ID: 1037293111

View in Genome Browser
Species Human (GRCh38)
Location 8:17372198-17372220
Sequence CATTTTTAGCAGAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037293111_1037293118 23 Left 1037293111 8:17372198-17372220 CCTGCCACCTTCTGCTAAAAATG 0: 1
1: 0
2: 0
3: 26
4: 226
Right 1037293118 8:17372244-17372266 AAAGGGAAATCTACAATTCAGGG No data
1037293111_1037293117 22 Left 1037293111 8:17372198-17372220 CCTGCCACCTTCTGCTAAAAATG 0: 1
1: 0
2: 0
3: 26
4: 226
Right 1037293117 8:17372243-17372265 CAAAGGGAAATCTACAATTCAGG No data
1037293111_1037293115 5 Left 1037293111 8:17372198-17372220 CCTGCCACCTTCTGCTAAAAATG 0: 1
1: 0
2: 0
3: 26
4: 226
Right 1037293115 8:17372226-17372248 CTGTGCACGAAATACAGCAAAGG No data
1037293111_1037293116 6 Left 1037293111 8:17372198-17372220 CCTGCCACCTTCTGCTAAAAATG 0: 1
1: 0
2: 0
3: 26
4: 226
Right 1037293116 8:17372227-17372249 TGTGCACGAAATACAGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037293111 Original CRISPR CATTTTTAGCAGAAGGTGGC AGG (reversed) Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
905165193 1:36077328-36077350 TATTTTTAGCAGGAGGTGACTGG - Intergenic
905596950 1:39215751-39215773 TATTTTTAGCAGAAGTTGGTTGG + Intronic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
908869337 1:68590662-68590684 CATTTCTAACAACAGGTGGCAGG - Intergenic
910634368 1:89390506-89390528 CATTTTTAGCATAAAGTACCTGG + Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
912315792 1:108666718-108666740 CATTCATAGCAGAAGGTGAAGGG - Intergenic
914850661 1:151311520-151311542 CATTTTGGGTAGAAGGTGGTGGG + Intronic
916123728 1:161550919-161550941 CATTTATAGCAAAGGTTGGCGGG - Intergenic
916133614 1:161632282-161632304 CATTTATAGCAAAGGTTGGCGGG - Intronic
916910711 1:169342290-169342312 CATCTTTTTCACAAGGTGGCAGG - Intronic
918016932 1:180644180-180644202 CATAATTACTAGAAGGTGGCTGG + Intronic
919214810 1:194538662-194538684 CACTTTCATCACAAGGTGGCAGG + Intergenic
919519649 1:198572006-198572028 CATTTTGAGCAACAGGGGGCGGG + Intergenic
919814304 1:201428064-201428086 CAGGTTTGGCAGAGGGTGGCGGG - Intronic
920757757 1:208750677-208750699 CAATTATAGCAGAAGGTGAAGGG - Intergenic
921069878 1:211649913-211649935 CAATTTGAGCAGAAGTTGGGAGG - Intergenic
922526048 1:226304992-226305014 TATTTTTAGTAGAACCTGGCTGG - Intronic
922561574 1:226573318-226573340 CTTTTGTAACAGATGGTGGCGGG + Intronic
1065067153 10:21981686-21981708 CCTTTTCAGCAGACGGTGCCAGG + Intronic
1065454004 10:25887689-25887711 CATTATTAGACGAATGTGGCTGG - Intergenic
1068158199 10:53228525-53228547 CATTTTCTTCATAAGGTGGCAGG + Intergenic
1068740791 10:60467422-60467444 CATCTTTAGCAGGATGTGGGAGG + Intronic
1069870831 10:71532006-71532028 CATTTTTGGGAGGAGCTGGCTGG - Intronic
1072170829 10:92860009-92860031 CATTTTCGGCACAATGTGGCTGG - Intronic
1072919524 10:99564238-99564260 GATTTGTAGCAGAAGGTGAAAGG + Intergenic
1073568365 10:104555053-104555075 CATTTTGAGCAAAAAATGGCTGG - Intergenic
1074969966 10:118528050-118528072 CATGTTTATGAGATGGTGGCCGG - Intergenic
1075160370 10:120019219-120019241 CATTCATAGCAGGAGGTGGGAGG + Intergenic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1076900883 10:133336797-133336819 CATTTCTTGCAGAATGTGGGCGG - Intronic
1078135555 11:8649040-8649062 CATTTAAAACAGATGGTGGCTGG + Intronic
1079339135 11:19597756-19597778 CATTTTTAGCTGAAGGAGGTGGG + Intronic
1080083538 11:28251263-28251285 CTTGTTTAGCAAAAGGAGGCAGG - Intronic
1083145705 11:60756916-60756938 CAATTTCAGCTGAAGGGGGCTGG - Intergenic
