ID: 1037287267

View in Genome Browser
Species Human (GRCh38)
Location 8:17314759-17314781
Sequence TCTAGCTCAGGGCAGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037287267_1037287271 9 Left 1037287267 8:17314759-17314781 CCAAATGCCTGCCCTGAGCTAGA 0: 1
1: 0
2: 2
3: 13
4: 201
Right 1037287271 8:17314791-17314813 CTGAAGACCTGATATGCAGTCGG No data
1037287267_1037287274 16 Left 1037287267 8:17314759-17314781 CCAAATGCCTGCCCTGAGCTAGA 0: 1
1: 0
2: 2
3: 13
4: 201
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287267_1037287272 15 Left 1037287267 8:17314759-17314781 CCAAATGCCTGCCCTGAGCTAGA 0: 1
1: 0
2: 2
3: 13
4: 201
Right 1037287272 8:17314797-17314819 ACCTGATATGCAGTCGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037287267 Original CRISPR TCTAGCTCAGGGCAGGCATT TGG (reversed) Intronic
900332399 1:2142517-2142539 TCTAGCTTAATGCCGGCATTGGG - Intronic
902311852 1:15587145-15587167 TGGAGCTCAGGGCTGGGATTTGG - Intronic
902329765 1:15725514-15725536 TCGAGCTCCGTGCAGGCATCCGG - Exonic
902814789 1:18910068-18910090 TCTTGCACAGAGCAGGCCTTTGG + Intronic
904482312 1:30801718-30801740 GCTTGCACAGGGCAGGAATTCGG - Intergenic
904835480 1:33332843-33332865 TCTGGCTTGGGTCAGGCATTGGG - Intronic
905705828 1:40056615-40056637 TCTAGCTCAGGCCATTCATCTGG - Intronic
905807488 1:40887331-40887353 TCCAGATCAGGGAAGGCTTTAGG + Intergenic
907916491 1:58874698-58874720 TCTTCCTCAGAGCAGGCAGTAGG + Intergenic
911054863 1:93700918-93700940 CCTAGCGCAGGGCAGGCATGTGG + Intronic
912254096 1:108041405-108041427 TTTGGCACAGGGAAGGCATTTGG + Intergenic
914252107 1:145930114-145930136 TCTGGCTCATGGTAGACATTTGG + Intergenic
914961681 1:152214571-152214593 TCTAGCTCATGGCAGTCCTCTGG - Exonic
914961930 1:152215981-152216003 TCTAGCTCATGGCAGTCCTCTGG - Exonic
914962175 1:152217391-152217413 TCTAGCTCATGGCAGTCCTCTGG - Exonic
914962424 1:152218801-152218823 TCTAGCTCAGGGCAGTCCTCTGG - Exonic
914962492 1:152219182-152219204 TCTGGCTCAGGCCAGGCTTCTGG - Exonic
914962545 1:152219494-152219516 TCTGGCTCAGGGCAGTCCTCTGG - Exonic
914962786 1:152220901-152220923 TCTAGCTCAGGGCAGTCCTCTGG - Exonic
914975406 1:152356353-152356375 TCTAGCTCAGGTAAGACATCTGG - Exonic
922645436 1:227281589-227281611 TCTGGCTCAGTACAGGCATGGGG - Intronic
923307022 1:232697571-232697593 GCTTTCTCAGGGCAGGCAGTGGG + Intergenic
923552019 1:234971474-234971496 TCTAGATCAGGGAAGGGATGAGG - Intergenic
924218124 1:241846387-241846409 TCTAACTTAGGGAAGACATTTGG + Intergenic
924672087 1:246138967-246138989 TATAGCTCAGGCCAGGGGTTTGG - Intronic
1064490664 10:15852383-15852405 TGTAGTTCAGGGCAGGACTTAGG + Intronic
1066010332 10:31188550-31188572 CCTGGCCCAGGGCAGGCACTTGG - Intergenic
