ID: 1037291094

View in Genome Browser
Species Human (GRCh38)
Location 8:17350142-17350164
Sequence ATCCCAGGACACTTCCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037291094_1037291098 3 Left 1037291094 8:17350142-17350164 CCCACATGGAAGTGTCCTGGGAT 0: 1
1: 0
2: 1
3: 15
4: 162
Right 1037291098 8:17350168-17350190 TCAGGCACCTCTTTACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037291094 Original CRISPR ATCCCAGGACACTTCCATGT GGG (reversed) Intronic
900153012 1:1188113-1188135 ATGCCAGGACCATTCCATGGGGG - Intronic
903076462 1:20771468-20771490 ATGCCAGGACATTTCCCTGAAGG + Intronic
903529640 1:24020386-24020408 AGCCCAGGACACTAGCCTGTTGG - Intergenic
906721571 1:48009360-48009382 ATCCCAGGGCACATAGATGTTGG - Intergenic
907332663 1:53681408-53681430 CTCCCAGGACAATGCCAAGTAGG + Intronic
907550081 1:55297805-55297827 AACCCAGAACCCTTCAATGTAGG - Intergenic
913102836 1:115584970-115584992 ATTACAGGACACTTCCAAGACGG - Intergenic
915661202 1:157407062-157407084 TTCGCAGGACACTTCAAGGTTGG - Intergenic
916821256 1:168401017-168401039 CTCCCAGGACTCTTCCCTGTCGG - Intergenic
1062952407 10:1514743-1514765 ATCCCAGGACACTCAAATGTGGG + Intronic
1063672875 10:8113973-8113995 ACCCCAGGCCAGTTCCCTGTAGG - Intergenic
1063983496 10:11476211-11476233 ATCTCAGGCCAGCTCCATGTGGG - Intronic
1065740957 10:28796769-28796791 CTCCCAGCACAGTTCCCTGTGGG + Intergenic
1069078467 10:64063396-64063418 TTCCCAGGGCACTTCTGTGTGGG + Intergenic
1072969361 10:100003599-100003621 ATCCCAGCACACTTTGAGGTGGG + Intronic
1074437497 10:113446400-113446422 ATCCCAGGGCTGTTCCATGATGG - Intergenic
1075405083 10:122189601-122189623 TTCCCAGATCACTTTCATGTTGG + Intronic
1080421790 11:32117337-32117359 ATGCCTGGACCCCTCCATGTGGG - Intergenic
1087603947 11:100351814-100351836 ATGACGGGACACTTCCCTGTAGG - Intronic
1088903595 11:114137364-114137386 TTCCCAAGACACTTCCATTTTGG - Intronic
1089215163 11:116830548-116830570 CTCACAGGACACTTCCTTGCAGG + Exonic
1089388889 11:118086598-118086620 ATCCCAGGATACTTGGAAGTCGG + Intronic
1090346750 11:126077635-126077657 GTTCCAGGACACATCCAGGTGGG - Intergenic
1090899404 11:131014003-131014025 ATGCCATGTCACTTCCAGGTGGG - Intergenic
1091174717 11:133547699-133547721 GATCCAGGAAACTTCCATGTGGG - Intergenic
1097429873 12:59491645-59491667 ATCGCTTGACACTTCCATATTGG + Intergenic
1098183585 12:67873747-67873769 ACCCCAGGGCAATTCCATTTTGG - Intergenic
1102055016 12:109889992-109890014 ATCCCAGGAAACACCCAAGTGGG + Intergenic
1106213522 13:27673404-27673426 ATCCTGGTACACCTCCATGTGGG + Intergenic
1109641772 13:65201057-65201079 ATCCAGTGACACTTCCATGGTGG + Intergenic
1111358065 13:87136992-87137014 AACCCAGGAAACTGACATGTGGG - Intergenic
