ID: 1037287270

View in Genome Browser
Species Human (GRCh38)
Location 8:17314771-17314793
Sequence CAGAGCTGTGCTTCTAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037287270_1037287272 3 Left 1037287270 8:17314771-17314793 CCTGAGCTAGAAGCACAGCTCTG 0: 1
1: 0
2: 6
3: 32
4: 327
Right 1037287272 8:17314797-17314819 ACCTGATATGCAGTCGGTGAAGG No data
1037287270_1037287274 4 Left 1037287270 8:17314771-17314793 CCTGAGCTAGAAGCACAGCTCTG 0: 1
1: 0
2: 6
3: 32
4: 327
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287270_1037287271 -3 Left 1037287270 8:17314771-17314793 CCTGAGCTAGAAGCACAGCTCTG 0: 1
1: 0
2: 6
3: 32
4: 327
Right 1037287271 8:17314791-17314813 CTGAAGACCTGATATGCAGTCGG No data
1037287270_1037287275 27 Left 1037287270 8:17314771-17314793 CCTGAGCTAGAAGCACAGCTCTG 0: 1
1: 0
2: 6
3: 32
4: 327
Right 1037287275 8:17314821-17314843 ACAGCCCTTTGAATTCGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037287270 Original CRISPR CAGAGCTGTGCTTCTAGCTC AGG (reversed) Intronic
900546519 1:3232282-3232304 CAGAGCTGGGATTCAAACTCAGG - Intronic
900874870 1:5334982-5335004 TACAGGTGGGCTTCTAGCTCTGG + Intergenic
900879117 1:5367830-5367852 CACAGCTGTGCTTCTTCCGCTGG - Intergenic
901328879 1:8389165-8389187 CAGAGCTGTGCTTCTAGATAAGG + Intronic
901910132 1:12450393-12450415 TAGAGCTGTGCTGGTAGCTGAGG + Intronic
902830028 1:19006480-19006502 CAGAGCTGGGCTTCAAACCCAGG + Intergenic
903624699 1:24722047-24722069 CAGAACCGTGTGTCTAGCTCAGG + Intergenic
905870232 1:41399365-41399387 CACAGCTGTGCTCATGGCTCTGG + Intergenic
906312000 1:44760778-44760800 CAGTGCTGAGCTTCCAGCCCAGG - Intronic
906717633 1:47981961-47981983 CAGAGCTGGGCCTCAAGCTGGGG + Intronic
906799272 1:48721729-48721751 CAGAGCTGTCTTTCCAGCACTGG + Intronic
910776905 1:90886136-90886158 CAGAACTGTGGTTCCAGGTCTGG + Intergenic
911542715 1:99177952-99177974 CAGAGCTGGGATTCAAACTCAGG - Intergenic
911854041 1:102854305-102854327 CAGTGCTCTGTGTCTAGCTCAGG + Intergenic
915242236 1:154531925-154531947 CAGCGCTCTGTGTCTAGCTCAGG - Intronic
915288236 1:154866470-154866492 CAGAGCTGGGATTCCAACTCTGG + Intronic
915531473 1:156504870-156504892 CAGAGTTGTGCCCCAAGCTCAGG + Intergenic
915732947 1:158067050-158067072 TAGAGCTGTCCTACTAGGTCTGG + Intronic
916962379 1:169902306-169902328 CAAAGCTGTGCTTCCAGCTCAGG + Intergenic
918190193 1:182166282-182166304 TAGAGCTGGAATTCTAGCTCAGG - Intergenic
918262450 1:182808063-182808085 CAGAGCTGGGCCTCTAACTCAGG - Intronic
918508576 1:185284976-185284998 CACAGCTGTATTCCTAGCTCAGG + Intronic
918912325 1:190590752-190590774 CTGAGCTGTACTTTTACCTCTGG + Intergenic
919057658 1:192591080-192591102 CAGAGCTGCCCTTCTAGCCTGGG + Intergenic
924169562 1:241323923-241323945 CAGAGCTGGGCTTCAGTCTCAGG - Intronic
1063087870 10:2835964-2835986 CAGAGCTGGGCTTCCAGAGCAGG - Intergenic
1063161397 10:3421353-3421375 AAGAGCTGGGCTTCGGGCTCAGG - Intergenic
1064651822 10:17517150-17517172 CAGAGCTGTGCTGCAATCTGGGG + Intergenic
1066104539 10:32145191-32145213 CATAGCTGTGTTCCTAGCCCAGG - Intergenic
1066457479 10:35584945-35584967 CAGGGCTTTGTCTCTAGCTCAGG + Intergenic
1068707361 10:60091666-60091688 CATTGCTGTGCATCTTGCTCAGG - Intronic
1068752792 10:60614736-60614758 CAGATGTTTGCTTCTAGATCTGG - Intronic
1069280742 10:66651298-66651320 CAGCACTCTGCTTCTAGCTCAGG - Intronic
