ID: 1037287269

View in Genome Browser
Species Human (GRCh38)
Location 8:17314770-17314792
Sequence AGAGCTGTGCTTCTAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037287269_1037287275 28 Left 1037287269 8:17314770-17314792 CCCTGAGCTAGAAGCACAGCTCT 0: 1
1: 0
2: 1
3: 14
4: 320
Right 1037287275 8:17314821-17314843 ACAGCCCTTTGAATTCGCTCTGG No data
1037287269_1037287272 4 Left 1037287269 8:17314770-17314792 CCCTGAGCTAGAAGCACAGCTCT 0: 1
1: 0
2: 1
3: 14
4: 320
Right 1037287272 8:17314797-17314819 ACCTGATATGCAGTCGGTGAAGG No data
1037287269_1037287274 5 Left 1037287269 8:17314770-17314792 CCCTGAGCTAGAAGCACAGCTCT 0: 1
1: 0
2: 1
3: 14
4: 320
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287269_1037287271 -2 Left 1037287269 8:17314770-17314792 CCCTGAGCTAGAAGCACAGCTCT 0: 1
1: 0
2: 1
3: 14
4: 320
Right 1037287271 8:17314791-17314813 CTGAAGACCTGATATGCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037287269 Original CRISPR AGAGCTGTGCTTCTAGCTCA GGG (reversed) Intronic
900174821 1:1287011-1287033 AGGGCCGTGCTCCCAGCTCAAGG - Intronic
900788569 1:4665153-4665175 AAAGCTGTGCTTCCTGCTGAGGG + Intronic
900874871 1:5334983-5335005 ACAGGTGGGCTTCTAGCTCTGGG + Intergenic
900931679 1:5741954-5741976 AGGGGGGTGCTTCTGGCTCATGG + Intergenic
901294895 1:8153701-8153723 AGAGCTCTGCGTCTGGCTAAAGG - Intergenic
903624700 1:24722048-24722070 AGAACCGTGTGTCTAGCTCAGGG + Intergenic
903847765 1:26288638-26288660 TGAGTTCTGCTGCTAGCTCAGGG - Intronic
906311999 1:44760777-44760799 AGTGCTGAGCTTCCAGCCCAGGG - Intronic
906723325 1:48025027-48025049 AGAGCTCTGCTTCCTGCCCAGGG + Intergenic
906766065 1:48435573-48435595 AGTGCTCTGCATCTAGCTGAAGG + Intronic
906988913 1:50716594-50716616 AGAGCTCTGTGTCTAGCTAAAGG + Intronic
907115821 1:51967577-51967599 AGTGGTGTGGTTATAGCTCAAGG + Intronic
907141954 1:52195198-52195220 TGAGCACAGCTTCTAGCTCATGG + Intronic
907270343 1:53287535-53287557 AGAGCTGGGCTTCTGTCTCCTGG + Intronic
909360457 1:74753123-74753145 AAAACTGTGCATCTAGCTGATGG - Intronic
909688364 1:78376779-78376801 AGAGCAGTGCTTCTCCATCAGGG + Intronic
910749060 1:90607912-90607934 TGAGCTGTGCTACTTGTTCACGG + Intergenic
911854042 1:102854306-102854328 AGTGCTCTGTGTCTAGCTCAGGG + Intergenic
912675909 1:111680404-111680426 AGAGCTCTGTGTCTAGCTAAAGG - Intronic
914423309 1:147550169-147550191 AGAGGTGACCTTCTGGCTCACGG - Intronic
915019651 1:152766916-152766938 AAAGGTGTGGATCTAGCTCAGGG - Intronic
915242235 1:154531924-154531946 AGCGCTCTGTGTCTAGCTCAGGG - Intronic
915531474 1:156504871-156504893 AGAGTTGTGCCCCAAGCTCAGGG + Intergenic
916845330 1:168644493-168644515 AGAGCATTGCTCCTAGCACAGGG + Intergenic
919386962 1:196934234-196934256 AGCACTGTGTGTCTAGCTCAAGG + Intronic
919964996 1:202513944-202513966 AGAGTTCTGCTTTTAGCTCTTGG + Intronic
920762866 1:208802432-208802454 ACTGCTGCCCTTCTAGCTCATGG - Intergenic
921068801 1:211642250-211642272 GGAGCAGTGCTATTAGCTCATGG - Intergenic
923050313 1:230387094-230387116 AGAGAAGTGCTTCCAGCTCCAGG - Intronic
923203127 1:231731860-231731882 AGAGCAGAGCGTCTGGCTCAGGG - Intronic