1114018700 14:18456640-18456662 ATTCCAGAACACTTCTATGAGGG - Intergenic
1114022499 14:18493167-18493189 ATCCCAGAACACTGCTATGAGGG + Intergenic
1114024626 14:18513769-18513791 ATCCCAGGACACTGCTACGAGGG + Intergenic
1114550357 14:23529278-23529300 ATGCCAGGACAGTTCCATCCAGG + Intronic
1116420703 14:44728471-44728493 ATCCTAGGACAGTTCTATATGGG + Intergenic
1122652573 14:103233499-103233521 ATCCCAGGACAGCTTCAGGTAGG + Intergenic
1123215522 14:106805948-106805970 ATTCCAGGAGACATCCCTGTAGG + Intergenic
1202838034 14_GL000009v2_random:93097-93119 ATTCCAGAACACTGCCACGTGGG + Intergenic
1202907398 14_GL000194v1_random:83064-83086 ATTCCAGAACACTGCCACGTGGG + Intergenic
1202885679 14_KI270722v1_random:104929-104951 ATTCCAGAACACTGCCACGTGGG - Intergenic
1126547713 15:49890850-49890872 ATGCCAGGCCACTCCCATGTGGG + Intronic
1129450997 15:75651374-75651396 CCCCAAGGACACGTCCATGTTGG + Intronic
1129771176 15:78204467-78204489 CTCCTAGGACCCTGCCATGTGGG - Intronic
1132630521 16:915082-915104 AGCCCAGGACCCTGCCATCTAGG - Intronic
1133091413 16:3407178-3407200 AACCCAAGAGACTACCATGTGGG - Intronic
1133449430 16:5891312-5891334 ATCGCAGCACACGTCCAGGTAGG + Intergenic
1135553483 16:23416402-23416424 CTCCCAGGGCAGTTCCACGTAGG - Intronic
1140451565 16:75075074-75075096 ATCTCTGGGCACTTCCAGGTGGG + Intronic
1142415148 16:89937021-89937043 ATCCCCGGCCCCATCCATGTTGG - Intergenic
1143013722 17:3880410-3880432 GTCACAGGGCACTTCCATGACGG + Exonic
1143758977 17:9087608-9087630 ATCCCAGGACTCTGGTATGTGGG - Intronic
1149408218 17:56376702-56376724 ATCTCAGGAGACTTGCATTTGGG + Intronic
1151719990 17:75849548-75849570 TTCCCAGGACACCTCCCTGCAGG + Intronic
1203157270 17_GL000205v2_random:16279-16301 ATTCCAGAACACTTCTATGAGGG - Intergenic
1203157583 17_GL000205v2_random:19061-19083 ATTCCAGAACACTCCCATGTGGG - Intergenic
1203159262 17_GL000205v2_random:34147-34169 ATTCCAGGACACTTCTAAGAGGG - Intergenic
1157686406 18:49646095-49646117 GTCCCAGGGCACTTTCATTTTGG + Intergenic
1160899290 19:1419186-1419208 ATGCCAGGACAGTGCCCTGTCGG - Intronic
1161155274 19:2729309-2729331 AACCCAGCACATGTCCATGTTGG - Intronic
1162499585 19:11044501-11044523 ATCCCAGGACTAATCAATGTGGG + Intronic
1168238196 19:55076401-55076423 CTCCCAGGGCACCTCCAGGTGGG + Exonic
1202651053 1_KI270707v1_random:3893-3915 ATTCCAGAACACTGCCATGAGGG + Intergenic
1202661062 1_KI270708v1_random:71762-71784 ATTCCAGAACACTGCCACGTGGG - Intergenic
925168055 2:1731310-1731332 ATCCCAGCACCCTTGCATCTGGG + Intronic
925168066 2:1731360-1731382 ATCCCAGCACCCTTGCATCTGGG + Intronic
927695272 2:25235548-25235570 ACCCCAGGAGTCTGCCATGTTGG + Intronic
927896569 2:26786372-26786394 ATCCCGTGGCACTTCCCTGTTGG + Intronic