1069516823 10:69084309-69084331 TCTATCCCAGGGCATGGATTAGG + Intergenic
1069896380 10:71682711-71682733 ACTTGCTAAGGGCAGGCTTTGGG - Intronic
1073563653 10:104517636-104517658 TCTGGCACAGGGCTGGCATGAGG - Intergenic
1074603638 10:114939024-114939046 TCTCGGACAGGGCAGGGATTAGG - Intronic
1075257141 10:120934280-120934302 TCCAGATAAGGGGAGGCATTGGG - Intergenic
1075590157 10:123685288-123685310 TCCAGATCCGGGCAGGCATCTGG - Intronic
1075666248 10:124233120-124233142 TCTAGCTCGGGGCAGGAAGCTGG - Intergenic
1076109521 10:127850165-127850187 TGGTGCTCAGCGCAGGCATTAGG - Intergenic
1076340956 10:129744557-129744579 TCAGGCTCAGGTCAGGCATGGGG - Intronic
1077540632 11:3145012-3145034 TCTAGCCCAGCGGAGGCCTTTGG + Intronic
1077890564 11:6415201-6415223 TCTGGCTCAAGGCAGGGAGTTGG + Intronic
1078928556 11:15895724-15895746 TCTAGCTCAGGACAGGCAGTAGG - Intergenic
1080730368 11:34944970-34944992 TCTAACTGAGGGCAGGCACATGG - Intronic
1082955635 11:58867093-58867115 TCTTGCTCATGGCAGGGAATGGG - Intronic
1082963097 11:58937936-58937958 TCTTGCTCATGGCAGGGAATGGG - Intronic
1085403826 11:76250031-76250053 CCGAACTCAGAGCAGGCATTGGG - Intergenic
1085512784 11:77096747-77096769 TGTGGCTCAGAGCAGGCATCAGG - Intronic
1085559480 11:77457619-77457641 TCTAGGTCAGGCATGGCATTTGG + Intronic
1085815847 11:79736308-79736330 CCTGGCTCACTGCAGGCATTTGG - Intergenic
1087015131 11:93547270-93547292 TCTGGCTGAGGGTAGGCATGTGG - Intergenic
1088467152 11:110153149-110153171 ACTTGCTCAGCGCAGGCAGTGGG + Intronic
1096865847 12:54562305-54562327 CCTAGCTCTAGGCAGCCATTGGG - Intronic
1099318396 12:81113295-81113317 TCTAGCGGAGGGTAGGCAATTGG - Intronic
1100290930 12:93214542-93214564 CCTAGCTCAGGGCTGGTACTGGG + Intergenic
1101253189 12:102955013-102955035 TCAGGCTCAGGGCTGGCATAGGG + Intronic
1101362607 12:104042008-104042030 TCCAGTTCATGGCAAGCATTTGG + Intronic
1102055481 12:109893470-109893492 TCTAGCTCTGGGGAGGAAGTTGG + Intergenic
1102157602 12:110743124-110743146 TCTCGCTCGGGCCCGGCATTGGG - Intergenic
1102493805 12:113305476-113305498 CCTGGCGCACGGCAGGCATTCGG - Intronic
1102638068 12:114341925-114341947 TCTACTTGAGGGCAGGGATTGGG + Intergenic
1103081182 12:118025123-118025145 CCTAGCACAGGGGAGGCACTGGG + Intronic
1103792799 12:123483633-123483655 TCTAGTTGAGGGCAGGGACTAGG + Intronic
1103903304 12:124314675-124314697 TGTAGGTCAGGGCAGGCAGCGGG - Exonic
1104980310 12:132570560-132570582 TCTCGCCCAGGGCAGGGGTTGGG + Intronic
1105770458 13:23606473-23606495 GACAGCTCAGGGCAGGCATGTGG - Intronic
1108485070 13:50915560-50915582 TCTAGCTCCTGGCATGTATTAGG - Intronic
1108593196 13:51928620-51928642 CCTAGCTCAGGGCAGTAATGAGG + Intergenic
