ID: 1037290781

View in Genome Browser
Species Human (GRCh38)
Location 8:17347485-17347507
Sequence CTACAGCCGGGGGGTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037290781_1037290789 -9 Left 1037290781 8:17347485-17347507 CCTGCTCTACCCCCCGGCTGTAG 0: 1
1: 0
2: 2
3: 12
4: 196
Right 1037290789 8:17347499-17347521 CGGCTGTAGGTGCAGGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037290781 Original CRISPR CTACAGCCGGGGGGTAGAGC AGG (reversed) Intronic
900013762 1:135796-135818 ATGCAGCCGGGAGGAAGAGCTGG + Intergenic
900043832 1:491779-491801 ATGCAGCCGGGAGGAAGAGCTGG + Intergenic
900065269 1:726782-726804 ATGCAGCCGGGAGGAAGAGCTGG + Intergenic
900210023 1:1450827-1450849 CTACTGCCGGTGGGTAGGGCCGG + Intronic
900220081 1:1503730-1503752 CTACTGCCGGTGGGTAGGGCTGG + Intergenic
900222384 1:1516157-1516179 CTACTGCCGGTGGGTAGGGCCGG + Intronic
900288350 1:1912888-1912910 CTCCAGCCTGGAGATAGAGCGGG + Intergenic
900305309 1:2003872-2003894 CTCCAGCCGGGGAGCAGAACGGG - Intergenic
905268484 1:36771231-36771253 CTACAGGCTGGGGGTGGAGCTGG + Intergenic
907422976 1:54359604-54359626 CTACAGCCGGGAAGAAGAGTAGG - Intronic
908599117 1:65719697-65719719 CTGCTGCCAGGGGATAGAGCAGG + Intergenic
910074468 1:83261135-83261157 CTACACATGGGTGGTAGAGCCGG - Intergenic
910511648 1:88013269-88013291 CTACATGCTGGGGGTAGAGCAGG - Intergenic
910951534 1:92653538-92653560 CTACAGCAGTGGGGTTGAGGAGG - Intronic
913660744 1:121004576-121004598 CTTCAGCCTGGTGGAAGAGCAGG + Intergenic
913670583 1:121094377-121094399 CCACAGCCGGGGGGTGAAGTGGG - Intronic
914012107 1:143787732-143787754 CTTCAGCCTGGTGGAAGAGCAGG + Intergenic
914022349 1:143881816-143881838 CCACAGCCGGGGGGTGAAGTGGG - Intergenic
914165724 1:145173402-145173424 CTTCAGCCTGGTGGAAGAGCAGG - Intergenic
914650738 1:149696395-149696417 CTTCAGCCTGGTGGAAGAGCAGG + Intergenic
914660832 1:149789757-149789779 CCACAGCCGGGGGGTGAAGTGGG - Intronic
916013650 1:160728830-160728852 CTACAGCCTGGAGACAGAGCAGG + Intergenic
917930221 1:179817721-179817743 CTGCAGCTTGGGGGTACAGCAGG + Intergenic
918666282 1:187154942-187154964 CTACAGCCTGGAGCTAGAGGAGG + Intergenic
921264592 1:213411769-213411791 CTACAGCCTGGGCTTAGAGGTGG + Intergenic
923572108 1:235125779-235125801 CTCCAGCCTGGGGACAGAGCGGG - Intronic
924306391 1:242693258-242693280 CTACAGCCCTGAGATAGAGCAGG - Intergenic
1070303031 10:75218728-75218750 CTCCAGCCTGGCGATAGAGCGGG + Intronic
1075565089 10:123497437-123497459 TTACAGCCAGGGGGTGGGGCAGG + Intergenic
1076918445 10:133438873-133438895 CTAGAGACGGTGGGAAGAGCAGG - Intergenic
1076970106 11:128010-128032 ATGCAGCCGGGAGGAAGAGCTGG + Intergenic
1080891062 11:36409587-36409609 CCACAGTAGGGGGGAAGAGCTGG + Intronic
1082260528 11:50073804-50073826 ACACAGCCGGGAGGAAGAGCTGG + Intergenic
1091896110 12:4106464-4106486 CTGCAGCTGGGGGGTCGGGCTGG - Intergenic
1092488015 12:8919559-8919581 CTCCAGCCTGGTGATAGAGCAGG + Intronic
1092875119 12:12841324-12841346 CTCCAGCCTAGGGATAGAGCAGG - Intergenic
1096702834 12:53397615-53397637 CTCCAGCCTGGGCGAAGAGCAGG - Intronic
1100040758 12:90314223-90314245 CTTCAGCCAGGGGGCACAGCAGG + Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1104719708 12:131038539-131038561 CTACAGTCGGGGGGCAGACATGG + Intronic