1069868761 10:71520556-71520578 CAGTGCTGTGCCTCTGGCCCAGG - Intronic
1070391309 10:75973261-75973283 CAGAGCTGGGATTCAAACTCAGG + Intronic
1072305815 10:94106050-94106072 CAGAGCTGGGATTCAAACTCAGG + Intronic
1072338701 10:94424571-94424593 CTGTGCTGTGATACTAGCTCAGG + Intronic
1075664879 10:124223028-124223050 CAGAGCTGGGATTCAAGCCCAGG + Intergenic
1076117361 10:127909459-127909481 CAGAGGTGTGTTTCTAGGCCCGG + Intronic
1077298469 11:1836769-1836791 GGGAGCTGTGCTTCTCTCTCCGG + Exonic
1077896176 11:6455316-6455338 CAGAGCTAGGATTCAAGCTCAGG + Intronic
1078939435 11:15985454-15985476 CCCTGCTGTGCTTCTAGGTCTGG + Intronic
1079103388 11:17555536-17555558 CAGAGCTGGGATTCTAGCCCCGG - Intronic
1079400494 11:20102978-20103000 CAGTGCTGTGCTTTTACCCCAGG + Intronic
1079509769 11:21197283-21197305 CAGAGCTGAGATTTTAACTCAGG + Intronic
1080311051 11:30892763-30892785 CAGAGCTGGGATTCAAACTCAGG + Intronic
1080430206 11:32190871-32190893 CTGAGCTGTGCGTCTGGTTCTGG - Intergenic
1080819944 11:35796044-35796066 CAGAGCTGTGATTCAAACCCAGG + Intronic
1084951521 11:72668854-72668876 CAGAGCTGTGGTTGTGGCTACGG - Intronic
1084951532 11:72668909-72668931 CAGCCCTGAGCTCCTAGCTCTGG + Intronic
1086419270 11:86622250-86622272 CAGAGCTTTTGTTTTAGCTCTGG - Intronic
1087149865 11:94849629-94849651 CAGAGGGGAGCTTCAAGCTCAGG - Intronic
1088787598 11:113196696-113196718 CAGAGCTGAGATTCAAACTCAGG + Intronic
1089706643 11:120283003-120283025 GAGAGCTGTGCTCCTAGCTCTGG + Intronic
1090374817 11:126281290-126281312 CAGGGCTGTACTTCAAGCTGTGG + Intergenic
1090384746 11:126350945-126350967 GAGAGCTGAGCTTCTAGCGTGGG + Intergenic
1090405510 11:126473743-126473765 CAGAGCTCTGCTTCTGGGTCTGG - Intronic
1090917937 11:131182802-131182824 CAGAGCTGGGATTCAAACTCAGG - Intergenic
1091677708 12:2503451-2503473 CAGAGCTGTGCTTCCATCAGAGG - Intronic
1092029608 12:5273536-5273558 CGGAGCTGTGCTTCATGCCCTGG - Intergenic
1093865393 12:24221057-24221079 CAGAGCTGAGATTTTAACTCAGG + Intergenic
1093875530 12:24345056-24345078 CAGAGCTGTGCTTCTCAAACTGG + Intergenic
1095417507 12:41992636-41992658 CAGAGCTGTAATTCTAACCCAGG - Intergenic
1096915227 12:55024646-55024668 CTGAGCTGCACTTCTAACTCAGG - Intronic
1098504772 12:71236909-71236931 CAGAGCTGGGATTCCAACTCAGG + Intronic
1101155787 12:101926166-101926188 CAGAGCAGTGCTCCTTGCTGAGG - Intronic
1101346174 12:103888433-103888455 CAGTGCTCTGCTCCTAGGTCAGG + Intergenic
1101399882 12:104378126-104378148 CAGGACTGAGCTTCTAGCACAGG - Intergenic
1101545077 12:105704852-105704874 CAAAGCTGTGTTCATAGCTCAGG + Intergenic
1102145438 12:110651568-110651590 CACAGCTGTGTTTCCAGCACTGG - Intronic
1102222154 12:111201871-111201893 CAGAGCTGGGCTTTGAACTCTGG - Intronic
1103024755 12:117564323-117564345 CAGACCTGTGATTCAGGCTCAGG - Intronic
1103340688 12:120219690-120219712 GAGAGCTGTGCTCCCAGCACAGG + Intronic
1103597311 12:122031603-122031625 CAGAGCTGTGAATGGAGCTCAGG + Intronic
1104150390 12:126076369-126076391 CTGAGCTGTGCTTGAAGCTGGGG - Intergenic
1104373996 12:128247973-128247995 CAGCACTCTGCATCTAGCTCAGG + Intergenic
1104550134 12:129749258-129749280 TAGAGCTGTGCTATGAGCTCTGG - Intronic
1104635539 12:130436034-130436056 CAGGGCTGTGCTGCCACCTCAGG + Intronic
1105255971 13:18744335-18744357 CAGAACTGTGGTTGTGGCTCAGG - Intergenic
1105701431 13:22938345-22938367 CAGCGCTCTGTGTCTAGCTCAGG - Intergenic
1106903302 13:34378097-34378119 CAGAGCTGAGATTCTAGCTGTGG + Intergenic