923809911 1:237302704-237302726 AGAGCTGGGATTTTAGCTGAAGG - Intronic
923943835 1:238860232-238860254 ACAGCTGAGCTTCTCGCTGAGGG + Intergenic
924885855 1:248215843-248215865 ATAGCTGAGGTGCTAGCTCAGGG - Intergenic
1063155264 10:3373278-3373300 AGAGTTGAGCTTCTAACGCAAGG - Intergenic
1063155275 10:3373360-3373382 AGAGTTGAGCTTCTAACGCAAGG - Intergenic
1063155298 10:3373524-3373546 AGAGTTGAGCTTCTAACGCAAGG - Intergenic
1063161396 10:3421352-3421374 AGAGCTGGGCTTCGGGCTCAGGG - Intergenic
1064497857 10:15933397-15933419 AGAGCTGTCCTTCTTTGTCATGG + Intergenic
1066522219 10:36233949-36233971 AGATTTGTTCTTCTTGCTCAAGG - Intergenic
1067961167 10:50852152-50852174 AAGTCTGTGCTTCTAGCTTAAGG + Intronic
1067974807 10:51012203-51012225 AGAGTGGTGTTTCCAGCTCAGGG + Intronic
1069280741 10:66651297-66651319 AGCACTCTGCTTCTAGCTCAGGG - Intronic
1069868760 10:71520555-71520577 AGTGCTGTGCCTCTGGCCCAGGG - Intronic
1070389395 10:75956042-75956064 AGATAAGTGGTTCTAGCTCAGGG + Intronic
1071324995 10:84505730-84505752 AGAAATGTGCATCTAACTCATGG + Intronic
1071332284 10:84571881-84571903 AGCACTCTGTTTCTAGCTCAAGG + Intergenic
1071610902 10:87030622-87030644 AGTGCTCTGTGTCTAGCTCAAGG - Intergenic
1072338702 10:94424572-94424594 TGTGCTGTGATACTAGCTCAGGG + Intronic
1075664880 10:124223029-124223051 AGAGCTGGGATTCAAGCCCAGGG + Intergenic
1075965112 10:126604490-126604512 AGAGCTGAGCTTCTCCCTGAAGG - Intronic
1076045770 10:127293143-127293165 AGAGCGCTGCTGCTAGCCCAGGG + Intronic
1076187519 10:128460862-128460884 GGAGCTCTGCTCCTTGCTCAGGG - Intergenic
1078150096 11:8751115-8751137 AGCACTCTGCATCTAGCTCAAGG + Intronic
1078432919 11:11301579-11301601 AAGGCTGGGTTTCTAGCTCAGGG + Intronic
1078528675 11:12119897-12119919 AGAGGTGTGTTTCTTGCTCAAGG + Intronic
1078909678 11:15719314-15719336 AGAGCTGTGCTTCTGTTTGATGG - Intergenic
1079176057 11:18142128-18142150 AGAGTTGTACTTGTGGCTCAAGG + Intronic
1079179556 11:18177853-18177875 AGAGTTGTACTTGTGGCTCAAGG + Intronic
1080728649 11:34923636-34923658 AGAGCTGAGATTCTACCTGATGG - Intronic
1081046304 11:38278359-38278381 AGTGCTCTGTGTCTAGCTCAAGG - Intergenic
1081657844 11:44869007-44869029 GGAGCTGTGGTTCTGGCTGAGGG + Intronic
1082106820 11:48229513-48229535 AGAACTCTGTGTCTAGCTCAAGG + Intergenic
1082242913 11:49890145-49890167 AGAGCTGTGGCTCTAACACAAGG - Intergenic
1083215418 11:61215753-61215775 GGAGCTGTGCTTCGACCCCAGGG - Intergenic
1083218302 11:61234582-61234604 GGAGCTGTGCTTCGACCCCAGGG - Intergenic
1085290097 11:75391964-75391986 AAAGCTGATCTTCTAGGTCAGGG + Intergenic
1086035002 11:82404415-82404437 AGCGCTCTGTGTCTAGCTCAAGG + Intergenic
1087074683 11:94118397-94118419 AGCGCTGTGTGTCTAGCTAAAGG + Intergenic
1088914054 11:114213504-114213526 AAAGATCTGCTTCTTGCTCATGG + Intronic
1089008699 11:115114428-115114450 TCAGCTGGGCTTCCAGCTCATGG - Intergenic
1089706644 11:120283004-120283026 AGAGCTGTGCTCCTAGCTCTGGG + Intronic
1090069502 11:123531259-123531281 TGAGCTGTCCTTCTCACTCAAGG - Intronic
1090270182 11:125380579-125380601 ACATCTCTGCTTCTAGCCCATGG + Intronic
1090405509 11:126473742-126473764 AGAGCTCTGCTTCTGGGTCTGGG - Intronic