1118210922 14:63765041-63765063 CTACAGCCAGGGGGTCAAGGAGG + Intergenic
1121542007 14:94735202-94735224 CTCCAGCCTGGGTGCAGAGCAGG - Intergenic
1124719133 15:32097074-32097096 CTACAGCAGGTGGGAAGAGGAGG - Intronic
1125514336 15:40309348-40309370 CTAGGGCCGGGGGATGGAGCCGG + Intergenic
1125674230 15:41493981-41494003 CTGCAGCCCGGGGCTGGAGCGGG + Exonic
1128972277 15:72118110-72118132 CTGCAGCCGGGGAGTCGCGCGGG - Intronic
1132571554 16:646586-646608 CTACAGCCGGAGGTGGGAGCCGG - Intronic
1133811289 16:9162919-9162941 CCACAGCCCTGGGGGAGAGCTGG + Intergenic
1142450571 16:90171122-90171144 ATGCAGCCGGGAGGAAGAGCTGG - Intergenic
1142593333 17:1017359-1017381 CTACTGCTGGGGGACAGAGCTGG - Intronic
1146302982 17:31705852-31705874 CTCCAGCCTGGGGGTGGGGCTGG - Intergenic
1147995686 17:44359178-44359200 CAAAAGCCTGGGGGTAGACCAGG + Intronic
1148049679 17:44763558-44763580 CTGCAGCCGAGGGGTGGTGCAGG + Intronic
1148090011 17:45017873-45017895 GGACAGCTGGGGGGTAGTGCTGG + Intergenic
1149556198 17:57575153-57575175 CTCCAGCCGGGGGGTGGCGGGGG - Intronic
1151045229 17:70911914-70911936 CTCCAGCCTGGGGACAGAGCGGG + Intergenic
1151242073 17:72765949-72765971 CTACAGTCGGCGGATAGAGCTGG + Intronic
1152809825 17:82376099-82376121 CTCCAGCTGAGGGGTGGAGCAGG + Intergenic
1152942941 17:83181989-83182011 CCACACCCGGGGGGTACAGCGGG + Intergenic
1157556119 18:48613856-48613878 CTACAGCTGGAGGGGAGGGCCGG - Intronic
1160646904 19:197928-197950 ATGCAGCCGGGAGGAAGAGCTGG + Intergenic
1160912973 19:1483336-1483358 CTACAGCCGGCGCGGAGACCTGG - Exonic
1160960446 19:1718531-1718553 CTCCAGCCGGGGACTGGAGCTGG + Intergenic
1161491710 19:4565958-4565980 CTCCAGCCTGGGCGAAGAGCAGG - Intergenic
1162119174 19:8451567-8451589 CTCCAGCCGGGGGTAACAGCGGG - Intronic
1163349282 19:16765155-16765177 CCACAGCAGGGCGGCAGAGCTGG - Exonic
1165307662 19:35012206-35012228 CTACAGCCGGGGGGCAGAGGGGG - Intronic
1166493708 19:43282897-43282919 CTCCAGCCGGGGGGTGGGGCAGG - Intergenic
1166885114 19:45955824-45955846 CTCCAGCCTGGCGGCAGAGCGGG + Intronic
1167017277 19:46849489-46849511 CCACAGCCTGGGAGCAGAGCCGG + Intronic
1167425152 19:49426393-49426415 CTATAGCTGCGGGGGAGAGCGGG - Exonic
1168651456 19:58095147-58095169 CCATTGCCAGGGGGTAGAGCTGG - Intronic
925321840 2:2976374-2976396 CTACAGCCGGAGGGAAGAGCAGG + Intergenic
927347938 2:22069581-22069603 GTACAGCCGGGGGTTAGGGGAGG - Intergenic
927425690 2:22979002-22979024 CAAAAGCTGGGGTGTAGAGCAGG - Intergenic
928288000 2:30010085-30010107 TTGAAGCCAGGGGGTAGAGCAGG + Intergenic
930011116 2:46939570-46939592 CTACAACCTGGGGGCAGGGCTGG + Intronic
933489798 2:82970821-82970843 GAGCAGCCTGGGGGTAGAGCAGG + Intergenic
935345034 2:102099992-102100014 CTACAGCAGAAGGGCAGAGCAGG - Intronic
947578955 2:231299712-231299734 CTCCAGCCGAGAGGGAGAGCTGG + Intronic
948701683 2:239764604-239764626 CTGCTGCCTGGGGGCAGAGCAGG + Intronic
1170510962 20:17076267-17076289 CTACAGCCAAGGGGTAGAGAAGG + Intergenic
1171964956 20:31522888-31522910 CCACAGCTGGGAAGTAGAGCTGG + Intronic
1174173490 20:48630964-48630986 CAACAGCCGGGGGGGAAAGAGGG + Intronic
