ID: 1037287268

View in Genome Browser
Species Human (GRCh38)
Location 8:17314766-17314788
Sequence CTGTGCTTCTAGCTCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037287268_1037287274 9 Left 1037287268 8:17314766-17314788 CCTGCCCTGAGCTAGAAGCACAG 0: 1
1: 0
2: 4
3: 20
4: 222
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287268_1037287271 2 Left 1037287268 8:17314766-17314788 CCTGCCCTGAGCTAGAAGCACAG 0: 1
1: 0
2: 4
3: 20
4: 222
Right 1037287271 8:17314791-17314813 CTGAAGACCTGATATGCAGTCGG No data
1037287268_1037287272 8 Left 1037287268 8:17314766-17314788 CCTGCCCTGAGCTAGAAGCACAG 0: 1
1: 0
2: 4
3: 20
4: 222
Right 1037287272 8:17314797-17314819 ACCTGATATGCAGTCGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037287268 Original CRISPR CTGTGCTTCTAGCTCAGGGC AGG (reversed) Intronic
900274511 1:1815389-1815411 CTGTGCCTGTTTCTCAGGGCTGG - Intronic
901209930 1:7518955-7518977 CTCTGCTCCTGGCACAGGGCCGG - Intronic
901325649 1:8363803-8363825 CTTAGCTTCTGGCTCAGTGCAGG - Intronic
901784904 1:11618068-11618090 AAGTCCTTCCAGCTCAGGGCAGG + Intergenic
902275164 1:15334420-15334442 CTGTGGTTATGGCTCAGGGTAGG - Intronic
902527940 1:17071395-17071417 CTGTACTTCCAGGTGAGGGCAGG - Exonic
903743112 1:25569827-25569849 CTGTGCTTCAAGTGCTGGGCGGG + Intergenic
904203198 1:28835221-28835243 CTCTGCTTCTGGCTTAGGGGTGG - Intronic
905306515 1:37022806-37022828 CAGTGCTTCTAGCACAGTGCAGG - Intronic
905490020 1:38336163-38336185 CTGGGCTTGTAGAGCAGGGCTGG - Intergenic
905920878 1:41717874-41717896 CTGAGCGCCTAGCTCACGGCAGG + Intronic
906153451 1:43600891-43600913 CTCTGCCTCTAGCGCAGGACAGG + Intronic
906547181 1:46628063-46628085 CTGTAATTCTAGCACAAGGCGGG - Intergenic
907333250 1:53684903-53684925 CTCTGTTTCCAGCTCAGGGCTGG - Intronic
909360456 1:74753119-74753141 CTGTGCATCTAGCTGATGGTAGG - Intronic
912774040 1:112492559-112492581 CTGTGCTTCTGGCTGGGGGAAGG + Intronic
914245090 1:145879601-145879623 GGGTCCTTCTGGCTCAGGGCTGG - Intronic
914745595 1:150498886-150498908 CTCTGCTTCCAGCTAGGGGCAGG - Exonic
915700745 1:157793252-157793274 ATGTGCTTGGAGCTCAGGGAGGG - Intergenic
916686434 1:167151553-167151575 CTGGGCTTCTAGTGCTGGGCTGG + Intergenic
919781954 1:201226917-201226939 CGGGGCTTCTGGCTCAGGTCGGG - Exonic
922058249 1:222062803-222062825 CTGTCTTGCTACCTCAGGGCAGG - Intergenic
1063646849 10:7893676-7893698 CTTTGCTTCTAGCGTAGGCCTGG + Intronic
1064253075 10:13721720-13721742 CTGTTCTTCTACCTCGGGGATGG + Intronic
1068545098 10:58335525-58335547 CTGTGCTTCACGGTCACGGCCGG + Intronic