1110147234 13:72206306-72206328 CCTGGCTCAGAGCAGGCACTCGG + Intergenic
1114517672 14:23310300-23310322 TCTGGCTCAGGGCATGCATCTGG - Exonic
1116689348 14:48084781-48084803 TCTAGGTCAGGGCAGGCTTCAGG - Intergenic
1120568503 14:86089085-86089107 CCTTGCTCAATGCAGGCATTTGG + Intergenic
1121527426 14:94628752-94628774 GCCAGCTCAGGGCCTGCATTTGG - Intergenic
1121582514 14:95041482-95041504 TCTCACTGAGGGCAGGGATTGGG - Intergenic
1122072485 14:99213720-99213742 CCTAGCTCAGCGCAGGGACTTGG + Intronic
1122481127 14:102048167-102048189 TCCAGCTGAGCCCAGGCATTGGG + Intronic
1123176602 14:106425095-106425117 TCTAGAACAGGGCATGGATTTGG + Intergenic
1125227102 15:37408066-37408088 CCTAGCTAAGGGAAGCCATTAGG + Intergenic
1126957529 15:53950770-53950792 GCAAGCTCAGGGTTGGCATTAGG + Intergenic
1129298734 15:74613662-74613684 TATAGCTCAGGGCAGGGCTGGGG + Intronic
1129707556 15:77803260-77803282 CCTAGCACAGAGGAGGCATTAGG + Intronic
1131050128 15:89342199-89342221 CCTAGCACAGGGCCTGCATTAGG + Intergenic
1131205304 15:90440548-90440570 TCTTGCTAAAGGCAGGCATCTGG - Exonic
1131374243 15:91910426-91910448 TCTATCACAGAGCAGGCACTTGG + Intronic
1131979160 15:97979095-97979117 TCCAGCCCAGGGGAGGCAATGGG - Intergenic
1132392893 15:101451582-101451604 TCCAGCCAAGGGCAGGCTTTGGG - Intronic
1132581913 16:688686-688708 GCTGGCTCAGGGCAGCCATCGGG + Intronic
1132791453 16:1691721-1691743 TGGAGCTCAGGGCTGGCACTCGG + Intronic
1133033472 16:3022406-3022428 TCCAGCTCAGGGGAGTCAGTCGG - Intergenic
1135144776 16:19951655-19951677 TCGAGTTCATGTCAGGCATTTGG + Intergenic
1135996555 16:27253865-27253887 TCAAGTTCAGTGCAGGCCTTGGG - Intronic
1138555544 16:57769402-57769424 GACTGCTCAGGGCAGGCATTCGG - Intronic
1141194366 16:81848881-81848903 TATAGATCATAGCAGGCATTGGG + Intronic
1141714068 16:85716850-85716872 TCTGGGGCAGGGCTGGCATTTGG - Intronic
1146721448 17:35126965-35126987 TCCACCTGAGGGCAGGCCTTGGG - Intronic
1149988455 17:61366545-61366567 TCTAGCACAGTTCAGGCCTTGGG + Intronic
1150002622 17:61451472-61451494 CCTAGACTAGGGCAGGCATTGGG + Intergenic
1151562912 17:74880247-74880269 TCTTTCTCGGGGCAGGCACTAGG + Intronic
1151564473 17:74890119-74890141 TCAAGGTCAGGGCAGCCAGTGGG + Intronic
1151893365 17:76964136-76964158 TCTCGCTCCTGGCAGGAATTGGG - Intergenic
1152433814 17:80263301-80263323 CCTTGCTCAGGGCAGGCCGTGGG + Intronic
1153341933 18:3984367-3984389 TCTAGCACAGGGCAGACTTGGGG - Intronic
1155399716 18:25424715-25424737 TCTGTCTCTAGGCAGGCATTAGG + Intergenic
1156749356 18:40431757-40431779 TCTAACTAAGGGGAGGGATTAGG + Intergenic
1156900403 18:42294461-42294483 TGGAGCTCAGGGCATTCATTTGG - Intergenic
1159940130 18:74400540-74400562 TCAGGCTCGGGGCAGGCATGTGG - Intergenic