1108543104 13:51462781-51462803 CAGAGCTGTGCAGATACCTCAGG + Intergenic
1109309895 13:60680177-60680199 CAAAGCTGCCTTTCTAGCTCAGG + Intergenic
1109506256 13:63306457-63306479 CAGCGCTCTGTGTCTAGCTCAGG + Intergenic
1109714213 13:66200092-66200114 CAGAGCTGTAATTCAAACTCGGG + Intergenic
1109884476 13:68524549-68524571 CAGTGCTCTGTGTCTAGCTCAGG + Intergenic
1112630786 13:101159349-101159371 CTGACCTGTGCTGCAAGCTCTGG - Intronic
1114049320 14:18908577-18908599 CAGAGCTATGATTCTAGAACTGG + Intergenic
1114113244 14:19493354-19493376 CAGAGCTATGATTCTAGAACTGG - Intergenic
1114271048 14:21100423-21100445 CAGAGCTAAGATTCCAGCTCAGG + Intronic
1114865093 14:26581141-26581163 CAGAGCTGGGATTCAAACTCTGG + Intronic
1115682011 14:35751143-35751165 CAGAGATATGCTTCTAACCCAGG + Intronic
1115934706 14:38538908-38538930 CAGAGCTGCGATTCAAGCCCTGG + Intergenic
1117086086 14:52202901-52202923 CAGAGCTGGGGTTCAAGGTCAGG - Intergenic
1119577642 14:75741720-75741742 CAGGTCTGTGCTTCTAGTTGGGG - Intronic
1120229657 14:81829182-81829204 CAGCACTCTGCATCTAGCTCAGG - Intergenic
1120655607 14:87186394-87186416 CAGAGCTCAGCTTCTATCCCAGG + Intergenic
1121020194 14:90575351-90575373 CAGAGCTGTGATTCTAACCCAGG + Intronic
1121285936 14:92735873-92735895 CAGACCCGTGGTTCTAGCACTGG - Intronic
1122045275 14:99018484-99018506 CTCAGGTGTGTTTCTAGCTCAGG + Intergenic
1122083680 14:99284827-99284849 GAGAGCTGCGCTTCCAGCCCCGG + Intergenic
1122564816 14:102645607-102645629 CAGAACTGTGCTACTGGCTTTGG - Intronic
1122787189 14:104169167-104169189 CAGAGCTGTGCCGAGAGCTCAGG + Intronic
1202836040 14_GL000009v2_random:77693-77715 CAGAACTGTGGTTGTGGCTCAGG + Intergenic
1123449654 15:20351770-20351792 CAGAGCTGTTCCTCCAGCTTTGG - Intergenic
1124653180 15:31487582-31487604 CAGAGCCGTGCTTGGAGCCCCGG + Intronic
1125299401 15:38238423-38238445 CAGAGCTCTGATTCAAACTCAGG - Intergenic
1127860138 15:62987206-62987228 TAGAGCTGAGCTTCCATCTCAGG - Intergenic
1127966536 15:63926828-63926850 GACTCCTGTGCTTCTAGCTCGGG - Intronic
1128617350 15:69120691-69120713 CAAAGCTGCGGTTCTACCTCAGG + Intergenic
1128668938 15:69559733-69559755 CAGAGCTGGGATTCTACCCCAGG + Intergenic
1133191892 16:4139978-4140000 CAGAGCTGGGATTCAATCTCAGG - Intergenic
1133247870 16:4461345-4461367 CAGAGCTGTTCTGCTAGCTGAGG + Intergenic
1134046775 16:11106950-11106972 CAGACCTGTGCTTCTTGGTGGGG + Intronic
1134635954 16:15792082-15792104 CAGAGTTTTGCTTCTTGCTCAGG + Intronic
1135027299 16:19008287-19008309 CAAAGCTTGGCTTCTAGCTCTGG + Intronic
1135272486 16:21081346-21081368 GAGAGCTGGGCTTGAAGCTCAGG + Intronic
1137431039 16:48417825-48417847 CAGAGCAGTTATTCAAGCTCAGG - Intronic
1137791539 16:51179104-51179126 CTGAGCTGTGCTTTTTCCTCTGG - Intergenic
1138122287 16:54410311-54410333 CAGAGCTGGGCTTCAGACTCAGG + Intergenic
1138818597 16:60231263-60231285 CTGAGCAATGCTTCTATCTCAGG - Intergenic
1139304825 16:65976149-65976171 CAGTGCTGTCTTTCTAGGTCTGG - Intergenic
1139618217 16:68114030-68114052 CAGAGCTGTGCAACCTGCTCAGG - Intronic
1140830016 16:78742352-78742374 CAGAGCCCCACTTCTAGCTCTGG + Intronic
1140860741 16:79015615-79015637 CAGTGGTGTGCTTCCAACTCTGG - Intronic
1142167080 16:88597835-88597857 CAGAGCTTTGCTTCCAGCCCTGG - Intronic
1142180934 16:88669736-88669758 CAGAGCTGTTCTTTAAACTCGGG - Intergenic
1142249704 16:88985737-88985759 CAGACATGTGCTCCGAGCTCAGG - Intergenic