1090967840 11:131614132-131614154 AAGTCTGTGCTTCTAGTTCAAGG - Intronic
1094405268 12:30110317-30110339 AGCACTGTGTATCTAGCTCAAGG - Intergenic
1094446252 12:30533763-30533785 AGAGCTGTACTTTTGGCTAATGG - Intergenic
1100142439 12:91634476-91634498 AGCACTCTGCATCTAGCTCAAGG + Intergenic
1101399881 12:104378125-104378147 AGGACTGAGCTTCTAGCACAGGG - Intergenic
1101545078 12:105704853-105704875 AAAGCTGTGTTCATAGCTCAGGG + Intergenic
1103340689 12:120219691-120219713 AGAGCTGTGCTCCCAGCACAGGG + Intronic
1103548733 12:121720749-121720771 AGAGCTGTGCCTCTTGCTGGTGG - Intronic
1104373997 12:128247974-128247996 AGCACTCTGCATCTAGCTCAGGG + Intergenic
1104547348 12:129724206-129724228 AGAGCAGTGTTGCTTGCTCAAGG - Intronic
1105255970 13:18744334-18744356 AGAACTGTGGTTGTGGCTCAGGG - Intergenic
1105614356 13:21998878-21998900 AGGGCTGTGTTTCTAGCACTAGG + Intergenic
1105701430 13:22938344-22938366 AGCGCTCTGTGTCTAGCTCAGGG - Intergenic
1106312527 13:28566417-28566439 AGAGCTGTGCTTCTGTCTCCAGG + Intergenic
1107343062 13:39430676-39430698 AGCGCTCTGCGTCTAGCTAAAGG + Intronic
1107470518 13:40687294-40687316 GGAGTTGTGCTTTTAGCACAAGG - Intergenic
1109110922 13:58318370-58318392 AGCACTGTGTGTCTAGCTCAAGG - Intergenic
1109267581 13:60218902-60218924 AGGGCTGTGATTCTAACACATGG - Intergenic
1109434004 13:62274610-62274632 AGTGCTGTGTGTCTAGCTAAAGG - Intergenic
1109506257 13:63306458-63306480 AGCGCTCTGTGTCTAGCTCAGGG + Intergenic
1109854204 13:68107555-68107577 AGCACTGTGTGTCTAGCTCAAGG - Intergenic
1109884472 13:68524468-68524490 AGTGCTCTGTGTCTAGCTCAAGG + Intergenic
1109884477 13:68524550-68524572 AGTGCTCTGTGTCTAGCTCAGGG + Intergenic
1111602572 13:90493855-90493877 ACAGCTGTGCTGCTCGATCAGGG - Intergenic
1112370262 13:98787717-98787739 AGACCTCTGCTTCTCTCTCATGG + Intergenic
1113094830 13:106652635-106652657 AGAGCTGAGATTCTGGCTCATGG + Intergenic
1113551872 13:111198871-111198893 AGAGCTCTGTGTCTAGCTAAAGG - Intronic
1115736874 14:36341901-36341923 AGTGCTGTGTATCTAGCTAAAGG + Intergenic
1117086085 14:52202900-52202922 AGAGCTGGGGTTCAAGGTCAGGG - Intergenic
1117864455 14:60131067-60131089 AGGGCTATCCTCCTAGCTCATGG - Intronic
1118144837 14:63124153-63124175 AGATCTTTCCTTATAGCTCAAGG - Intergenic
1118558807 14:67056362-67056384 AGTGCTCTGCGTCTTGCTCAAGG - Intronic
1120215660 14:81679023-81679045 AGCACTGTGTATCTAGCTCAAGG - Intergenic
1120229656 14:81829181-81829203 AGCACTCTGCATCTAGCTCAGGG - Intergenic
1122083681 14:99284828-99284850 AGAGCTGCGCTTCCAGCCCCGGG + Intergenic
1202836041 14_GL000009v2_random:77694-77716 AGAACTGTGGTTGTGGCTCAGGG + Intergenic
1123992867 15:25696364-25696386 AGAGCTTTGCTTCCAGGGCATGG + Intronic
1125678899 15:41518302-41518324 ACATCTGTCCTTCTAGCACAAGG + Intronic
1126788590 15:52199608-52199630 AGCTCTCTGATTCTAGCTCAAGG + Intronic
1127323363 15:57868698-57868720 AGCGCTCTGCATCTAGCTAAAGG - Intergenic
1127760278 15:62132743-62132765 ACAGCTGTGCTTCGAGTTCTAGG + Intergenic
1127764553 15:62172379-62172401 AGAAGTCTGTTTCTAGCTCAGGG - Intergenic
1130611578 15:85366071-85366093 AGTGGTGTGGTTCTGGCTCAGGG - Intergenic
