGATGG + Intronic
968654285 4:1771896-1771918 GCTCGGGGCAGGCATGGGGAGGG + Intergenic
969306692 4:6329929-6329951 GTGCAGGGCAGGCCTTTTGAGGG + Intronic
969496448 4:7529153-7529175 GCTGGGGAAAGGCATTTGGACGG - Intronic
971452196 4:26810586-26810608 GCGCAGGGCAAGCAGTTGGAGGG - Intergenic
971889996 4:32507708-32507730 GGTCAGGGTAGGCACTTGGTGGG - Intergenic
979439288 4:120732074-120732096 GATAAGGGTAGGCATTTGGGTGG + Intronic
980514171 4:133832344-133832366 GCTTAGGCCAGTCAATTGGATGG + Intergenic
981164815 4:141545266-141545288 GATCAGAGCTGGCCTTTGGAAGG - Intergenic
981782761 4:148445178-148445200 GGTCAGGGCCGGACTTTGGAGGG - Intergenic
985415743 4:189734175-189734197 GCTCAGGGCAGGGTTTCAGAGGG - Intergenic
985525793 5:401055-401077 GCTCAGAGCGGGCAGTTGGATGG + Intronic
985774102 5:1831720-1831742 GCTCTGGAAAGGGATTTGGAGGG + Intergenic
985985301 5:3510749-3510771 GCTCAGGGCTGGCAGCAGGATGG + Intergenic
986000176 5:3624778-3624800 CCACAAGACAGGCATTTGGAGGG - Intergenic
986171552 5:5318606-5318628 GCACAGGGATGGCATTTAGAGGG - Intronic
991438004 5:66615886-66615908 GCTGAGGGCAGGCAAATGGGAGG - Intronic
992207602 5:74446042-74446064 GCTGAGGGCAAGCATCTGGAGGG - Intergenic
998353503 5:141516060-141516082 GCTCAGGGAAGGCATGAGGAGGG + Exonic
1001263314 5:170252200-170252222 TCTCAAGGCAGTCATTTGGTTGG - Intronic
1003276988 6:4661553-4661575 GCTCAGGGCCTGCATGTGGCTGG - Intergenic
1003282683 6:4707609-4707631 GCCCAGGTAAGGGATTTGGATGG - Intronic
1003630701 6:7783907-7783929 GCTCATGTGTGGCATTTGGAGGG - Intronic
1003760639 6:9175147-9175169 ACTTAGGGCAGTCATGTGGATGG - Intergenic
1007103472 6:39267559-39267581 ACTGAGGGCAGGCATTCTGATGG - Intergenic
1008356077 6:50555148-50555170 GCCCAGGGAATGTATTTGGATGG + Intergenic
1009796269 6:68472165-68472187 TTTCAGGGCAGTCATGTGGAAGG + Intergenic
1013486120 6:110597878-110597900 CCTAAGGGCAGGACTTTGGAAGG + Intergenic
1013599597 6:111691977-111691999 TCTCAGGCCTGGCACTTGGAAGG + Intronic
1013976012 6:116079696-116079718 GCTCAGGGCACACAGTGGGAGGG - Intergenic
1018736244 6:166689055-166689077 GCTCAGGGCTGGCCTTCGGCAGG - Intronic
1019821531 7:3247032-3247054 TCTCAGGAAAGGCATTTGTAAGG - Intergenic
1021174981 7:17440103-17440125 GTTCAGGCCATGCTTTTGGAGGG - Intergenic
1021181080 7:17506796-17506818 GCTAAAGGCAGGCATCTGGGAGG + Intergenic
1022334541 7:29409997-29410019 GCTCAGGGCAGGCGCTTGGTGGG - Intronic
1022505476 7:30906633-30906655 GCTCAGGGCAGGCAGCGGCAGGG + Intergenic
1022725122 7:32974270-32974292 GGTCAGGCCAGGGCTTTGGAAGG - Intronic
1024865133 7:53896570-53896592 CCACAGGGCAGGTAGTTGGATGG - Intergenic
1025709264 7:63891927-63891949 GCCCTGGGCAGGCACTGGGAGGG + Intergenic
1025738404 7:64174916-64174938 GGACAAGGCAGGCATGTGGATGG - Intronic
1026528949 7:71180785-71180807 GCTGAGTGATGGCATTTGGATGG + Intronic
1027575638 7:79927232-79927254 GCTCTGGAGAGGCATTTGGAAGG + Intergenic
1029573334 7:101386207-101386229 GCTCAGGGCAGACACTCGGCAGG - Intronic
1035713709 8:1738017-1738039 ACTCATGGCAGGCATGTGGGTGG - Intergenic
1036556957 8:9868559-9868581 GGTAAGGACAGGGATTTGGAAGG + Intergenic