1174385426 20:50186043-50186065 ATACAGCAGGGGAGCAGAGCAGG - Intergenic
1175309367 20:58000910-58000932 CTACAGCCTGGGTGTGCAGCAGG + Intergenic
1175384773 20:58587182-58587204 CTACAGCCCGAGGGGAGAGGTGG - Intergenic
1175725884 20:61318056-61318078 CTCCAGCCGGGACGGAGAGCAGG - Intronic
1178071963 21:28978058-28978080 CTCCAGCCTAGGGGAAGAGCAGG - Intronic
1181553307 22:23653239-23653261 CTACAGCCGGGGCATGGAGAAGG - Intergenic
1182237951 22:28891274-28891296 CTACAGCCGGGGGTAACAGAAGG - Intronic
1184721916 22:46319594-46319616 CTGCAGCTGAGGGGTGGAGCAGG + Intronic
949112064 3:273083-273105 CTTCAGGTGGAGGGTAGAGCAGG + Intronic
950711783 3:14818405-14818427 CAACAACTGGAGGGTAGAGCCGG - Intergenic
951569467 3:24046922-24046944 CTTCTGCCAGGGGGTAGAGGAGG + Intergenic
951733499 3:25836819-25836841 CTCCAGACTGGTGGTAGAGCAGG - Intergenic
955981332 3:64530404-64530426 AGACAGCCGGGGGCTAGAGAGGG + Intronic
958131814 3:89436088-89436110 CTAAAGCCTGGGGATGGAGCAGG + Intronic
960989801 3:123303096-123303118 CTACAGCCTGGGCGATGAGCAGG - Exonic
963040082 3:141064023-141064045 CTACACCCTGGGGGAAGAGGAGG - Intronic
963364980 3:144323378-144323400 GTACAGCCTGGGGTTAGAGGAGG - Intergenic
967882600 3:194312587-194312609 ACACAGCAGGTGGGTAGAGCTGG - Intergenic
968370777 3:198221594-198221616 ATGCAGCCGGGAGGAAGAGCTGG - Intergenic
968662539 4:1804748-1804770 GTACAGCCGGGGGTCAGTGCTGG - Intronic
968909054 4:3467304-3467326 TTACAGCCAGGGCGGAGAGCCGG - Intronic
974885248 4:67809831-67809853 CTCCAGCCAGGGGCTCGAGCTGG + Intergenic
975272830 4:72457618-72457640 CTACAGGCTAGGGTTAGAGCAGG - Intronic
976880739 4:89922134-89922156 CTCCAGCTGGGGGATAGAGCAGG - Intronic
982605890 4:157515538-157515560 CTCCAGTCGGGTGGTACAGCTGG + Intergenic
985632682 5:1022154-1022176 CCACAGCAGGTGGGAAGAGCAGG - Intronic
985632693 5:1022195-1022217 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632705 5:1022236-1022258 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632715 5:1022277-1022299 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632727 5:1022318-1022340 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632737 5:1022359-1022381 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632749 5:1022400-1022422 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632759 5:1022441-1022463 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632783 5:1022524-1022546 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632793 5:1022565-1022587 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632805 5:1022606-1022628 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632817 5:1022647-1022669 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632863 5:1022813-1022835 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632897 5:1022937-1022959 CCACAGCAGGTGGGAAGAGCAGG - Intronic