1160726075 19:618383-618405 TCTAGCTGGGGGCAGGGACTGGG - Intronic
1161086350 19:2337347-2337369 TCTAACTCAGCGCAGGCTTCAGG + Intronic
1161739423 19:6011459-6011481 CCTGGCTCAGGGCAGGCCGTGGG + Intronic
1162156236 19:8679675-8679697 TCTGGTCCAGGGCAGGGATTGGG + Intergenic
1163135093 19:15304753-15304775 CCTCGCACAGGGCAGGGATTAGG + Intronic
1163180200 19:15593948-15593970 TCTAGCTCTGGACATGCCTTGGG + Intergenic
1165958511 19:39516271-39516293 TCTAGCACAGGCCTGGCACTTGG - Intronic
1166809706 19:45507852-45507874 GCTAGCTCCGGGCTGGAATTTGG + Intronic
926027392 2:9556402-9556424 TCGAGCGCAGCTCAGGCATTTGG + Intergenic
927041370 2:19234005-19234027 TCTGCCTCAGGGCAGGCCTAGGG - Intergenic
927751774 2:25676012-25676034 TCTAGCTCAGGCCACTCATCTGG + Intergenic
929225995 2:39512235-39512257 TCCAGGTTAGGGAAGGCATTAGG + Intergenic
929845500 2:45521195-45521217 TCTAGCTCCCTGCAGTCATTGGG - Intronic
929992607 2:46802498-46802520 GCGAGCTCAGGACAGGCAGTGGG - Intergenic
932479788 2:72032354-72032376 TCCAGGCCAGGGCAGGGATTTGG + Intergenic
934755451 2:96821210-96821232 TCTAGTTCAGTGCAGTCCTTTGG + Intronic
935187263 2:100745462-100745484 GATAGCTCAGGCCAGGCACTAGG - Intergenic
938386721 2:130872062-130872084 TTCAGGTCAGGGCAGGCAATCGG + Intronic
938447387 2:131389507-131389529 ACTAGGTCAGGGCGGGCATGGGG - Intergenic
938548830 2:132361142-132361164 GCAGGCACAGGGCAGGCATTGGG + Intergenic
944638358 2:201696581-201696603 CCTAGCTCAGCACAGTCATTCGG - Intronic
947158036 2:227183516-227183538 TTTAGGTCAGACCAGGCATTAGG + Intronic
947529164 2:230897895-230897917 TATAGTTCAGAGCAGGCATTAGG + Intergenic
947925391 2:233917134-233917156 TCAAGCTAAGAGCAGGAATTTGG + Intergenic
948575206 2:238945497-238945519 TCTAGATTCTGGCAGGCATTAGG - Intergenic
948945535 2:241217402-241217424 ACTAACTCAGGGCAGGCGTTGGG - Intronic
1169726940 20:8745330-8745352 TCTAGGACATGGCAGGCACTGGG + Intronic
1172139688 20:32713684-32713706 TCTAGCACAGTGCAGGCACATGG - Intronic
1172986577 20:38996340-38996362 TCTAGCACAGAGTAGGCACTTGG + Intronic
1173082020 20:39877487-39877509 TCAACCTCAGGGCAGACATCTGG - Intergenic
1173372438 20:42449205-42449227 TCTACTTCATGCCAGGCATTGGG - Intronic
1174517350 20:51102800-51102822 TCCAGCTCTGGGCACACATTTGG + Intergenic
1176101795 20:63367772-63367794 GCGAGCTCTGGGCAGGCATCGGG + Intronic
1180719896 22:17900244-17900266 CACAGCACAGGGCAGGCATTGGG + Intronic
1182302669 22:29346434-29346456 TCCACCTCAGATCAGGCATTAGG + Intronic
1183281557 22:36935280-36935302 TCGACCTCAGGGCAGGGAGTGGG - Intronic
1184411390 22:44328414-44328436 CCTGGCTCGGGGCAGGCCTTCGG + Intergenic
950456085 3:13093516-13093538 TGTGGCTCAGGGCAGGAACTGGG + Intergenic
953976955 3:47389256-47389278 TCTAGCTCAGAGCTGTCATAAGG - Intronic