1142345495 16:89551282-89551304 CAGTGCTGTGTTCCTACCTCAGG + Intronic
1144961595 17:19047248-19047270 CAAAGCTGTCCTGCTGGCTCAGG + Exonic
1144973565 17:19127276-19127298 CAAAGCTGTCCTGCTGGCTCAGG - Intergenic
1145783463 17:27578970-27578992 CAGAGCTGGGCTTTGAACTCAGG + Intronic
1145916445 17:28576822-28576844 CCGAGCTGTGCTTGTGGCTGCGG - Exonic
1146240872 17:31224006-31224028 CAGAGCTATGATTCTAGAACTGG - Intronic
1146993821 17:37299853-37299875 CCGAGCTGTGCTCCTCCCTCTGG - Intronic
1147497817 17:40934697-40934719 CAGAGGTGGGATTCTAACTCAGG - Intronic
1149455819 17:56787373-56787395 CTGTGCTGTGCTTCTTCCTCAGG - Intergenic
1152267548 17:79305093-79305115 CAGAGCTGTGCTTCCTGCCCTGG - Intronic
1153523455 18:5973777-5973799 CAGGGCTGTGATGCCAGCTCTGG - Intronic
1153614148 18:6918974-6918996 TAGAGTTCTGGTTCTAGCTCCGG - Intergenic
1154004984 18:10519461-10519483 CAGAGCTGACATTCTAGCACAGG - Intergenic
1154224147 18:12486562-12486584 CAGAGCTGAGGTTCAAACTCAGG - Intronic
1155611619 18:27673680-27673702 CAGCACTCTGCGTCTAGCTCAGG - Intergenic
1160533505 18:79578736-79578758 CAGGTCTGTGCTCCTAGCTGGGG + Intergenic
1160605213 18:80044938-80044960 TGGAGCTTTGCTTCCAGCTCAGG - Intronic
1162425424 19:10592520-10592542 CAGAGCTGGGATTTGAGCTCTGG + Intergenic
1162544020 19:11317370-11317392 CAGAGATGTGATTGTTGCTCAGG + Intronic
1163777028 19:19224826-19224848 CGCAGCTGTGCGTCCAGCTCCGG - Intronic
1163936148 19:20446018-20446040 CATAGTTGTGGTTATAGCTCTGG - Intergenic
1164555037 19:29244864-29244886 CAGAGCTTGGCTTCTCCCTCTGG + Intergenic
1165356182 19:35305540-35305562 CAGAGCTGGGATTCTAGCCCAGG - Intronic
1165844897 19:38812121-38812143 CAGAGCTGGGATTTTAACTCGGG + Intronic
1166127187 19:40722203-40722225 CAGCGCTGGGGTTCTAGCTCTGG - Intronic
1167678233 19:50902571-50902593 CATAGGTCTGCTTCTGGCTCTGG + Intergenic
1167755096 19:51407804-51407826 CAGAGCTGGGATTCAAACTCAGG - Intergenic
1168659981 19:58157872-58157894 CAGCACTGTGTGTCTAGCTCAGG + Intergenic
1202636596 1_KI270706v1_random:49669-49691 CAGAACTGTGGTTGTGGCTCAGG - Intergenic
925351716 2:3205725-3205747 CAGAGCTGGGGTTCAAGCTCGGG - Intronic
925459137 2:4044706-4044728 CACAGCTGGGCTTGTAGCTCAGG - Intergenic
925479750 2:4256791-4256813 CAGTTCTGTGCTTCCTGCTCAGG + Intergenic
926118048 2:10225644-10225666 CATTCCTGTGCTTCTGGCTCAGG - Intergenic
928059016 2:28090624-28090646 CATAGGTATGCTTCTAGCTTAGG + Intronic
928213212 2:29339377-29339399 CTCAGCTCTGCTTCTAGATCAGG - Intronic
928355702 2:30612808-30612830 CTGAGCTGAGCTTCTGTCTCTGG - Intronic
929142555 2:38678940-38678962 CAGAGCTGGGGTTCAAACTCAGG - Intronic
930093095 2:47545595-47545617 CAGAGCTGAGATTCTAGCCCAGG - Intronic
931467989 2:62508467-62508489 CTGAGCTGTGCTTCTTGATGAGG - Intronic
931788018 2:65639138-65639160 CAGAGCTGGGATTCAAACTCAGG + Intergenic
931974829 2:67631753-67631775 CAGAGCTCTGGTTATAGCTGAGG + Intergenic
932396125 2:71449674-71449696 CAGAACTGTGCTTCATGCTCAGG + Intergenic
934159503 2:89234956-89234978 TAGAGCTGAGCTTTTATCTCAGG + Intergenic
934207775 2:89947475-89947497 TAGAGCTGAGCTTTTATCTCAGG - Intergenic
934762291 2:96863370-96863392 CTGTGCTGTGGTTCTGGCTCTGG - Intronic
935688764 2:105711669-105711691 CAGGGCTGGGATTCTAGCCCAGG + Intergenic
937105875 2:119312189-119312211 CAGAGCTGAGCTTCCAGCTCTGG + Intronic
937608107 2:123826584-123826606 CAGCACTCTGCGTCTAGCTCGGG - Intergenic