929894154 2:45944068-45944090 ATTCCAGGACTCAACCATGTTGG + Intronic
929913605 2:46115005-46115027 ATACCAGGACAGTCCCATGAAGG + Intronic
932280916 2:70491274-70491296 CTCCCAGGACAAACCCATGTTGG + Intronic
940122775 2:150285760-150285782 ATCCCAAAATAATTCCATGTGGG - Intergenic
943860509 2:192855970-192855992 ATACCAGTACACATCCATGTAGG - Intergenic
946765998 2:223041630-223041652 TTCCCAGGAGACTTGCATGAAGG + Intergenic
946809033 2:223503403-223503425 ACCCCAAAACACTTCCAGGTTGG - Intergenic
1170512665 20:17094890-17094912 ATCCCATGGCACTTTCATGTAGG - Intergenic
1170644746 20:18187849-18187871 ATCCCAGGACAGTGCCTTTTGGG - Exonic
1176234015 20:64045807-64045829 ATCCCAGGAAGAGTCCATGTTGG + Intronic
1176601072 21:8795602-8795624 ATTCCAGAACACTGCCATGAGGG - Intergenic
1176601222 21:8796841-8796863 ATTCCAGAACACTGCCACGTGGG - Intergenic
1176626690 21:9097405-9097427 ATTCCAGAACACTGCCACGTGGG + Intergenic
1179081937 21:38179411-38179433 ACACCAGGACCCTTCCATGCAGG - Intronic
1180252919 21:46601448-46601470 ATCACAGTTCACTTCCATGAGGG + Intronic
1180328532 22:11455119-11455141 ATTCCAGAACACTGCCACGTGGG - Intergenic
1180343357 22:11687139-11687161 ATTCCAGAACACTGCCATGAGGG - Intergenic
1180343507 22:11688378-11688400 ATTCCAGAACACTGCCACGTGGG - Intergenic
1180439988 22:15355712-15355734 ATTCCAGGACACTACCATAAGGG - Intergenic
1180443200 22:15387463-15387485 ATTCCAGAACACTTCTATGAGGG - Intergenic
1180446542 22:15419581-15419603 ATCCCAGAACACTGCTATGAGGG + Intergenic
1180448735 22:15440770-15440792 ATCCCAGGACACTGCTACGAGGG + Intergenic
1180448786 22:15441250-15441272 ATCCCAGGACACTGCTACGAGGG + Intergenic
1184492968 22:44820709-44820731 ATTCAAGGACACTGCCAGGTAGG - Intronic
1185036868 22:48483950-48483972 ATCCCAGGACAATTGCCTGCAGG + Intergenic
1185160578 22:49226333-49226355 ATGCCAAGACAATTCAATGTGGG + Intergenic
950321084 3:12054145-12054167 CACTCAGGACATTTCCATGTGGG + Intronic
950858192 3:16125118-16125140 ATCCCCAGACACATTCATGTTGG - Intergenic
953370160 3:42380781-42380803 TTCCCACCACACTTCCATGGGGG + Intergenic
954923309 3:54210644-54210666 ATCCCAGGACACTTCCCTCCAGG - Intronic
957092899 3:75749702-75749724 ATTCCAGAACACTGCCATGAGGG + Intronic
957092969 3:75750277-75750299 ATCCCAGAACACTGCTATGAGGG + Intronic
965616478 3:170598182-170598204 ATCCCAGGACAGTGTCATGTGGG + Intronic
968808855 4:2791251-2791273 GGCCCAGGACACTTACAGGTGGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
973396047 4:49593865-49593887 ATTCCAGAACACTGCCACGTGGG + Intergenic
973396367 4:49596678-49596700 ATTCCAGAACACTGCCACGTGGG + Intergenic
977961601 4:103091257-103091279 AATCCAGGACAGTTCCATGATGG + Exonic