1068576358 10:58688472-58688494 CTGGGCTTCTGGGTCAGGGGGGG - Intronic
1070764369 10:79048104-79048126 CTGTGCACCCTGCTCAGGGCTGG - Intergenic
1071568980 10:86686191-86686213 ATGTGCTTCTTCCTCAGAGCAGG - Intronic
1072249979 10:93573735-93573757 TTGTGGCTCTTGCTCAGGGCAGG - Intronic
1072624079 10:97099696-97099718 CCCTGCTCCTAGGTCAGGGCAGG - Intronic
1073455775 10:103635921-103635943 CAGCACTTCCAGCTCAGGGCAGG + Intronic
1073650611 10:105354397-105354419 TTGTGCTGCCAGCCCAGGGCAGG + Intergenic
1075197151 10:120369705-120369727 CTGTGCTCCTAGCTCACACCTGG - Intergenic
1075444836 10:122506022-122506044 CTGTGCTTCCTGGTCTGGGCAGG - Intronic
1076600912 10:131656423-131656445 CTGTTCTCCAGGCTCAGGGCTGG - Intergenic
1076774788 10:132689179-132689201 CTGTGCTTTCAGCTGAGGACAGG + Intronic
1077256024 11:1583721-1583743 CTCAGCATCTGGCTCAGGGCGGG - Intergenic
1077416237 11:2425606-2425628 GTGTGCTTGTAGCCCTGGGCGGG + Intergenic
1077535573 11:3122469-3122491 CTGGGCTCCTAGCCCTGGGCCGG - Intronic
1078754599 11:14197094-14197116 CTGAGAATCTAGCTCAGGGCTGG + Intronic
1083269845 11:61566472-61566494 CTGGGCTCCCAGCTCAGAGCTGG - Intronic
1083330961 11:61898166-61898188 TTCTGCCTCTGGCTCAGGGCTGG + Exonic
1083356824 11:62072705-62072727 CTGTGCTTCCAGCTAAAGGGGGG - Intergenic
1084837599 11:71813924-71813946 CTGTGCTGCCACCTCATGGCCGG - Intergenic
1085290099 11:75391968-75391990 CTGATCTTCTAGGTCAGGGTGGG + Intergenic
1085506878 11:77066101-77066123 CTGTCCTGCTGCCTCAGGGCGGG + Intergenic
1089706645 11:120283008-120283030 CTGTGCTCCTAGCTCTGGGCTGG + Intronic
1090992090 11:131826958-131826980 CTGTCCCTCTAGTTCATGGCTGG + Intronic
1091439377 12:500748-500770 CCGTGCTTCAAGGCCAGGGCTGG + Intronic
1091787920 12:3254117-3254139 CTGTGCTCCAGGCTCGGGGCTGG - Intronic
1092401101 12:8180145-8180167 CTGTGCTGCCACCTCATGGCAGG + Intronic
1093427235 12:19042246-19042268 CTGTGCGCATACCTCAGGGCTGG + Intergenic
1094658871 12:32446918-32446940 CTGTGCTTCCGGCTCTGGGCAGG - Intronic
1096199326 12:49670466-49670488 CTGGGCTTGTAGCTCAGACCTGG - Intronic
1101399880 12:104378121-104378143 CTGAGCTTCTAGCACAGGGTAGG - Intergenic
1101409776 12:104458233-104458255 CGGAGTTTCCAGCTCAGGGCTGG - Intronic
1104423870 12:128658635-128658657 ATGTGCTTTTAGCTCAAGGAAGG - Intronic
1106688405 13:32086963-32086985 CTGTGCTCCTAACTCAGCACAGG - Intronic
1108605177 13:52030384-52030406 CTGTCCTTCTAACACAGGTCTGG - Exonic
1109543793 13:63814650-63814672 CTGGGCTTCCAGTTCAGGGTAGG - Intergenic
1113451361 13:110412382-110412404 CTGTGCCTCCAGCCAAGGGCCGG + Intronic
1114430623 14:22657379-22657401 CTGTGCATCTAGTGCAGGCCTGG - Intergenic