937855447 2:126669365-126669387 CAGGGCTGTGATTCAAGCCCAGG + Intronic
938426661 2:131196906-131196928 CAGAGCTATGATTCTAGAACTGG + Intronic
938768455 2:134479758-134479780 CAGAGCTGTGTCCCAAGCTCAGG + Intronic
941768164 2:169321688-169321710 CAGAGATGAGCTTATAGATCTGG - Intronic
942176575 2:173340249-173340271 CAGAGCTACTTTTCTAGCTCAGG - Intergenic
942233875 2:173885397-173885419 CAGAGCTGGGCATGTATCTCAGG + Intergenic
942508530 2:176670364-176670386 CATAGCTTTGTTCCTAGCTCCGG + Intergenic
942881262 2:180863830-180863852 AAAAGCTGTGCTTATAACTCTGG + Intergenic
943947779 2:194090227-194090249 CAGCACTGTGTGTCTAGCTCAGG - Intergenic
947655954 2:231827238-231827260 CAGAGCAGAGTTTCTAACTCTGG - Intergenic
947657506 2:231840234-231840256 CAGAGCAGAGTTTCTAACTCTGG - Intergenic
947657562 2:231840719-231840741 CAGAGCAGTGTTTCTCACTCTGG - Intergenic
1168937725 20:1681343-1681365 CAGAGCTATGATTTGAGCTCAGG - Intergenic
1169726519 20:8739660-8739682 CATAGCTGTGCTTCAGGTTCTGG + Intronic
1171880724 20:30616084-30616106 CAGAACTGTGGTTGTGGCTCAGG - Intergenic
1172303474 20:33865550-33865572 CAGAGCCGGGATTCTAGCTCAGG - Intergenic
1172676595 20:36677073-36677095 CAGACCTGGGCCTCTGGCTCCGG + Intronic
1172698033 20:36835665-36835687 CAGAGGTGTCCATCCAGCTCAGG + Intronic
1173613848 20:44390121-44390143 AAAAGCTGAGCTTCAAGCTCAGG + Intronic
1174214382 20:48904788-48904810 CATTGCTGTGCTTCCAGCCCCGG - Intergenic
1174392636 20:50227205-50227227 CAGAGCTGAGATTCAAGCCCAGG - Intergenic
1175209059 20:57337464-57337486 CAGAGCTGAGATGCGAGCTCAGG + Intronic
1175335712 20:58194596-58194618 CCCAGCTGTGCCTCTAGCCCAGG + Intergenic
1175628067 20:60505837-60505859 CAGAGCTGTGGGTCCAGCTCTGG + Intergenic
1176841975 21:13849359-13849381 CAGAACTGTGGTTGTGGCTCAGG - Intergenic
1177367773 21:20159651-20159673 CAGAGTTGTTCTTTTTGCTCAGG - Intergenic
1177618587 21:23557379-23557401 CAGTGCTGTACTAGTAGCTCAGG - Intergenic
1178032858 21:28547641-28547663 CAGAGCTGTGATTAGATCTCAGG - Intergenic
1178204322 21:30445422-30445444 CAGAGCTTTTCTTCTAGATCAGG + Intergenic
1178624752 21:34205160-34205182 CAGCCCTGTGCTTCCAGCTCTGG + Intergenic
1180364274 22:11924644-11924666 CAGAACTGTGGTTGTGGCTCAGG + Intergenic
1180467801 22:15630950-15630972 CAGAGCTATGATTCTAGAACTGG + Intergenic
1181306415 22:21919810-21919832 CAGAGCTGTCCTCCCAGCCCTGG + Exonic
1181793793 22:25288566-25288588 CAGAGCTGTTCTACAAGCCCAGG - Intergenic
1181833790 22:25585108-25585130 CAGAGCTGTTCTACAAGCCCAGG - Intronic
1183028563 22:35084828-35084850 CAGAGCTGGGATTCGAACTCAGG - Intronic
1183708707 22:39490136-39490158 CAGAGCTGCCCTACCAGCTCTGG - Exonic
1184178265 22:42802042-42802064 GGGAGCTGTGCTTCAAGCTGAGG + Intronic
1184205523 22:43000053-43000075 CAGAGCTGGGATTCAAGCCCAGG + Intronic
1184965920 22:47972219-47972241 CAGAGCTGTGCTCATTTCTCTGG + Intergenic
950528636 3:13539759-13539781 CAGAGCTGGGCTTCAAACCCAGG + Intergenic
951825864 3:26867563-26867585 CAGAGCAGTGGTTCTCACTCAGG + Intergenic
952298484 3:32083278-32083300 CAGAGCTGCCATTCTTGCTCTGG - Intergenic
953344542 3:42164492-42164514 CAGCTCTGTGCTTCGAGCTGAGG - Intronic
955266320 3:57448736-57448758 GAGAGCTTTGTATCTAGCTCAGG - Intronic
955793551 3:62611950-62611972 CAGAGCTTGGCTTCTAGTTGGGG - Intronic
955835056 3:63045344-63045366 CAGAGCTTTGCTTCTGGTCCAGG + Intergenic