978436497 4:108690839-108690861 CTCTCAGGACACATCAATGTGGG + Intergenic
978876698 4:113648481-113648503 ATCCCATCAGACTTGCATGTGGG - Intronic
980886915 4:138772798-138772820 TTCCCAGGACACTTCTATGTTGG - Intergenic
982154712 4:152507209-152507231 CTCTCAGTTCACTTCCATGTGGG - Intronic
985887419 5:2690348-2690370 ATCTCAGGAGCCTTCCAGGTTGG + Intergenic
990358227 5:54991675-54991697 TTCCCAGGACACTCTCATGCAGG - Intronic
993285349 5:85989678-85989700 ATGCCACGACACTTCACTGTTGG - Intergenic
993440515 5:87951149-87951171 ATCACAGAACACTTGCTTGTAGG + Intergenic
996603279 5:125291475-125291497 ACCCCAGGACTCTCTCATGTGGG + Intergenic
1001437421 5:171710931-171710953 CTCCCAGGACCCTGGCATGTAGG + Intergenic
1003160829 6:3633043-3633065 ACCCCAGCAAACTTCCATTTAGG + Intergenic
1006553707 6:34847243-34847265 TTCCAAGAACACTTTCATGTAGG + Intronic
1010127179 6:72446603-72446625 ATCCCAGGAGCCTTGCATCTAGG - Intergenic
1012432134 6:99174998-99175020 AATCCAGGACAGTTCCATGATGG - Intergenic
1014793132 6:125697383-125697405 ATGCCAGGACAATTCAATGAGGG + Intergenic
1019110341 6:169704591-169704613 TTCCCAGGAAACTTCGTTGTAGG + Exonic
1019213799 6:170427087-170427109 AGCCCAGGACAGGTCCATCTTGG - Intergenic
1019489963 7:1307720-1307742 AAACCAGGACTCTCCCATGTGGG + Intergenic
1020262599 7:6538995-6539017 AGCCCAGGACTGTGCCATGTGGG - Intronic
1022688458 7:32619617-32619639 TTCCCAGGACTCTTCCCTGAGGG - Intergenic
1022816107 7:33916034-33916056 ATTCCATGACACTTCAATGGTGG - Intronic
1024521286 7:50305921-50305943 GACCCAGGACATTTCTATGTGGG - Intronic
1037291094 8:17350142-17350164 ATCCCAGGACACTTCCATGTGGG - Intronic
1041207042 8:55510223-55510245 ATCCCAGGAGTCCTCCAGGTGGG + Intronic
1041853916 8:62426966-62426988 ATCACAGGACACTCCCATGCTGG + Intronic
1044597713 8:93974579-93974601 ATCCCATGATACGTACATGTAGG + Intergenic
1046576031 8:116030041-116030063 CTCCCTGAACACTTACATGTTGG - Intergenic
1047625003 8:126647453-126647475 ATCCCATGCCACTCCCATCTTGG - Intergenic
1048461212 8:134623298-134623320 ATCCCTGGACACTCCCCTGTGGG + Intronic
1048503882 8:135003392-135003414 TTCCCAGGACACTCCTATGAGGG - Intergenic
1053719287 9:40929071-40929093 ATTCCAGAACACTGCCATGAGGG + Intergenic
1055729034 9:79261835-79261857 ATCCCAGGAATCATCCATTTAGG - Intergenic
1057967179 9:99515573-99515595 ATCCCAGGACACTGACATTTTGG + Intergenic
1059015540 9:110511759-110511781 ATCCCAGGAGACATCTATGTTGG - Intronic
1061144860 9:128791650-128791672 CTCCCTGGACACACCCATGTTGG - Exonic
1061191190 9:129083662-129083684 CAACCAGGACACTTCCATGTTGG - Intronic
1061243011 9:129385172-129385194 TTCCCAGGACACTCCCTTTTGGG - Intergenic
1061866710 9:133495044-133495066 TCCCCAGGACCCTTCCATGGAGG + Intergenic