1118362898 14:65070784-65070806 CCGTGTTTCTTGCCCAGGGCTGG - Intronic
1119109856 14:71961294-71961316 CTGAGGGTCTAGCTCAGAGCTGG + Intronic
1119319830 14:73723805-73723827 CTGTGTTGCCAGGTCAGGGCTGG - Intronic
1119543164 14:75453567-75453589 CTGTGCTCCCGGCTCTGGGCTGG + Intronic
1119731434 14:76953685-76953707 CTGTGCGGGCAGCTCAGGGCAGG + Intergenic
1121083548 14:91127696-91127718 CTGTGCTCCTAGCCTGGGGCAGG + Intronic
1122072685 14:99214809-99214831 ATGTGCTTCTAGCTGATGGGTGG + Intronic
1122378905 14:101287569-101287591 GTGTGCTCCTTGCTCAGGGCAGG + Intergenic
1122774718 14:104112037-104112059 GTGAGCTTCTAGTGCAGGGCTGG + Intronic
1122906571 14:104804332-104804354 CAGTGTTGATAGCTCAGGGCAGG - Exonic
1127060788 15:55181443-55181465 CTCTGCTTCTAGATCAATGCTGG + Exonic
1127672358 15:61207438-61207460 CTGAGCTTCTAGCTAATGGAGGG - Intronic
1128989006 15:72242761-72242783 ATGAGCATCTAGCTCAGTGCTGG - Intronic
1129071431 15:72954468-72954490 CAGTGGTCCTAGCTCAAGGCTGG - Intergenic
1129252881 15:74318487-74318509 GCCTGCTTCCAGCTCAGGGCTGG + Intronic
1129298729 15:74613655-74613677 CAGAGCCTATAGCTCAGGGCAGG + Intronic
1129683412 15:77671191-77671213 ACTTGCTTCTAGCTCAAGGCTGG - Intronic
1131394903 15:92078422-92078444 CTGTGCTTCTTGCTGTAGGCAGG + Intronic
1132257916 15:100393601-100393623 CCGAGCTTCTTGCTCATGGCAGG - Intergenic
1132860026 16:2065855-2065877 CTGTGCTCCTGAGTCAGGGCCGG + Intronic
1132924539 16:2422033-2422055 CTGTGCTCCTTGCTCAGGACTGG - Intergenic
1135261400 16:20983963-20983985 ATGTGGTTCTAGCTCACTGCAGG - Intronic
1136590725 16:31216265-31216287 GTGGTCTCCTAGCTCAGGGCAGG + Intronic
1137029295 16:35506942-35506964 CTGTGCGCCTAGCCCAGGGCGGG + Intergenic
1137670655 16:50276321-50276343 CAGTGCTGCTGGCTCATGGCAGG + Intronic
1142968307 17:3594717-3594739 CTGTGCCCCCAGCGCAGGGCTGG - Intronic
1145830548 17:27912865-27912887 CTGGGTTTCTAGACCAGGGCAGG - Intergenic
1152433811 17:80263294-80263316 CTGAGCGCCTTGCTCAGGGCAGG + Intronic
1154017549 18:10632820-10632842 CTATGCTTATAACTCATGGCAGG + Intergenic
1154187314 18:12196777-12196799 CTATGCTTATAACTCATGGCAGG - Intergenic
1157879946 18:51312112-51312134 CTGTGTTGCTGGCTCAGTGCAGG + Intergenic
1158146211 18:54315975-54315997 CTGTGCTTATAGCTCACTGCAGG + Intronic
1158652402 18:59299662-59299684 TTGTGCTTCTTGCTCAGGGAAGG + Intronic
1160812059 19:1017212-1017234 CTGGGCGTGTGGCTCAGGGCCGG - Intronic
1161425899 19:4202943-4202965 CTGGGCTTCGGGGTCAGGGCAGG - Intronic
1162797146 19:13092763-13092785 CTGGGCTTCTGGCCCAGGCCCGG - Intronic
1163620347 19:18355982-18356004 CTGTGCTTCTCCCACAGGGCGGG - Exonic