985632950 5:1023142-1023164 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632972 5:1023224-1023246 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985632984 5:1023265-1023287 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633006 5:1023347-1023369 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633018 5:1023388-1023410 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633040 5:1023470-1023492 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633058 5:1023552-1023574 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633121 5:1023798-1023820 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633133 5:1023839-1023861 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633165 5:1023962-1023984 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633177 5:1024003-1024025 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633199 5:1024085-1024107 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633251 5:1024290-1024312 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633273 5:1024372-1024394 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633295 5:1024454-1024476 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633319 5:1024536-1024558 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633339 5:1024618-1024640 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633351 5:1024659-1024681 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633383 5:1024782-1024804 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633403 5:1024864-1024886 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633433 5:1024987-1025009 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633455 5:1025069-1025091 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633465 5:1025110-1025132 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633495 5:1025233-1025255 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633505 5:1025274-1025296 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633515 5:1025315-1025337 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633525 5:1025356-1025378 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633535 5:1025397-1025419 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633545 5:1025438-1025460 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633555 5:1025479-1025501 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633619 5:1025725-1025747 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633652 5:1025849-1025871 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633676 5:1025931-1025953 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633708 5:1026055-1026077 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633731 5:1026137-1026159 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633762 5:1026261-1026283 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633774 5:1026302-1026324 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633795 5:1026384-1026406 CCACAGCGGGTGGGAAGAGCAGG - Intronic
985633825 5:1026507-1026529 CCACAGCGGGTGGGAAGAGCAGG - Intronic
988919199 5:35925224-35925246 TTACAGCCTGGGGGCTGAGCAGG + Intronic
997947057 5:138212348-138212370 CTCCAGCCCGAGGGCAGAGCGGG - Intronic
999859759 5:155633198-155633220 CTACAGCCAGGAGGCACAGCTGG + Intergenic
1000169484 5:158687854-158687876 CTACAGCCTGGGGGAATAGGTGG - Intergenic