1087212656 11:95459417-95459439 CATGTTTTTCAGGAGGTGGCAGG - Intergenic
1091932931 12:4411573-4411595 CAATTTTGGCAGATGCTGGCCGG - Intergenic
1094168698 12:27468435-27468457 CATTTCTAGAAACAGGTGGCAGG + Intronic
1096063452 12:48721106-48721128 CATTTTAAGTGGATGGTGGCAGG + Intergenic
1099778502 12:87165045-87165067 CATTTTCTTCATAAGGTGGCAGG + Intergenic
1100375966 12:94016569-94016591 CAATTATGGCAGAAGGTGACAGG - Intergenic
1101124434 12:101616453-101616475 CAATTTTAGCAGAATTTGGGAGG - Intronic
1101537746 12:105634908-105634930 CATTCTGGGCAGAAAGTGGCAGG + Intergenic
1105370138 13:19795003-19795025 GTTTTTTAGCTGAAGGAGGCAGG - Intergenic
1105477091 13:20737722-20737744 CAGCTGTAGGAGAAGGTGGCAGG - Exonic
1107346696 13:39469246-39469268 CATTTTGAACACAAAGTGGCTGG - Intronic
1108344639 13:49533278-49533300 CATTTATAGAAGAAGGTGGTGGG + Exonic
1110014898 13:70387597-70387619 CATTTTTGGGAGAAGATGACAGG + Intergenic
1110070419 13:71169254-71169276 CATTTTGAACAGATGGTGGCTGG + Intergenic
1110385388 13:74904826-74904848 CAATCTTAGCAGAAGGTGAAGGG - Intergenic
1112489968 13:99853898-99853920 AATTTTTAGCAGAAGGCCCCAGG - Intronic
1113737266 13:112687962-112687984 CACTTATAAGAGAAGGTGGCCGG - Intergenic
1115054147 14:29101945-29101967 CATTTTTAGGTGCAAGTGGCTGG + Intergenic
1115989637 14:39139114-39139136 AATATTAAGAAGAAGGTGGCTGG + Intergenic
1117946948 14:61037242-61037264 CATTTTTGGCAGAAGGATGGTGG + Intronic
1120119622 14:80663520-80663542 TATTATTATCGGAAGGTGGCTGG - Intronic
1121573206 14:94962836-94962858 CATTTTTTGCTGGTGGTGGCGGG - Intergenic
1123473263 15:20570185-20570207 CACATTTAGCAGATGGTGGTTGG + Intergenic
1123644745 15:22430168-22430190 CACATTTAGCAGATGGTGGTTGG - Intergenic
1123733563 15:23165196-23165218 CACATTTAGCAGATGGTGGTTGG + Intergenic
1123751695 15:23362571-23362593 CACATTTAGCAGATGGTGGTTGG + Intronic
1124095934 15:26648833-26648855 GATTTTGAGCAGCAGGTGGGTGG + Intronic
1124284067 15:28386496-28386518 CACATTTAGCAGATGGTGGTTGG + Intronic
1124298630 15:28525118-28525140 CACATTTAGCAGATGGTGGTTGG - Intronic
1125274901 15:37979403-37979425 CATTCTTGGCAGAATGTGGTAGG + Intergenic
1125461277 15:39909058-39909080 CCTTTGTAGCAGAAGGTAGCAGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131862733 15:96671495-96671517 CATGTTTAGCAGTAAGTAGCGGG + Intergenic
1132380993 15:101366658-101366680 AATTTCCTGCAGAAGGTGGCTGG + Intronic
1202976746 15_KI270727v1_random:303155-303177 CATTTTTAGAAGAATGTAGGAGG - Intergenic
1133427110 16:5702232-5702254 CAATTATAGCAGAAGGTGAATGG + Intergenic
1133983082 16:10648049-10648071 TATTTTTAACAGGAGGTGGGAGG - Intronic
1135199398 16:20423904-20423926 AATTTTTGGCAGACGGTGGGTGG + Exonic
1135219299 16:20599706-20599728 AATTTTTGGCAGATGGTGGTTGG - Intergenic
1135783134 16:25323912-25323934 CATTTTTGGCAGGATTTGGCAGG + Intergenic
1142647669 17:1325546-1325568 CATTTTCAACAGAAGATTGCTGG + Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1142975894 17:3644092-3644114 TATTTTTAGCCCAAGGTGGGAGG - Intronic
1145005618 17:19336159-19336181 CAGTTCTGGCAGAAGGTGGCTGG - Exonic
1146546456 17:33742922-33742944 CATTTTCATCAGAAGGCTGCTGG - Intronic
1148543925 17:48502503-48502525 CAGTTTGGCCAGAAGGTGGCTGG + Intergenic
1149579743 17:57741335-57741357 CATTTTTAGCCAGAGGAGGCTGG - Intergenic
1150140302 17:62722730-62722752 CATTTTCTACAGAAGATGGCTGG - Intronic
1150601450 17:66654386-66654408 CATTTTTCCCAAAAGGTGGTTGG - Intronic
1152003921 17:77665312-77665334 CAATTATGGCAGAAGGTGGAAGG - Intergenic