1165934211 19:39379429-39379451 CTGTTCTTCTCCCTCAGGGAGGG + Intronic
1166392146 19:42414409-42414431 CTGTTCTGCTGGCTCAGGGTGGG + Intronic
1167502497 19:49855873-49855895 CTGAGATTCTGGCGCAGGGCAGG + Intronic
1168307778 19:55444789-55444811 CTCGGCAGCTAGCTCAGGGCAGG - Intergenic
925023088 2:587403-587425 CTGTGCTTCCTGCTCAGTGGTGG - Intergenic
925311097 2:2882331-2882353 TTGTGCTTCTACCACAGGACAGG + Intergenic
925392412 2:3505516-3505538 CTGTGCTTCTGGCAGAGGGAGGG + Intronic
925455798 2:4015684-4015706 CTGAGCATCTGGCTGAGGGCAGG - Intergenic
926691146 2:15734671-15734693 CTGGGCTTCTTGCACATGGCTGG + Intronic
927041372 2:19234012-19234034 CTTTGGTTCTGCCTCAGGGCAGG - Intergenic
931456167 2:62411362-62411384 CTTTGCTTCAAGCACAGGGATGG + Intergenic
933809832 2:86026390-86026412 CTGTTATTTCAGCTCAGGGCGGG - Exonic
935443624 2:103132761-103132783 CTGAGAGTCAAGCTCAGGGCAGG + Intergenic
935620770 2:105127720-105127742 CTGTGCTTCCTGCACTGGGCAGG + Intergenic
935868802 2:107422445-107422467 CAGTTCTTCTATCTGAGGGCTGG + Intergenic
938879069 2:135566214-135566236 GGGTGTGTCTAGCTCAGGGCAGG - Intronic
946027013 2:216678081-216678103 CTGAGCCTGGAGCTCAGGGCAGG + Intronic
946343397 2:219087340-219087362 CAGTGCTAGTAGCACAGGGCAGG - Intronic
946343400 2:219087346-219087368 CTGTGCTACTAGCACTGTGCAGG + Intronic
946365125 2:219244325-219244347 CTCAGCCTCTAGCACAGGGCCGG + Intronic
946423025 2:219575511-219575533 CTGTGCTTGTATCTAAGGGTGGG + Exonic
947909397 2:233791408-233791430 CAGTGCTTCTAGCTCGGGAAAGG - Intronic
948706923 2:239800539-239800561 CTGTGCTTCTGGGTCAGGTGGGG + Exonic
949081570 2:242104763-242104785 CTGTGGTTCTGGATCAGGGTTGG + Intergenic
1170431804 20:16283085-16283107 CTGTCAGTCTAACTCAGGGCAGG + Intronic
1170601188 20:17842999-17843021 CTGTGCTGAGAGCTCAGGGGTGG - Intergenic
1173404409 20:42752480-42752502 CTTTGGTTCCAGTTCAGGGCAGG - Intronic
1173405082 20:42757409-42757431 CTGTGGTGATAGCTTAGGGCAGG - Intronic
1173613849 20:44390126-44390148 CTGAGCTTCAAGCTCAGGTCTGG + Intronic
1175656857 20:60778578-60778600 CTGTTGTTCAAGCTCAGGACAGG - Intergenic
1177497626 21:21910247-21910269 CTGGGCTTCTGGCTCAGGTAGGG - Intergenic
1178932505 21:36831909-36831931 CGATGCTATTAGCTCAGGGCAGG - Intronic
1179549552 21:42135384-42135406 CTGAACCACTAGCTCAGGGCTGG - Intronic
1179779296 21:43689107-43689129 CTGGGCTTCCAGGCCAGGGCCGG + Intronic
1179884902 21:44309725-44309747 CCTTGTTCCTAGCTCAGGGCTGG + Intronic
1181645064 22:24226502-24226524 ATGTGGTTCTAGGCCAGGGCAGG - Intronic
1181920006 22:26313144-26313166 CTCTGCTTCCAGTTCAGGGCCGG + Intronic