1002730011 5:181327150-181327172 ATGCAGCCGGGAGGAAGAGCTGG - Intergenic
1004598725 6:17126999-17127021 CTACAGCCGGGGGGATCATCAGG - Intronic
1007103328 6:39266628-39266650 ATACAGCCGGGGTGTATAGCAGG + Intergenic
1011603640 6:89081507-89081529 CTGCACCCGGGGGGTCGGGCGGG + Intronic
1012554347 6:100493356-100493378 GTATAGCCGCGGGGCAGAGCCGG + Intergenic
1014097764 6:117479142-117479164 CTCCAGCCTGGGCGAAGAGCGGG - Intronic
1017164178 6:151391656-151391678 CTCCCGCCGGGGGGGAGAGGCGG + Intergenic
1019283990 7:215221-215243 CTCCAGCTGGGGGGGGGAGCAGG + Intronic
1019459539 7:1149646-1149668 CTACAGCCTGGGTGTGGAGGAGG - Intergenic
1023414088 7:39916196-39916218 CTCCAGCCGGGTGACAGAGCGGG - Intergenic
1025052280 7:55741431-55741453 ATGCAGCCGGGAGGAAGAGCTGG + Intergenic
1025181374 7:56825450-56825472 ATGCAGCCGGGAGGAAGAGCTGG + Intronic
1025182707 7:56831698-56831720 ATGCAGCCGGGAGGAAGAGCTGG + Intergenic
1025188781 7:56881291-56881313 CTACAGGAGTGGGGCAGAGCAGG + Intergenic
1025233160 7:57216466-57216488 CTGGAGCCTGGGGGTGGAGCTGG + Intergenic
1025683154 7:63695629-63695651 CTACAGGAGTGGGGCAGAGCAGG - Intergenic
1025689217 7:63745276-63745298 ATGCAGCCGGGAGGAAGAGCTGG - Intergenic
1025690992 7:63753353-63753375 ATGCAGCCGGGAGGAAGAGCTGG - Intergenic
1026045259 7:66902425-66902447 CCACAGCCGGGAGGGAGAGCTGG - Intergenic
1029710191 7:102295126-102295148 CTCCAGCCAGGAGGAAGAGCTGG + Intronic
1033669952 7:143482072-143482094 CTGCAGCCAGGAGCTAGAGCTGG + Intergenic
1034058943 7:148068106-148068128 CTACAGCAGGTGGGGAGAGGTGG - Intronic
1034441877 7:151089806-151089828 CTTCAGCTGGGAGGGAGAGCTGG + Intronic
1037290781 8:17347485-17347507 CTACAGCCGGGGGGTAGAGCAGG - Intronic
1037823610 8:22147731-22147753 CTACAGCGGGGAGCAAGAGCAGG + Exonic
1043391218 8:79794312-79794334 CTACACCCTGGGTGTAGAGTGGG + Intergenic
1045909844 8:107394124-107394146 CTAAAGCTAGGGGTTAGAGCTGG + Intronic
1053168519 9:35861602-35861624 CTACAGCCAGGAGGCAAAGCTGG - Intergenic
1053875413 9:42540548-42540570 CTACAGCAGGGAGGTATGGCTGG + Intergenic
1054236287 9:62561176-62561198 CTACAGCAGGGAGGTATGGCTGG - Intergenic
1058836704 9:108863691-108863713 CTACACACAGGGGGTGGAGCCGG + Exonic
1060195345 9:121620128-121620150 CTGCAGCAGGGGGTCAGAGCCGG - Intronic
1061820337 9:133223908-133223930 CCTCAGCCCTGGGGTAGAGCTGG - Intergenic
1062185157 9:135214293-135214315 CTGCAGGCGGGGAGTAGGGCAGG + Intergenic
1062754426 9:138279664-138279686 ATGCAGCCGGGAGGAAGAGCTGG - Intergenic
1203578330 Un_KI270745v1:23824-23846 ATGCAGCCGGGAGGAAGAGCTGG - Intergenic
1189479764 X:41383575-41383597 CTTCAGCCTGGGGGTGGAGAGGG + Intergenic
1192676144 X:73198961-73198983 CTACAGCCTGGGGTTAGGGAGGG - Intergenic
1195329157 X:103782791-103782813 CTGCAGCCGGGGGGTGGGGAGGG - Intronic
1195923310 X:110003015-110003037 CTAGGGCCGGAGGGTGGAGCTGG + Intronic
1196800838 X:119542096-119542118 CTCCAGCCTGGGGACAGAGCGGG - Intronic
1196984606 X:121254250-121254272 GTACAGCCTGGGGTTAGAGGAGG + Intergenic
1199810116 X:151340720-151340742 CTACATCTGGGGGCTAGAGTAGG - Intergenic
1202380971 Y:24276461-24276483 ACACAGCCGGGAGGAAGAGCTGG - Intergenic
1202489814 Y:25393665-25393687 ACACAGCCGGGAGGAAGAGCTGG + Intergenic