956655801 3:71548994-71549016 CAGAGCTGGGATTCAAACTCAGG + Intronic
956880063 3:73501264-73501286 CAGAGAGATGCCTCTAGCTCAGG - Intronic
959706900 3:109346592-109346614 CATGGCTGTGCTTCAAGCTCAGG - Intergenic
959845397 3:111026945-111026967 CAGAACTGTGCTTTTAGACCAGG + Intergenic
960479659 3:118172271-118172293 CAGCGCTCTGTGTCTAGCTCAGG + Intergenic
961386606 3:126526505-126526527 CAGTGCTGGGCCTCTTGCTCTGG - Intronic
964090133 3:152866113-152866135 CAGAGCTGGGATTCTAACCCAGG - Intergenic
965744118 3:171906890-171906912 CAGCACTGTGTGTCTAGCTCTGG - Intronic
966186040 3:177228313-177228335 CAGAACTCTGTGTCTAGCTCAGG - Intergenic
966236264 3:177705040-177705062 CAGTGATGTGCTTGTATCTCAGG - Intergenic
966428475 3:179806841-179806863 CAGAGCTGTGATTTTAACACAGG + Intronic
967831095 3:193920860-193920882 CAGAGCTGGGATTCAAGCCCAGG + Intergenic
968329355 3:197852261-197852283 CTGAGATTTGCTTCTAGCTAAGG + Intronic
969489664 4:7491866-7491888 CAGGGCTGTGCTCCCAGCTGTGG + Intronic
969513886 4:7635735-7635757 CAGAGCTGTGCTTCTTGGTGTGG - Intronic
970541420 4:17083700-17083722 AAGAGCTGTGTATCTGGCTCTGG + Intergenic
972712484 4:41611567-41611589 CAAAGCTGTGATTCTAACACAGG - Intronic
973163510 4:47048749-47048771 CAGAGCTGGGTTTAAAGCTCAGG + Intronic
973366407 4:49213039-49213061 CAGAACTGTGGTTGTGGCTCGGG - Intergenic
973394202 4:49579395-49579417 CAGAACTGTGGTTGTGGCTCAGG + Intergenic
973701403 4:53540654-53540676 CAGAGCTTTGCTTGTTGCCCAGG - Intronic
973872947 4:55185067-55185089 CAGAGCAGAGATTTTAGCTCAGG + Intergenic
974085024 4:57251004-57251026 CAGAGCTGAGACTCTAACTCAGG - Intergenic
977708378 4:100096734-100096756 CAGAGCTCTCCTTTTTGCTCTGG + Intergenic
978466362 4:109013312-109013334 CAGCACTCTGTTTCTAGCTCAGG + Intronic
978514702 4:109557969-109557991 CAGTGCTCTGTGTCTAGCTCAGG + Intergenic
978560183 4:110024837-110024859 CAAAGAAGTGCTTCTAGCTTGGG + Intergenic
978575398 4:110184886-110184908 CAGAGCAGTGCTTCTCCCTAGGG + Intronic
979033131 4:115678338-115678360 CAGAACTCTGTGTCTAGCTCCGG - Intergenic
981055395 4:140355472-140355494 CAGAGCTGGGATTCAAGCCCAGG + Intronic
981901528 4:149870719-149870741 CTGAGCTGTGCTTGTAACTAAGG + Intergenic
984241233 4:177221983-177222005 CTGAGCTGTGATTTTAACTCAGG + Intergenic
986857110 5:11882749-11882771 CAGCTCTGTTCTTCTTGCTCAGG + Intronic
988241195 5:28611342-28611364 CAGAGCTGTCCTATTAGCTTGGG - Intergenic
988593094 5:32566365-32566387 CAGAGCTGTGGTTCTCAGTCAGG + Intronic
989350230 5:40477729-40477751 GAGAGCTGTGGTTCCAGCTGAGG + Intergenic
989760492 5:45010118-45010140 CAGCGCTCTGTGTCTAGCTCTGG - Intergenic
991009506 5:61868297-61868319 CACAGCTCTGCTTCAAGCTGCGG + Intergenic
991952128 5:71956605-71956627 CAGAGCTGTGCCTCTTGGTGGGG - Intergenic
991986772 5:72296400-72296422 CAGAGCTGTTTCTCAAGCTCAGG - Intronic
992344691 5:75865010-75865032 CAGTGCTGTGATTCTCCCTCTGG - Intergenic
992465159 5:76997002-76997024 CAGAGCTGGGCTTTCAACTCAGG + Intergenic
992802894 5:80309825-80309847 CAGCACTCTGCGTCTAGCTCGGG - Intergenic
994338402 5:98597127-98597149 GAGGACTGTCCTTCTAGCTCAGG + Intergenic
994570391 5:101506554-101506576 CAGCACTGTGTGTCTAGCTCAGG + Intergenic
995355790 5:111236505-111236527 CAGAGCTGAGATTCAAGCCCTGG + Intronic
995582739 5:113618112-113618134 CAGCACTCTGCATCTAGCTCAGG + Intergenic
996624619 5:125555562-125555584 CAGAACTTTGCTTCTATGTCCGG + Intergenic
