ID: 1037293067

View in Genome Browser
Species Human (GRCh38)
Location 8:17371659-17371681
Sequence TTTTCTAAGCTGTTGGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037293062_1037293067 19 Left 1037293062 8:17371617-17371639 CCACATGGAATGTTCGAGTTCTG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1037293067 8:17371659-17371681 TTTTCTAAGCTGTTGGTGGTCGG No data
1037293061_1037293067 27 Left 1037293061 8:17371609-17371631 CCTTAATTCCACATGGAATGTTC 0: 1
1: 0
2: 2
3: 17
4: 186
Right 1037293067 8:17371659-17371681 TTTTCTAAGCTGTTGGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037293067 Original CRISPR TTTTCTAAGCTGTTGGTGGT CGG Intronic
No off target data available for this crispr