954374214 3:50185606-50185628 TCTAGGTCAGGGCAGGGAGGGGG + Intronic
956722957 3:72134382-72134404 TCTAGCACACAGTAGGCATTTGG - Intergenic
961640951 3:128364566-128364588 TGGAGCTCAGGGCAGGTATGAGG - Intronic
962372872 3:134835308-134835330 TCCAGCTCAAGGCAGGCAAGGGG - Intronic
964177022 3:153836124-153836146 TCTAGCTCTGGGCAGGTATTAGG + Intergenic
966161233 3:176970693-176970715 TTTAGCGCAGGGCATGCTTTAGG - Intergenic
974990897 4:69088789-69088811 CCTACCTCAGGAGAGGCATTAGG - Intronic
981760724 4:148192279-148192301 CCTGGCTCCGGGCTGGCATTGGG + Intronic
983984381 4:174040587-174040609 TCTAGCTATGGGAAGGCCTTGGG + Intergenic
985619573 5:947115-947137 TCCAGCTCAGGGCCGGAATCGGG + Intergenic
985719582 5:1482244-1482266 CCGAGCTCAGGGCATTCATTTGG - Intronic
986581592 5:9271787-9271809 TCTAGCCAAGGGAAGCCATTAGG + Intronic
986989675 5:13537067-13537089 TCTTGCTCAGTCCAGGCACTGGG - Intergenic
987857250 5:23437020-23437042 TAAAGCTCAGGGCAGGCAGATGG - Intergenic
989419421 5:41219142-41219164 TCAGGCTCAGGGCTGGCATCAGG - Intronic
990133596 5:52618464-52618486 TCTAGCACAGGGTAAGCATTTGG + Intergenic
990190034 5:53249401-53249423 CCTAGATCAGGGTAGGCAATAGG + Intergenic
994422080 5:99534606-99534628 TCCAGCCCAGGGCAGGCAGCGGG - Intergenic
994460764 5:100065978-100066000 TCCAGCCCAGGGCAGGCAGCGGG + Intergenic
994484912 5:100379404-100379426 TCCAGCCCAGGGCAGGCAGTGGG + Intergenic
994612944 5:102068689-102068711 TATATCCCAGAGCAGGCATTGGG + Intergenic
995714349 5:115067565-115067587 CCTAGGGCAGGACAGGCATTTGG + Intergenic
997119974 5:131164472-131164494 GCTAGCCCAGGGTAGGCCTTGGG + Intronic
998092897 5:139381314-139381336 GCTAGCTCAGGGCTGCCATCTGG + Intronic
999204866 5:149840637-149840659 ACTAACTCTGGGAAGGCATTAGG - Intronic
999343555 5:150795246-150795268 TCTAGCACAGGTCTGGCAATAGG + Intronic
1000339912 5:160269119-160269141 TCTAGGTCAGAGGTGGCATTCGG + Intronic
1000623954 5:163517870-163517892 TCTTGATCATGACAGGCATTTGG + Intronic
1005072070 6:21871112-21871134 TCTAGCTCAGAGAAGACATAAGG - Intergenic
1009838990 6:69042345-69042367 CCTAGCACAGAGGAGGCATTTGG + Intronic
1012372627 6:98525977-98525999 CCGAGATCAGGGCAGGCATCTGG + Intergenic
1012951507 6:105522684-105522706 TCTGTTTCAGGGCAGTCATTTGG + Intergenic
1015099728 6:129462367-129462389 TCAAGCTGAAGGCAGGCATATGG - Intronic
1019449225 7:1088193-1088215 TCTAGCCCTGCTCAGGCATTCGG + Exonic
1019709229 7:2510772-2510794 TCCAGCTCAGGACAAGCAGTGGG + Intergenic
1022334543 7:29410001-29410023 TCGTGCTCAGGGCAGGCGCTTGG - Intronic
1030845843 7:114409960-114409982 TCTATCCCAAGGCAGGCATGTGG - Intronic
1031943182 7:127811211-127811233 TCTTGATCAGTGCAGACATTTGG + Intronic