1135637770 16:24093649-24093671 GGAACTGTGCTTCTAGCTGGTGG - Intronic
1138281284 16:55773752-55773774 AGAGCTGGGACTCCAGCTCATGG + Intergenic
1138287255 16:55820109-55820131 AGAGCTGGGACTCCAGCTCATGG - Intronic
1139142251 16:64280607-64280629 AGTGCTCTGTTTCTAGCTAAAGG - Intergenic
1139387617 16:66583840-66583862 AAAGCTTTGGTACTAGCTCAGGG + Intronic
1140035415 16:71367903-71367925 AGGGCTGCCCTTCTAGCTCCTGG + Intronic
1141546504 16:84773577-84773599 AGAGCTGTGCTTTCTGCTGACGG + Intronic
1141789377 16:86224019-86224041 AGAGCTGTGGTTCTCACTAAAGG - Intergenic
1142345496 16:89551283-89551305 AGTGCTGTGTTCCTACCTCAGGG + Intronic
1143386015 17:6530956-6530978 AGAGCTGTGCCACTGGCCCACGG + Intronic
1147404042 17:40198063-40198085 AGCGCTGTGTGTCTAGCTAAAGG + Intergenic
1147519957 17:41161127-41161149 AAAGCTGTGCTTTAATCTCATGG + Intergenic
1147805450 17:43127441-43127463 AGTGCTCTGTGTCTAGCTCAAGG + Intergenic
1149455818 17:56787372-56787394 TGTGCTGTGCTTCTTCCTCAGGG - Intergenic
1151078606 17:71302761-71302783 AGATCTCTCCTTCTAGCTCGTGG - Intergenic
1154004983 18:10519460-10519482 AGAGCTGACATTCTAGCACAGGG - Intergenic
1155611618 18:27673679-27673701 AGCACTCTGCGTCTAGCTCAGGG - Intergenic
1158460646 18:57643494-57643516 AGCGCTCTGTATCTAGCTCAAGG - Intergenic
1160605212 18:80044937-80044959 GGAGCTTTGCTTCCAGCTCAGGG - Intronic
1162544021 19:11317371-11317393 AGAGATGTGATTGTTGCTCAGGG + Intronic
1164733457 19:30523201-30523223 AGATCTGTGGTTTTAGCTCCAGG - Intronic
1165323377 19:35099850-35099872 TGAGCTGTGCTGCCAGCACAGGG + Intergenic
1165846677 19:38822071-38822093 AGCACTCTGTTTCTAGCTCAAGG + Intronic
1165846719 19:38822549-38822571 AGCACTGTGTGTCTAGCTCAAGG + Intronic
1202636595 1_KI270706v1_random:49668-49690 AGAACTGTGGTTGTGGCTCAGGG - Intergenic
925019363 2:556574-556596 AGAGCTGTAGTTGTGGCTCACGG - Intergenic
925351715 2:3205724-3205746 AGAGCTGGGGTTCAAGCTCGGGG - Intronic
926332162 2:11834560-11834582 AGATCTTTGCTTCTAGTTGATGG - Intergenic
926397370 2:12457461-12457483 AGAGCTGGGCTTCCATCTAATGG + Intergenic
926685753 2:15696623-15696645 AGCACTCTGCATCTAGCTCAAGG - Intronic
928059017 2:28090625-28090647 ATAGGTATGCTTCTAGCTTAGGG + Intronic
928595966 2:32859042-32859064 AGCGCTCTGTTTCTAGCTAAAGG - Intergenic
928951301 2:36815497-36815519 AGCTCAGTGCTTCTAGATCACGG - Intergenic
931412037 2:62042150-62042172 AGCGCTGTGTGTCTAGCTAAAGG - Intronic
932251044 2:70244178-70244200 AGAGCCATGCTTCTATCTGAAGG - Intronic
932755602 2:74407114-74407136 AGACCTGTGCTTCTTGCCTATGG - Intergenic
935598605 2:104899431-104899453 AGAGCTGTGTTTCAGGCTTAAGG - Intergenic
937855448 2:126669366-126669388 AGGGCTGTGATTCAAGCCCAGGG + Intronic
938768456 2:134479759-134479781 AGAGCTGTGTCCCAAGCTCAGGG + Intronic
939053126 2:137331449-137331471 AGCACTCTGCATCTAGCTCAAGG - Intronic
939462423 2:142514014-142514036 AGAGCTGTGCTGCTATCTGGAGG + Intergenic
940763372 2:157762931-157762953 AGCGGTGTGGTTCTGGCTCAGGG - Intronic
943942815 2:194020686-194020708 AGTGCTCTGTATCTAGCTCAAGG + Intergenic
943947778 2:194090226-194090248 AGCACTGTGTGTCTAGCTCAGGG - Intergenic