1182302123 22:29342822-29342844 CTGTGCTTCTACCAGAGGGTTGG + Intronic
1183316984 22:37142279-37142301 CTCTGCCTCTTGCTCAGCGCTGG + Intronic
1183654484 22:39176858-39176880 CTGTGCCTCTGGCTAAGGGCAGG + Intergenic
1184178267 22:42802047-42802069 CTGTGCTTCAAGCTGAGGGCAGG + Intronic
1184464624 22:44661409-44661431 CTCTGCTCCCAGCCCAGGGCTGG - Intergenic
1184740967 22:46428891-46428913 CTGTGCTCCAGGCTCTGGGCAGG + Intronic
1185176319 22:49329007-49329029 CTGTGGTGCTTTCTCAGGGCAGG + Intergenic
949259076 3:2084157-2084179 CTCTGCATCTAGCTCAAGGAAGG + Intergenic
949259096 3:2084320-2084342 CTCTGCATCTAGCTCAAGGAAGG + Intergenic
949259116 3:2084483-2084505 CTCTGCATCTAGCTCAAGGAAGG + Intergenic
951559737 3:23953754-23953776 CTGTGCTTCTAGCCAAGTGTTGG + Intronic
952848357 3:37707861-37707883 CTGTGCTGCCAGCCAAGGGCAGG - Intronic
953982956 3:47421853-47421875 CTGGGGTTCCAGCTCAGTGCAGG + Intronic
956843342 3:73159699-73159721 CTGGGCTTCTAGGTCAGGTGGGG - Intergenic
959367928 3:105487341-105487363 CTGTGCAGCTAGCCAAGGGCAGG - Intronic
960587961 3:119337887-119337909 CTGGGCTTCTGGGTCAGGGAGGG - Intronic
960992666 3:123322048-123322070 CTATGCCTCCAGCCCAGGGCTGG - Intronic
962084379 3:132174560-132174582 CTGTGCTTCTTGCTCTGTGGGGG - Intronic
962404817 3:135091920-135091942 CTGTGTTTCTATCTAAAGGCTGG - Intronic
962809319 3:138947513-138947535 CTGAACTTCTAGCTCGGGGCTGG + Intronic
964403195 3:156320687-156320709 CTGTCCTTATTGCTCTGGGCTGG + Intronic
965551286 3:169967163-169967185 CTGACCTTCCAGCTCAGGCCCGG - Intronic
967479140 3:189954433-189954455 CTGTGCTTCTAGCTCAGACCTGG + Intergenic
967930038 3:194684496-194684518 GTCTGCTCCTAGCTCAGGGCCGG + Intergenic
968540828 4:1167502-1167524 CTCTTCTTCGAGCTCGGGGCAGG + Exonic
968594095 4:1473471-1473493 CTGTGCTCCTGGGTCAGGGCTGG - Intergenic
968908203 4:3464066-3464088 CTGGGGTGCTGGCTCAGGGCGGG - Intronic
969467723 4:7367574-7367596 CGGCTCTTCTCGCTCAGGGCTGG + Intronic
969604451 4:8195534-8195556 CTGTACTTCTGGCCCAAGGCCGG - Intronic
969779016 4:9381435-9381457 CTGTGCTGCCACCTCATGGCCGG - Intergenic
970436961 4:16045095-16045117 CTGTGCCACTTGCTGAGGGCCGG - Intronic
970647981 4:18145225-18145247 CTCTGTTTCTATCTGAGGGCAGG - Intergenic
972404237 4:38731338-38731360 CGGAGCTTCTAGTTCAGGGCCGG + Intergenic
974807449 4:66898893-66898915 CTCTGTGTCTAGCTCAGGGATGG - Intergenic
974854113 4:67438899-67438921 CTGTGCTTCTTGCAGAGGGAGGG + Intergenic
980278428 4:130685666-130685688 CTGTGCTCCCAGCTAAAGGCTGG - Intergenic
983587835 4:169375158-169375180 CTGTGATTCTACTCCAGGGCAGG - Intergenic
