ID: 1037287274

View in Genome Browser
Species Human (GRCh38)
Location 8:17314798-17314820
Sequence CCTGATATGCAGTCGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037287269_1037287274 5 Left 1037287269 8:17314770-17314792 CCCTGAGCTAGAAGCACAGCTCT 0: 1
1: 0
2: 1
3: 14
4: 320
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287268_1037287274 9 Left 1037287268 8:17314766-17314788 CCTGCCCTGAGCTAGAAGCACAG 0: 1
1: 0
2: 4
3: 20
4: 222
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287266_1037287274 20 Left 1037287266 8:17314755-17314777 CCTTCCAAATGCCTGCCCTGAGC 0: 1
1: 0
2: 2
3: 32
4: 248
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287265_1037287274 30 Left 1037287265 8:17314745-17314767 CCAAAATCTTCCTTCCAAATGCC 0: 1
1: 0
2: 2
3: 33
4: 291
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287267_1037287274 16 Left 1037287267 8:17314759-17314781 CCAAATGCCTGCCCTGAGCTAGA 0: 1
1: 0
2: 2
3: 13
4: 201
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data
1037287270_1037287274 4 Left 1037287270 8:17314771-17314793 CCTGAGCTAGAAGCACAGCTCTG 0: 1
1: 0
2: 6
3: 32
4: 327
Right 1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037287274 Original CRISPR CCTGATATGCAGTCGGTGAA GGG Intronic
No off target data available for this crispr