945671330 2:212805855-212805877 ACAGTTTTGCTTCTAGCTAAGGG + Intergenic
948900967 2:240956733-240956755 AGGCCTGTGCCTCCAGCTCATGG + Intronic
1169809048 20:9590549-9590571 AGACCTGTGTATCTAGATCAGGG - Intronic
1170672975 20:18452186-18452208 AGAGCTGTGGTTCTCAATCATGG - Intronic
1171214744 20:23344250-23344272 CGAGCTGAGCTTCGAGCTGAGGG - Intergenic
1171300147 20:24052834-24052856 AGAGCTGTGCATCCACCGCAGGG - Intergenic
1171880723 20:30616083-30616105 AGAACTGTGGTTGTGGCTCAGGG - Intergenic
1174392635 20:50227204-50227226 AGAGCTGAGATTCAAGCCCAGGG - Intergenic
1175256851 20:57652849-57652871 AGAGCTGGGCTGCTCCCTCAGGG + Intronic
1175628068 20:60505838-60505860 AGAGCTGTGGGTCCAGCTCTGGG + Intergenic
1176671131 21:9736103-9736125 AGCGCTCTGTGTCTAGCTCAAGG + Intergenic
1176841974 21:13849358-13849380 AGAACTGTGGTTGTGGCTCAGGG - Intergenic
1177482107 21:21703952-21703974 AGATAAGTGCTTCTAGCTGAGGG + Intergenic
1177967945 21:27751749-27751771 AGCGCTCTGTGTCTAGCTCAAGG - Intergenic
1178381877 21:32116878-32116900 AGAGCTGAGCTCCATGCTCATGG + Intergenic
1180364275 22:11924645-11924667 AGAACTGTGGTTGTGGCTCAGGG + Intergenic
1180670904 22:17552162-17552184 AGAGCTGTTCTTCTTCCTCCAGG + Intronic
1182415502 22:30218556-30218578 AGAGCTGGGCTTCCAGCCCCAGG + Intergenic
1182798678 22:33012115-33012137 TGATCTGTGTTTCCAGCTCAAGG - Intronic
1184178266 22:42802043-42802065 GGAGCTGTGCTTCAAGCTGAGGG + Intronic
950238816 3:11349150-11349172 AGCGCTGTGTGTCTAGCTAAAGG - Intronic
950550169 3:13661480-13661502 AGAGCTGAGCTTCCATCTGATGG + Intergenic
951825865 3:26867564-26867586 AGAGCAGTGGTTCTCACTCAGGG + Intergenic
952713764 3:36457583-36457605 AGAATTGCTCTTCTAGCTCAAGG - Intronic
953089954 3:39714128-39714150 AGAACTTTGGATCTAGCTCAGGG + Intergenic
953096068 3:39778523-39778545 AGCACTGTGTGTCTAGCTCAAGG - Intergenic
953344541 3:42164491-42164513 AGCTCTGTGCTTCGAGCTGAGGG - Intronic
953393926 3:42551397-42551419 AGTGGTGTGATTATAGCTCATGG + Intronic
953866189 3:46585274-46585296 AGAGCAGAGGTGCTAGCTCAGGG - Intronic
955266319 3:57448735-57448757 AGAGCTTTGTATCTAGCTCAGGG - Intronic
955835057 3:63045345-63045367 AGAGCTTTGCTTCTGGTCCAGGG + Intergenic
956547487 3:70420359-70420381 AGAAATGTGCTGGTAGCTCATGG + Intergenic
956843336 3:73159562-73159584 AGTGCTCTGCGTCTAGCTAAAGG - Intergenic
959845398 3:111026946-111026968 AGAACTGTGCTTTTAGACCAGGG + Intergenic
960249417 3:115435866-115435888 AAAGCTGTGCTTCTTTCTTAGGG - Intergenic
960479660 3:118172272-118172294 AGCGCTCTGTGTCTAGCTCAGGG + Intergenic
961268904 3:125672464-125672486 AGAACTTTGTGTCTAGCTCAGGG + Intergenic
961347647 3:126274444-126274466 AGAGCTGTGAATCTTGCTGAAGG - Intergenic
961956926 3:130814438-130814460 AGTGCTCTGTGTCTAGCTCAAGG - Intergenic
962243960 3:133776019-133776041 CCAGCTCTGCTTCTAGCTCCTGG + Intronic
962605205 3:137027011-137027033 AGAAATGTGCTGCTTGCTCATGG + Intergenic
963856408 3:150258147-150258169 AGTGGTGTGATCCTAGCTCACGG - Intergenic
964874836 3:161355130-161355152 AGAGTAGGGCTTCTAGGTCAAGG + Intronic
965040387 3:163499550-163499572 AGCGCTCTGTCTCTAGCTCAAGG + Intergenic