984728785 4:183046072-183046094 TTGTGTGTCTAGCTCAGGGATGG + Intergenic
985537649 5:473795-473817 CTCTGCCTCCAGCTCAGAGCAGG - Intronic
985656905 5:1137093-1137115 CTGTGCAGCCAGCTCTGGGCTGG - Intergenic
985695643 5:1338680-1338702 TTGTGCTGCTACCACAGGGCTGG - Intronic
985882657 5:2651565-2651587 CTGTGCTTCCAGCTGACGGGAGG - Intergenic
986200280 5:5573136-5573158 CTGCGCTTCCAGCTGAGGTCGGG + Intergenic
986546507 5:8903844-8903866 CTGTGCTTCCAGCTCACTGGAGG - Intergenic
989074792 5:37552764-37552786 CTGTGCATTCAGCTCAAGGCTGG - Intronic
989419422 5:41219149-41219171 TTGTGCATCAGGCTCAGGGCTGG - Intronic
993181465 5:84559144-84559166 CTGTGCTTCTGCTACAGGGCTGG + Intergenic
995194514 5:109348749-109348771 GTGAGCTTCTGGCTGAGGGCAGG + Intronic
999728165 5:154454274-154454296 CTGTGTTAATAACTCAGGGCAGG - Intronic
1000916624 5:167089938-167089960 GGGTGCTCCTAGCTCAGGGGAGG + Intergenic
1001155081 5:169265729-169265751 AAGTGATTCTAGCCCAGGGCTGG + Intronic
1001317742 5:170656431-170656453 CTGTCCTTCAGGCTCAGGGATGG - Intronic
1001326265 5:170727877-170727899 CAGTGATTATGGCTCAGGGCAGG - Intronic
1002330039 5:178434819-178434841 ATGGGATTCCAGCTCAGGGCTGG + Intronic
1003056609 6:2826543-2826565 CTCTTCTTCCAGCTTAGGGCAGG - Intergenic
1004070412 6:12292204-12292226 CTGTGTTTCTTGCTGATGGCAGG + Intronic
1007317808 6:41003397-41003419 CTCTGCTTCTGGACCAGGGCAGG - Intergenic
1007724287 6:43905482-43905504 CTGTGCTGCCAGCTCTGGGAGGG + Intergenic
1010196512 6:73244869-73244891 CTGTGATACTAGCTCACTGCAGG - Intronic
1011656352 6:89555495-89555517 CTGGGATTTGAGCTCAGGGCAGG + Intronic
1017972812 6:159327809-159327831 CTGTGCTTCAGGGTCTGGGCAGG + Intergenic
1019633969 7:2065596-2065618 CTGAGTTTCGAGCTCTGGGCTGG - Intronic
1019670421 7:2275032-2275054 CTGTGGTCCTGGCTCAGGGATGG - Intronic
1019688275 7:2394723-2394745 CTCTGCTTCAAGCTGAGGCCTGG + Intergenic
1019703762 7:2487863-2487885 CAGTGCTCCCAGCTCTGGGCTGG - Intergenic
1020055692 7:5116521-5116543 CTGTTCTATCAGCTCAGGGCCGG + Intergenic
1022383866 7:29884333-29884355 CTGCGCATCTTGCGCAGGGCTGG - Exonic
1023031293 7:36092509-36092531 CTTTGCTCCCAGCTCCGGGCGGG + Intergenic
1025952054 7:66153052-66153074 CTGGGCTGCTGTCTCAGGGCAGG - Exonic
1026881485 7:73909271-73909293 CTGGGCTTCCAGGGCAGGGCTGG - Intergenic
1027779047 7:82500142-82500164 CTCTGTGTCTAGCTCAGGGTTGG + Intergenic
1027844802 7:83359212-83359234 CTGATCTTCTGGCTCAGGCCAGG + Intergenic
1031011358 7:116527408-116527430 ATGTGCCATTAGCTCAGGGCAGG - Intronic
1031350241 7:120722223-120722245 CTGTGCTTCCAACACAGGACAGG + Intronic