997854764 5:137363504-137363526 CAGAGCTGTGATTCCAGTCCAGG - Intronic
998526408 5:142847039-142847061 CAGAGCTGAGATTCTCACTCTGG - Intronic
998911260 5:146962810-146962832 CAGAGCTGGGACTCTAACTCAGG + Intronic
999265203 5:150262468-150262490 CAGAGCTGAGCATCCAGCACAGG - Intronic
999848764 5:155514731-155514753 CAGAGGTGAGCTTCTTGCTAAGG - Intergenic
1000084843 5:157879925-157879947 CAGTGCTCTGTGTCTAGCTCAGG + Intergenic
1000212463 5:159119857-159119879 CAGCACTCTGCGTCTAGCTCAGG + Intergenic
1000248452 5:159469969-159469991 CAAAGCTGTGCTTCCCGCGCCGG + Intergenic
1000547745 5:162622731-162622753 CAGCACTGTGTGTCTAGCTCAGG + Intergenic
1001118644 5:168960530-168960552 CAGAGCTGGGATTCAAACTCAGG + Intronic
1001410805 5:171509944-171509966 CAGAGCTGTGCTTCTCAAACTGG + Intergenic
1001977844 5:176014856-176014878 GAGAGTTGTGCTTCCAGATCTGG + Intronic
1002239576 5:177828906-177828928 GAGAGTTGTGCTTCCAGATCTGG - Intergenic
1002873904 6:1193409-1193431 CAGAGCTGGGGTTCTAGCTCAGG - Intergenic
1005844156 6:29764548-29764570 CAGAGCTTTGGTTCTAGTTCAGG - Intergenic
1005862110 6:29909679-29909701 CAGAGCTTTGGTTCTAGTTCAGG - Intergenic
1005983282 6:30853877-30853899 CAGAGCTGTGCCCACAGCTCTGG + Intergenic
1006067552 6:31472957-31472979 CGGAGCTTTGGTTCTAGTTCAGG + Intergenic
1011329612 6:86189032-86189054 GAATGCTGTGCTTCTAACTCTGG + Intergenic
1011931929 6:92724404-92724426 CAGTGCTCTGTGTCTAGCTCAGG + Intergenic
1011983069 6:93409558-93409580 AAAACCTGTGCTTCTGGCTCTGG + Intronic
1012598375 6:101066188-101066210 CAGCACTCTGCGTCTAGCTCAGG - Intergenic
1015158256 6:130122786-130122808 CCTAGCTGTGCGGCTAGCTCTGG + Intronic
1016379457 6:143459921-143459943 CAGGACTATGTTTCTAGCTCTGG - Intronic
1018434177 6:163746301-163746323 CAGAGCTAAGGTTCTAGCCCAGG - Intergenic
1019055681 6:169221566-169221588 CAGAGCTGTGGTTAAGGCTCCGG - Intronic
1022110745 7:27229668-27229690 CAGAGCTGAGGTTCAAGCTCAGG + Intergenic
1022535669 7:31096708-31096730 GTGAGCTGTGCTGCTAGCTGGGG + Intronic
1022664573 7:32398688-32398710 CAGAACTGTGATCCTAGCTGAGG + Intergenic
1023325149 7:39046521-39046543 CAGAGCTTTTCTTCTAGATCAGG + Intronic
1024199444 7:47090893-47090915 CAGAGCTGGGATTTCAGCTCCGG - Intergenic
1025001048 7:55315025-55315047 CAGGGCTCTGCTTCTGGCTGAGG - Intergenic
1026129820 7:67610978-67611000 CAGAGCTGTCCATCTGGCTGTGG - Intergenic
1027666015 7:81043513-81043535 CAGCACTGTGTGTCTAGCTCAGG + Intergenic
1028902028 7:96112619-96112641 AAGAGAGCTGCTTCTAGCTCTGG - Intergenic
1030143802 7:106332310-106332332 CTGGGTTGTTCTTCTAGCTCAGG + Intergenic
1031256634 7:119459692-119459714 CAGAGCTGTGCTTAGAAATCAGG + Intergenic
1032268412 7:130383904-130383926 CAGACCTGTGCTCCTAGCCGAGG + Intronic
1033394003 7:140956789-140956811 CAGCACTCTGCATCTAGCTCAGG - Intergenic
1035600172 8:892656-892678 CGGAACTGTGCTTCCAGCACAGG - Intergenic
1035625300 8:1066785-1066807 CAAAGCTGTGCTTGTAGGGCAGG + Intergenic
1036408884 8:8479927-8479949 CAGATGTCTGCTTCTAGCTCTGG + Intergenic
1037287270 8:17314771-17314793 CAGAGCTGTGCTTCTAGCTCAGG - Intronic
1037585149 8:20270928-20270950 CTGAGCTGTGCTTCCTGCTGGGG - Intronic
1037685865 8:21138974-21138996 CTGAGCTGTGCCTCTAGCCAAGG - Intergenic
1039136166 8:34325063-34325085 TAGATCTCTGCTTCAAGCTCTGG + Intergenic
1041291398 8:56311583-56311605 CAGGACTGTGCTTTTAGCGCTGG + Intronic
1041429046 8:57758315-57758337 CAGAGCTGGGCTTCGACCCCAGG - Intergenic