965084901 3:164082929-164082951 AGAGCTGTGGTTCTAGATATAGG - Intergenic
965248486 3:166308747-166308769 AGAGCTATTTTTCTAGCTTATGG + Intergenic
966333796 3:178845554-178845576 AGAGCTCTGCTTCTAGCAGATGG - Intergenic
966425366 3:179775152-179775174 AGCACTCTGCATCTAGCTCAAGG - Intronic
971121549 4:23710394-23710416 AGAGCTGTCTGTCTTGCTCATGG + Intergenic
971479538 4:27102044-27102066 AGAGCTGGCCTGCTGGCTCAGGG - Intergenic
971878985 4:32342997-32343019 AAAGCTGTGCTTCTTTCTGAAGG - Intergenic
972939249 4:44177318-44177340 AGGGCTGTGCCTCTAGGTCCAGG - Intronic
973039842 4:45456832-45456854 AGCACTGTGTGTCTAGCTCAAGG - Intergenic
973163511 4:47048750-47048772 AGAGCTGGGTTTAAAGCTCAGGG + Intronic
973190199 4:47377709-47377731 AGAACTTTGTGTCTAGCTCAGGG - Intronic
973394203 4:49579396-49579418 AGAACTGTGGTTGTGGCTCAGGG + Intergenic
975027947 4:69576042-69576064 AGTGCTCTGTGTCTAGCTCAAGG - Intergenic
975377232 4:73659807-73659829 AGAGCAGTGTTACTAACTCAAGG + Intergenic
975704433 4:77098088-77098110 AGTGCTGTGATCTTAGCTCACGG + Intergenic
976406477 4:84665234-84665256 AGCACTCTGCATCTAGCTCAAGG + Intergenic
978466354 4:109013194-109013216 AGTGCTCTGTGTCTAGCTCAAGG + Intronic
978466363 4:109013313-109013335 AGCACTCTGTTTCTAGCTCAGGG + Intronic
978514703 4:109557970-109557992 AGTGCTCTGTGTCTAGCTCAGGG + Intergenic
978917872 4:114148254-114148276 AGCACTCTGCATCTAGCTCAAGG - Intergenic
979865185 4:125745013-125745035 AGGGCTGTGCGCCTTGCTCATGG + Intergenic
980760214 4:137223008-137223030 AGCGCTCTGTGTCTAGCTCAAGG + Intergenic
981105194 4:140873253-140873275 AGAGCTGTGCCATTAGCCCAAGG + Intronic
981730872 4:147896692-147896714 TGATCTGTGCTTCTAACTTAGGG - Intronic
981899245 4:149842981-149843003 AGAGCAGGCCTTCAAGCTCATGG - Intergenic
981901529 4:149870720-149870742 TGAGCTGTGCTTGTAACTAAGGG + Intergenic
982424170 4:155237290-155237312 AGTGCTCTGCGTCTAGCTAAAGG - Intergenic
982441335 4:155439895-155439917 AGTGCTCTGCATCTAGCTAAAGG + Intergenic
986929161 5:12796285-12796307 AGCGCTGTGTGTCTAGCTAAAGG + Intergenic
986963700 5:13244950-13244972 AGCACTGTGTGTCTAGCTCAAGG + Intergenic
987284581 5:16443131-16443153 AGATGTCTGCTTCTTGCTCATGG + Intergenic
987953093 5:24701805-24701827 AGATCTTTGCTTCAAGCCCAAGG + Intergenic
988593095 5:32566366-32566388 AGAGCTGTGGTTCTCAGTCAGGG + Intronic
989350231 5:40477730-40477752 AGAGCTGTGGTTCCAGCTGAGGG + Intergenic
990090255 5:52036701-52036723 AGAAATGTTCTTCTACCTCATGG - Intronic
990419063 5:55614000-55614022 AGTGCTCTGTGTCTAGCTCAAGG + Intergenic
993803445 5:92374727-92374749 AGCACTCTGCATCTAGCTCAAGG - Intergenic
994109047 5:95980255-95980277 AGATCTGTGCTTATAGTTCTTGG + Intergenic
994549823 5:101218278-101218300 TGATCTATGCTTCTATCTCAGGG + Intergenic
994570392 5:101506555-101506577 AGCACTGTGTGTCTAGCTCAGGG + Intergenic
995582740 5:113618113-113618135 AGCACTCTGCATCTAGCTCAGGG + Intergenic
996134580 5:119823930-119823952 AGAGCTGTGATTTTAGGCCACGG + Intergenic
996499541 5:124202112-124202134 AGAGCAGTGTTTCTAGTCCATGG + Intergenic
999104322 5:149056671-149056693 AGAGGTGCCCTTCTGGCTCATGG - Intronic