1203440353 Un_GL000219v1:1846-1868 ATTCCAGAACACTGCTATGTGGG - Intergenic
1203440580 Un_GL000219v1:4243-4265 ATTCCAGAACACTGCTATGTGGG - Intergenic
1203449800 Un_GL000219v1:100939-100961 ATCCCAGGCATTTTCCATGTAGG - Intergenic
1203457017 Un_GL000219v1:177643-177665 ATTCCAGAACACTTCTATGAGGG - Intergenic
1203493710 Un_GL000224v1:130889-130911 ATTCCAGAACACTGCTATGTGGG + Intergenic
1203493736 Un_GL000224v1:131177-131199 ATTCCAGAACACTTCTATGTGGG + Intergenic
1203494984 Un_GL000224v1:142642-142664 ATTCCAGAACACTGCTATGTGGG + Intergenic
1203495404 Un_GL000224v1:146612-146634 ATTCCAGAACACTTCTACGTGGG + Intergenic
1203495745 Un_GL000224v1:149744-149766 ATTCCAGAACACTGCTATGTGGG - Intergenic
1203496200 Un_GL000224v1:153767-153789 ATCCCAGAACACTGCCACTTGGG - Intergenic
1203496555 Un_GL000224v1:157064-157086 ATTCCAGAACACTGCTATGTGGG - Intergenic
1203497139 Un_GL000224v1:162674-162696 AATCCAGAACACTGCCATGTGGG - Intergenic
1203498008 Un_GL000224v1:171149-171171 ATTCCAGAACACTTCTACGTGGG - Intergenic
1203498703 Un_GL000224v1:177989-178011 ATTCCAGAACACTGCTATGTGGG - Intergenic
1203506331 Un_KI270741v1:72764-72786 ATTCCAGAACACTGCTATGTGGG + Intergenic
1203506357 Un_KI270741v1:73052-73074 ATTTCAGAACACTTCTATGTGGG + Intergenic
1203507609 Un_KI270741v1:84565-84587 ATTCCAGAACACTGCTATGTGGG + Intergenic
1203508029 Un_KI270741v1:88535-88557 ATTCCAGAACACTTCTACGTGGG + Intergenic
1203508370 Un_KI270741v1:91667-91689 ATTCCAGAACACTGCTATGTGGG - Intergenic
1203508822 Un_KI270741v1:95689-95711 ATCCCAGAACACTGCCACTTGGG - Intergenic
1203509179 Un_KI270741v1:98986-99008 ATTCCAGAACACTGCTATGTGGG - Intergenic
1203509697 Un_KI270741v1:104730-104752 AATCCAGAACACTGCCATGTGGG - Intergenic
1203510562 Un_KI270741v1:113399-113421 ATTCCAGAACACTTCTACGTGGG - Intergenic
1203510737 Un_KI270741v1:115172-115194 ATTCCAGAACACTTCTACGTGGG - Intergenic
1203510786 Un_KI270741v1:115652-115674 ATTCCAGAACACTGCCATGATGG - Intergenic
1203511239 Un_KI270741v1:120277-120299 ATTCCAGAACACTGCTATGTGGG - Intergenic
1203511459 Un_KI270741v1:122626-122648 ATTCCAGAACACTGCTATGTGGG - Intergenic
1186124478 X:6398331-6398353 ATCCCCCGACTCTTCTATGTTGG - Intergenic
1188578780 X:31685307-31685329 ATCCCAGGACATTCACATATAGG + Intronic
1191169145 X:57423385-57423407 CTCCCAGGCCACATCCATGCTGG - Intronic
1194873002 X:99156221-99156243 GTCCCAGGACATTTCCTGGTTGG - Intergenic
1195320924 X:103721471-103721493 ATCCCGGGTCCCTTCCATGGTGG - Intronic
1197655533 X:129112591-129112613 GTCCCAGGACAGCTCCATGGAGG - Intergenic
1201163274 Y:11183220-11183242 ATTCCAGAACACTGCCACGTGGG + Intergenic
1201605837 Y:15783702-15783724 ATCCCCTGACTCTTCTATGTTGG - Intergenic