1042999039 8:74734687-74734709 CAGAGCTGCTGTTGTAGCTCTGG - Intronic
1043764860 8:84118555-84118577 CAGAGCTGTGCTGGTGGCTGTGG + Intergenic
1045127603 8:99109738-99109760 CAGAGCTGTAATTCAAACTCTGG - Intronic
1046058678 8:109109859-109109881 CAGAGCTCTGCTTCTCACTCTGG - Intronic
1047036890 8:120949756-120949778 CAGAGCTGGGATTCTGGCTCAGG + Intergenic
1047228849 8:122979048-122979070 TAGAGCTGTGATTCAAACTCAGG - Intergenic
1049119599 8:140722664-140722686 CAGGGATGTGCTTCTCTCTCAGG - Intronic
1049817116 8:144610378-144610400 CTGAACTCTGCTTCTAGCTTAGG - Intergenic
1051486952 9:17619183-17619205 CAGAGCTGGGCTTTGAACTCTGG + Intronic
1052014942 9:23452594-23452616 CAGTGCTCTGTGTCTAGCTCAGG + Intergenic
1052026882 9:23583194-23583216 TAGAGCTGTATTTCTAACTCAGG + Intergenic
1053495186 9:38544304-38544326 CAGAATTGTGCTTGTGGCTCAGG - Intronic
1054728199 9:68674015-68674037 CAGAGCTGTGATTTCAACTCAGG - Intergenic
1055765798 9:79662619-79662641 CAGACATCTGCTTCTAGTTCAGG - Intronic
1056596728 9:88013792-88013814 TAGAGCTGTGCTGCCAACTCAGG - Intergenic
1057274312 9:93668292-93668314 CAGAGATGTGCTTGTGGCTGGGG + Intronic
1057833478 9:98425740-98425762 CAGAGCTGGGATCCGAGCTCAGG + Intronic
1058524213 9:105840773-105840795 CAGAGCTGGGCCTTTAGCCCTGG + Intergenic
1058876763 9:109251481-109251503 CAGAGCTGGGCTGCTATCACTGG + Exonic
1059386314 9:113967584-113967606 CAGACCTGAGCTTATAGCTGTGG + Intronic
1059566212 9:115385486-115385508 CAGACCTGGGCTTTTGGCTCCGG + Intronic
1059683151 9:116605900-116605922 CAGAGCCCTAGTTCTAGCTCTGG + Intronic
1060436734 9:123599643-123599665 CAGAGCTGGGATTCAAACTCAGG + Intronic
1060770912 9:126331724-126331746 CAGAGCTGGAATTCAAGCTCGGG + Intronic
1061087950 9:128410105-128410127 CAGAGCTGGGATTCTAGCCCAGG + Intergenic
1061695292 9:132368874-132368896 CAGAGCTATGTGTCTGGCTCTGG + Intergenic
1061952462 9:133944019-133944041 CAGACCTGGGCTCCTGGCTCTGG - Intronic
1062001923 9:134220457-134220479 CAGGGCTAGGCTTCTAACTCAGG + Intergenic
1203544663 Un_KI270743v1:120414-120436 CAGAACTGTGGTTGTGGCTCAGG - Intergenic
1185546812 X:952777-952799 CAGAGCTGTGTTTCTATGACCGG + Intergenic
1189084721 X:38010047-38010069 CAGAGCTGAGATTCAAACTCAGG - Intronic
1189121554 X:38400576-38400598 CAGAGCTGCGCTACTGGCTGAGG - Intronic
1189225145 X:39406639-39406661 CAGAGTTGTGCTGCCAGCTGAGG + Intergenic
1189291001 X:39886144-39886166 CAGAGCAGTCATTCCAGCTCTGG + Intergenic
1189402694 X:40687088-40687110 CAGAGATGTGTTTCAAGCTCAGG - Intronic
1190737097 X:53262795-53262817 CAAAGCTGGGATTCAAGCTCAGG - Intronic
1190875007 X:54453494-54453516 CAGAGCTGAGATTGGAGCTCAGG - Intronic
1193756674 X:85418025-85418047 CAGTGCTGTGCTGCTGGCTTTGG - Intergenic
1193947731 X:87759012-87759034 CAGCTCTGTTCTTCTAGCTTAGG + Intergenic
1194173396 X:90617591-90617613 CAGCACTCTGTTTCTAGCTCAGG - Intergenic
1195043762 X:101037656-101037678 CAGAGCTGAGATTCACGCTCAGG - Intronic
1195239241 X:102934799-102934821 CAGAGCTGCGTTTCTGTCTCTGG + Intergenic
1195244379 X:102982450-102982472 TAGAGCTGTGCTTCTTCCACTGG - Intergenic
1195549984 X:106157386-106157408 CAGCAGTGTGCTCCTAGCTCTGG + Intergenic
1199721485 X:150545888-150545910 CAGAGCTGGGGTTGGAGCTCAGG - Intergenic
1200106760 X:153718418-153718440 CAGAGCTGTGCTACCAGCTCAGG + Intronic
1202100479 Y:21303137-21303159 CAGCACTGTGTGTCTAGCTCAGG - Intergenic