1000084844 5:157879926-157879948 AGTGCTCTGTGTCTAGCTCAGGG + Intergenic
1000212464 5:159119858-159119880 AGCACTCTGCGTCTAGCTCAGGG + Intergenic
1000547746 5:162622732-162622754 AGCACTGTGTGTCTAGCTCAGGG + Intergenic
1001086836 5:168706765-168706787 ATGGCTGTGCTTCTAGCAGATGG - Intronic
1001636553 5:173214078-173214100 AGTGCTCTGTGTCTAGCTCAAGG + Intergenic
1003517767 6:6832116-6832138 ACAGCTGGGCTTCTAACCCAAGG + Intergenic
1004608206 6:17213685-17213707 AGAGCTGTTCTTTTAGCAGAGGG - Intergenic
1005114162 6:22318065-22318087 AGCACTCTGCGTCTAGCTCAGGG - Intergenic
1005550793 6:26912548-26912570 CTAGCTGTGCTTGTAGCTAAGGG - Intergenic
1007796911 6:44356476-44356498 AGATCGGTGCCTCTGGCTCAAGG + Intronic
1008150688 6:47948091-47948113 GGAGCTGTGGTCTTAGCTCAAGG + Intronic
1011931930 6:92724405-92724427 AGTGCTCTGTGTCTAGCTCAGGG + Intergenic
1012598374 6:101066187-101066209 AGCACTCTGCGTCTAGCTCAGGG - Intergenic
1012789885 6:103679616-103679638 TTAGCTGTGCTTCTTGCTCCTGG - Intergenic
1013588374 6:111599253-111599275 TGAGCTGTGGTTCTAGCTCTTGG + Intronic
1013654946 6:112236889-112236911 AGAGCTATCTTTTTAGCTCAGGG + Intronic
1013673576 6:112432349-112432371 AGAGCTCTGCTTTCTGCTCATGG - Intergenic
1013977049 6:116091248-116091270 AGAGCTCTGTGTCTAGCTAAAGG + Intergenic
1016172824 6:141041056-141041078 AGTGCTCTGTGTCTAGCTCAAGG - Intergenic
1022458533 7:30581056-30581078 AGTGCTCTGCGTCTAGCTAAAGG - Intergenic
1022458537 7:30581187-30581209 AGTGCTCTGCATCTAGCTAAAGG - Intergenic
1022632987 7:32103048-32103070 GGACCTGTGCTTTTAGCCCAAGG - Intronic
1022664574 7:32398689-32398711 AGAACTGTGATCCTAGCTGAGGG + Intergenic
1023675453 7:42624596-42624618 AGAGCTGGGCTTATGGCTGATGG + Intergenic
1026379647 7:69786290-69786312 AGCGCTCTGCGTCTAGCTAAAGG + Intronic
1027590557 7:80113751-80113773 AGCGCTGTGTGTCTAGCTAAAGG + Intergenic
1027666016 7:81043514-81043536 AGCACTGTGTGTCTAGCTCAGGG + Intergenic
1028406431 7:90479998-90480020 GGACCTGGGCTTCTGGCTCATGG + Intronic
1028495643 7:91456734-91456756 AGAGCTCTGTGTCTAGCTAAAGG - Intergenic
1028719329 7:94011664-94011686 AGTGCTCTGTGTCTAGCTCAAGG - Intergenic
1028854589 7:95576505-95576527 AGAGATATGCTTCTATTTCAAGG + Intergenic
1029620053 7:101684765-101684787 AGAGCTGGCCTTCAAGGTCATGG - Intergenic
1030143803 7:106332311-106332333 TGGGTTGTTCTTCTAGCTCAGGG + Intergenic
1031253032 7:119413022-119413044 AGCACTCTGTTTCTAGCTCAAGG - Intergenic
1031732377 7:125314994-125315016 AGCGCTCTGCATCTAGCTAAAGG + Intergenic
1031957828 7:127960047-127960069 AGATCTGTTCTTCTAGCTGCTGG + Intronic
1032268413 7:130383905-130383927 AGACCTGTGCTCCTAGCCGAGGG + Intronic
1033394002 7:140956788-140956810 AGCACTCTGCATCTAGCTCAGGG - Intergenic
1033663975 7:143423957-143423979 AGAACTTTGTGTCTAGCTCAAGG - Intergenic
1033980786 7:147162882-147162904 GGAGCTTTGCTTCTCGCTCTTGG + Intronic
1034100245 7:148444737-148444759 AGTGCTCTGTGTCTAGCTCAAGG - Intergenic
1034100253 7:148444853-148444875 AGTGCTCTGTGTCTAGCTCAAGG - Intergenic
1035436388 7:158863254-158863276 AGCGCTCTGCGTCTAGCTAAAGG - Intronic