1036922409 8:12870462-12870484 ACTGAGAGCATGCATTTGGAAGG + Intergenic
1037287266 8:17314755-17314777 GCTCAGGGCAGGCATTTGGAAGG - Intronic
1037724594 8:21472830-21472852 GCTCAGGGAGGGTATTTAGAGGG + Intergenic
1037748714 8:21666211-21666233 GCTCAGCACAGGCTTCTGGAAGG - Intergenic
1039298241 8:36181372-36181394 GCTCAGGCCATGGCTTTGGAGGG - Intergenic
1040554737 8:48468696-48468718 TCTCATGACAGTCATTTGGAAGG - Intergenic
1042872236 8:73409762-73409784 GCTCAGGGCTGAGATTTTGAGGG + Intergenic
1043327618 8:79071887-79071909 GCTCAAGGCAGCCAGTTGGGGGG - Intergenic
1045006126 8:97918359-97918381 GCTCAGGGCCGGCACATAGAAGG - Intronic
1045440154 8:102201289-102201311 GCTCAGGGCCAGCATTTGGGAGG - Intergenic
1045665160 8:104477043-104477065 GCTCAGGGCAGGATTATGGATGG + Intergenic
1047254474 8:123205563-123205585 GCTGAGGCCAGGCCTTTGGGTGG + Intronic
1047779045 8:128096996-128097018 GTTAGGGGCAGGCATTTGGCTGG - Intergenic
1048331352 8:133472715-133472737 TCCCAGGGCAGCCACTTGGAAGG - Intronic
1049094370 8:140539790-140539812 GCTCAGGGCAGGCTTTGGGCTGG + Intronic
1049388979 8:142358481-142358503 GCTCCGGCCAGGCACATGGAGGG + Intronic
1049621461 8:143600058-143600080 TCTCAGGGCAGGCACATGTACGG + Exonic
1049938554 9:522921-522943 ACTCAGGGAAGGCATTTTCATGG - Intronic
1050418338 9:5437401-5437423 GCTCTGGGCTGGAATTTGCAAGG - Intronic
1052205495 9:25834794-25834816 GATGAGGGCAGACATTTAGAGGG - Intergenic
1053267465 9:36725690-36725712 GCTCAGTGCAGGCTTCTGGGTGG + Intergenic
1054767863 9:69057346-69057368 TCTCAGGGCAGGAATCAGGAAGG - Intronic
1057427264 9:94962688-94962710 GGACAGGGAGGGCATTTGGAAGG - Intronic
1057704230 9:97386359-97386381 GTGCTGGGCAGGCATTGGGAGGG - Intergenic
1059383016 9:113943208-113943230 GCTCAGAGCAGGCATGGGAATGG + Intronic
1059750561 9:117243762-117243784 GTACAGGGCAGGCCTTGGGAAGG + Intronic
1060144177 9:121236724-121236746 GCTCAGGGCTTGCATCAGGAAGG + Intronic
1060506548 9:124202288-124202310 GCTAAGGGCTGGCCTTGGGACGG + Intergenic
1060785787 9:126450844-126450866 GCTCAGGGCTGGGTTTTGGGAGG + Intronic
1061092704 9:128435581-128435603 GCTCCGGGCAGGCATGTGTCCGG + Intronic
1061185259 9:129049257-129049279 GCTCAGGGATGGCATTTGGAGGG + Intronic
1061245690 9:129400409-129400431 GCTCAGGGCAGGCCTCTCGGGGG + Intergenic
1062266839 9:135690448-135690470 GCTGAGGGCAGGCAGGGGGAGGG + Intergenic
1203637187 Un_KI270750v1:124081-124103 GCTCAGGGCAGGGTTTCAGAGGG + Intergenic
1188725690 X:33578852-33578874 ACTCAGAGCAGATATTTGGAGGG - Intergenic
1189693005 X:43636492-43636514 GCTCAAGACAGTAATTTGGATGG + Intergenic
1190121395 X:47662344-47662366 GCTGGGGGCAGGAAGTTGGATGG - Intergenic
1190370724 X:49738229-49738251 GTTTAGGGCATGCCTTTGGAAGG - Intergenic
1194142951 X:90227972-90227994 TCTTAGTGCAGGGATTTGGATGG - Intergenic
1197119313 X:122871319-122871341 GCTCAGAGAAGGCTTCTGGAAGG + Intergenic
1197707952 X:129647551-129647573 GCTCAGGGCAGACATGAGGAAGG + Exonic
1197747027 X:129938458-129938480 GATCAGGGAAGGCTTCTGGAAGG - Intergenic
1200488708 Y:3797291-3797313 TCTTAGTGCAGGGATTTGGATGG - Intergenic