1031473813 7:122198892-122198914 ATGTTCTTCTTTCTCAGGGCAGG - Intergenic
1032636029 7:133710175-133710197 CTGGGCTTCTATCACAGGGTGGG + Intronic
1034784049 7:153909202-153909224 CTGAGGTTCTACCTCTGGGCAGG + Intronic
1034841699 7:154403541-154403563 CTGTGCATCCAACTCTGGGCTGG + Intronic
1035388723 7:158490936-158490958 CTGTGTGTCTGGCACAGGGCAGG + Intronic
1035539481 8:421553-421575 CTGTGGTTCTGGATCAGGGTTGG + Intronic
1035544783 8:471632-471654 CTGCGCTGCTCACTCAGGGCTGG + Intergenic
1036344884 8:7954951-7954973 CTGTGCTGCCACCTCATGGCCGG + Intergenic
1036862013 8:12361955-12361977 CTGTGCTGCCACCTCATGGCCGG + Intergenic
1037287268 8:17314766-17314788 CTGTGCTTCTAGCTCAGGGCAGG - Intronic
1040496357 8:47969064-47969086 CTGTGCTTCTAGCTCAATGCTGG - Intronic
1040963612 8:53062017-53062039 CTGGGCTTCTAGGTCAGGTGGGG + Intergenic
1041364922 8:57092086-57092108 CAGTGTACCTAGCTCAGGGCTGG + Intergenic
1041821113 8:62033743-62033765 TTCTTGTTCTAGCTCAGGGCTGG - Intergenic
1041825482 8:62091378-62091400 CTTTGCTCCTAGCACAGTGCTGG + Intergenic
1042926818 8:73975614-73975636 CTCTGCTCCTAGCTCAGTCCTGG + Intronic
1044999346 8:97866913-97866935 CTGTACATCTAGCACATGGCAGG + Intergenic
1047816067 8:128464310-128464332 CATTGCTTCTAGCACAGGACTGG + Intergenic
1049326058 8:142022175-142022197 CTGGGCTTCTAGCCTAGGCCAGG - Intergenic
1049383752 8:142330640-142330662 CTGGGCTTCTACGTCGGGGCGGG + Intronic
1049794116 8:144488785-144488807 CTGTGCTCCTGGCTGAGGCCTGG - Intronic
1050257408 9:3809774-3809796 CTGGGCTTCAACCTCAGGACTGG - Intergenic
1050325274 9:4491641-4491663 GTGTGTTTCTAGCTCCGGCCCGG + Intronic
1051314085 9:15810228-15810250 CTCTGTGTCTAGCTCAGGGTTGG - Intronic
1055941604 9:81655471-81655493 CTCTACTTCTAGCCCAGGGAAGG + Intronic
1056596727 9:88013787-88013809 CTGTGCTGCCAACTCAGGCCTGG - Intergenic
1057428988 9:94977375-94977397 CTGTGCCTCTAAATCAGGGCAGG - Intronic
1058104071 9:100950205-100950227 CTATGCTCCTTGCTCAAGGCAGG + Intergenic
1060180884 9:121532962-121532984 CTGTACTTCTAGCTCAGAAGTGG - Intergenic
1062021300 9:134320612-134320634 ATGTGCCTCTAGCCCTGGGCTGG - Intronic
1062561187 9:137142789-137142811 CTGTGGTTGCAGCTCAGGGTCGG + Intronic
1186511167 X:10130746-10130768 TTGTGCTTCTGGGTGAGGGCAGG - Intronic
1193513761 X:82437255-82437277 CTGTTTTTCTAGCTCAAGGCAGG - Intergenic
1193820209 X:86152027-86152049 TAGTGCTTCTAGCTAAGAGCAGG + Intronic
1195001823 X:100649789-100649811 GTGTGCTTCCAGGACAGGGCTGG - Intronic
1199620229 X:149693728-149693750 CTCTTCTTCTAGCTCTTGGCAGG + Intronic
1200106761 X:153718423-153718445 CTGTGCTACCAGCTCAGGCGTGG + Intronic