1035600171 8:892655-892677 GGAACTGTGCTTCCAGCACAGGG - Intergenic
1037287269 8:17314770-17314792 AGAGCTGTGCTTCTAGCTCAGGG - Intronic
1038106901 8:24445424-24445446 AGAGCTGTGCTACTATAGCAAGG - Intronic
1040743003 8:50603928-50603950 AGAGCACTGAGTCTAGCTCAAGG + Intronic
1043110193 8:76170098-76170120 AGCACTGTGTATCTAGCTCAAGG + Intergenic
1043838756 8:85076352-85076374 GGGCCTGAGCTTCTAGCTCATGG + Intergenic
1044677509 8:94744147-94744169 AGATTGGTGGTTCTAGCTCAGGG + Intronic
1044684435 8:94813346-94813368 AGAGCTGTGCATCCCGGTCATGG - Intronic
1045835678 8:106518824-106518846 ATAGATGTGGTTCTATCTCAAGG + Intronic
1047343640 8:124006317-124006339 AGTGCTGTCCTGCTGGCTCAAGG + Intronic
1048321983 8:133407151-133407173 AGAGCTGTGCTGCACGCTCTCGG - Intergenic
1048756186 8:137740787-137740809 AGCGCTCTGCGTCTAGCTAAAGG + Intergenic
1049373753 8:142279609-142279631 AGGGCTGCGGTTCCAGCTCAGGG - Intronic
1049827148 8:144676487-144676509 AGCACTGTGTGTCTAGCTCAAGG - Intergenic
1051979970 9:23001834-23001856 AGTTCTGTGCTTCTTTCTCATGG + Intergenic
1052014943 9:23452595-23452617 AGTGCTCTGTGTCTAGCTCAGGG + Intergenic
1052398360 9:27969800-27969822 AGATCTGAGCTACTAGATCAAGG + Intronic
1053495185 9:38544303-38544325 AGAATTGTGCTTGTGGCTCAGGG - Intronic
1055248491 9:74275773-74275795 AGAACTCTGTGTCTAGCTCAAGG - Intergenic
1055583377 9:77731491-77731513 AAGCCTGCGCTTCTAGCTCAGGG + Intronic
1058900388 9:109437493-109437515 AGAGCTGGCCTTCTTGGTCAGGG + Intronic
1059430135 9:114245030-114245052 AGAGCTCTGCCACCAGCTCACGG - Intronic
1059977109 9:119729253-119729275 AGATCTATGCTTCTTGCTAAAGG - Intergenic
1060018479 9:120107861-120107883 AGAGCTGAGCCTCTAACTCTTGG + Intergenic
1061486854 9:130924497-130924519 AGAGGTGGGCTTCTGGCTCAAGG + Intronic
1062660439 9:137628619-137628641 ACAGCTGTGCTTCTAGTTTACGG - Intronic
1203455206 Un_GL000219v1:160567-160589 ACAGATGTGCTTCTGCCTCAGGG + Intergenic
1203544662 Un_KI270743v1:120413-120435 AGAACTGTGGTTGTGGCTCAGGG - Intergenic
1187408814 X:19029050-19029072 AGAGGAGGCCTTCTAGCTCAGGG - Intronic
1189900622 X:45702383-45702405 AGAGCTCTGTGTCTAGCTAATGG - Intergenic
1190457527 X:50640430-50640452 AGAGCTGTGGTTCTGTCTAATGG - Intronic
1191766918 X:64707772-64707794 AGTGGTGTGATTATAGCTCATGG - Intergenic
1192486206 X:71529035-71529057 AGCGCTCTGTTTCTAGCTAAAGG - Intronic
1193264894 X:79456406-79456428 AGAGCTCTGTGTCTAGCTAAAGG + Intergenic
1194173395 X:90617590-90617612 AGCACTCTGTTTCTAGCTCAGGG - Intergenic
1195244378 X:102982449-102982471 AGAGCTGTGCTTCTTCCACTGGG - Intergenic
1195460185 X:105115585-105115607 AGCACTCTGCATCTAGCTCAAGG - Intronic
1196378438 X:115062150-115062172 AGCGCTCTGTTTCTAGCTAAAGG + Intergenic
1196419790 X:115509676-115509698 AGCGCTCTGTGTCTAGCTCAAGG - Intergenic
1197533677 X:127662680-127662702 AGAACTTTGTGTCTAGCTCAGGG - Intergenic
1200423449 Y:2997931-2997953 AGCACTCTGTTTCTAGCTCAAGG - Intergenic
1200967301 Y:9108978-9109000 TGAGCTGTGCTTCTCCCTCCAGG + Intergenic
1201429249 Y:13888302-13888324 AGCACTCTGCATCTAGCTCAAGG + Intergenic
1202100478 Y:21303136-21303158 AGCACTGTGTGTCTAGCTCAGGG - Intergenic