1034512811 7:151550140-151550162 TTTAGCTCACAGCAGCCATTTGG + Intergenic
1035425772 7:158771763-158771785 GCTAGCTCAGAGCAGGCAGTGGG + Intronic
1036163766 8:6412123-6412145 TCTTACTCAAGACAGGCATTAGG - Intronic
1036597697 8:10228827-10228849 TGTGGCTCACAGCAGGCATTTGG + Intronic
1037287267 8:17314759-17314781 TCTAGCTCAGGGCAGGCATTTGG - Intronic
1039521846 8:38177608-38177630 TCGATCTCAGGCAAGGCATTAGG - Intronic
1042975728 8:74466986-74467008 CCTAGTTAAGGGCTGGCATTAGG + Intronic
1048054221 8:130848020-130848042 TCTGGCACAGAGGAGGCATTTGG - Intronic
1048283445 8:133122694-133122716 TTTAGCTCAGAGCCGGCATCTGG + Intronic
1048656392 8:136541837-136541859 TCAAGATCAGGGCAGAAATTTGG - Intergenic
1049094369 8:140539786-140539808 AGAAGCTCAGGGCAGGCTTTGGG + Intronic
1051636347 9:19183996-19184018 TCTAGCTCAGTGCAGGCTGAGGG - Intergenic
1051822988 9:21190863-21190885 TCTTGCTTAGGGCAGGCAACAGG - Intergenic
1051824812 9:21209398-21209420 TCTTGCTTAGGGCAGGCAACAGG - Intronic
1051826808 9:21231475-21231497 TCTTGCTTAGGGCAGGCAATAGG - Intronic
1052570185 9:30210939-30210961 TTTAGCTCAAGGCAGGCAGGAGG + Intergenic
1052892983 9:33720727-33720749 TAGAGCTCTGGGCAGGCACTTGG - Intergenic
1054333723 9:63784609-63784631 GCAGGCACAGGGCAGGCATTGGG + Intergenic
1056241589 9:84653177-84653199 TCTAGCGCAAGGTAGGCAATGGG + Intergenic
1056618720 9:88192164-88192186 TCTAGCAAAGGCCAGGAATTAGG + Intergenic
1057674528 9:97128555-97128577 TTTAGCTCAGGGAAGGGCTTGGG - Intergenic
1057825646 9:98370414-98370436 ACTTGCTCAGAGCTGGCATTGGG - Intronic
1058072948 9:100619827-100619849 TCTAGCCAAGGGAAGCCATTAGG - Intergenic
1058974770 9:110115503-110115525 TCTGGATCAGGACAGGCACTGGG - Intronic
1059527592 9:115006889-115006911 TAAGGCTCAGGGCAGGAATTGGG - Intergenic
1060544003 9:124450069-124450091 GCCGGCTCAGGGCAGGCAGTAGG + Intergenic
1060989935 9:127842889-127842911 TCTGGATCAGGGCAGTCTTTTGG - Intronic
1061185257 9:129049253-129049275 ACAAGCTCAGGGATGGCATTTGG + Intronic
1062448870 9:136607256-136607278 TGCAGCTCAGGGCAGCCAGTTGG - Intergenic
1062730223 9:138104384-138104406 TCTCCCACAGGGCAGGCGTTGGG - Intronic
1186754862 X:12659642-12659664 TCTACCTGGGGCCAGGCATTTGG - Intronic
1189130357 X:38491828-38491850 TCTATCTCAGGGCTTGCTTTTGG - Intronic
1190130942 X:47748505-47748527 TCTAGGTCAGGGCTGGCAATAGG - Intergenic
1190380531 X:49836553-49836575 TGCAGCCCAGGGCAGGCATCAGG - Intergenic
1190385155 X:49878112-49878134 TGCAGCCCAGGGCAGGCATCAGG - Intergenic
1193513760 X:82437248-82437270 TCTAGCTCAAGGCAGGCTATTGG - Intergenic
1201776826 Y:17674771-17674793 TCTAGGTTTGGGGAGGCATTGGG + Intergenic
1201824730 Y:18231221-18231243 TCTAGGTTTGGGGAGGCATTGGG - Intergenic