1155583209 18:27335734-27335756 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1156109072 18:33701680-33701702 CATTTTTACCAGAATGTGTCTGG + Intronic
1156535899 18:37864231-37864253 AATTTGTAGCAGAAAGTGGAAGG + Intergenic
1156584171 18:38413651-38413673 TATTTGTAGCAGAAGTTGACTGG + Intergenic
1156857599 18:41800541-41800563 AATCTTTATCAGAAGTTGGCTGG - Intergenic
1157129166 18:44987493-44987515 GATATTTAGAAGAATGTGGCAGG - Intronic
1157910225 18:51610504-51610526 CATCTTTTTCACAAGGTGGCAGG + Intergenic
1158014157 18:52764608-52764630 CATTTGTGGCAGAAGGTGAAGGG - Intronic
1158994535 18:62904424-62904446 CATTTATAGAAGAAGGTTGAGGG + Intronic
1159741710 18:72179487-72179509 TATATTTGACAGAAGGTGGCTGG - Intergenic
1159802723 18:72920842-72920864 CATTATTTGTATAAGGTGGCAGG - Intergenic
1163077701 19:14909722-14909744 TATTTTTAGTAGACGGTGGTGGG - Intergenic
1166322422 19:42026862-42026884 CAGTTTAAGAACAAGGTGGCTGG - Intronic
925749866 2:7078384-7078406 CATTGTTAGGAAGAGGTGGCTGG + Intergenic
927381868 2:22488735-22488757 CATTTTTATCAGGAGGTTGAAGG - Intergenic
927744538 2:25605013-25605035 CATTTTAAACAGAACTTGGCTGG - Intronic
928085044 2:28340669-28340691 CACTTCTAGCAGATGGTGGTTGG + Intergenic
928547476 2:32341885-32341907 TATTTTTAGTAGAGGGGGGCAGG - Intergenic
932644939 2:73490316-73490338 CTATTTTAGCAGAAGGTAGAAGG + Exonic
932943943 2:76204755-76204777 CAAATTTAACAGAAGGGGGCAGG - Intergenic
934666460 2:96174704-96174726 CATGTTGAGCAGCAGGGGGCAGG - Intergenic
935580590 2:104752837-104752859 CAGCTGTGGCAGAAGGTGGCCGG + Intergenic
935996485 2:108779591-108779613 AGTTTTTAGCAGAAGGTGTAGGG + Intronic
936127767 2:109805653-109805675 TATTTTTAGTAGAAACTGGCTGG + Intronic
936216930 2:110565832-110565854 TATTTTTAGTAGAAACTGGCTGG - Intronic
936426068 2:112420416-112420438 TATTTTTAGTAGAAACTGGCTGG - Intronic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
939643395 2:144667797-144667819 CATTTTTAGCATTAGCTGGGGGG - Intergenic
941565622 2:167102385-167102407 TATTTTTGACAGAAAGTGGCTGG - Intronic
941624790 2:167819701-167819723 AATTGTTAGTGGAAGGTGGCGGG + Intergenic
942064623 2:172258905-172258927 CATGTTTAACAAAAGGAGGCGGG + Intergenic
942437077 2:175990370-175990392 CATTCTTGGCAGAAGGTGACAGG - Intronic
943464867 2:188217367-188217389 CATTTCTAACAGAAAGCGGCTGG + Intergenic
943972574 2:194429505-194429527 CATTTGTGGCAGAAGGTGAAAGG + Intergenic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
945699846 2:213155601-213155623 TCTTTTTAGCAGAAGGTGGGAGG + Intergenic
945842363 2:214903296-214903318 CATTTTTAAGAGGAGGTGGAGGG + Intergenic
946502166 2:220261129-220261151 CATTTAGAGAAGGAGGTGGCTGG + Intergenic
946627272 2:221627196-221627218 GATTTTTAATAGAACGTGGCAGG + Intergenic
1170333904 20:15247541-15247563 CATGTAAAGCAGAAAGTGGCAGG - Intronic
1172328740 20:34058898-34058920 GATTTTAAACAGGAGGTGGCAGG + Intronic
1172334885 20:34107027-34107049 AAAAATTAGCAGAAGGTGGCGGG + Intronic
1172590483 20:36114250-36114272 CATTTGTAGCAGAACTTGTCTGG + Intronic
1175019453 20:55828848-55828870 CAATTATGGCGGAAGGTGGCAGG + Intergenic
1175218557 20:57404336-57404358 CATTTTTAGCAAAACCTTGCGGG + Intronic
1182203047 22:28593030-28593052 CATTATTCTCTGAAGGTGGCTGG + Intronic
1183348751 22:37322626-37322648 CAATTTTAGCACAAGAAGGCCGG - Intergenic
1184969452 22:48004840-48004862 CATTCTTAGTAGGAGCTGGCAGG + Intergenic
949176685 3:1072109-1072131 GATTTTTATAAGAAGGTGGTGGG + Intergenic
949307745 3:2661946-2661968 ATTTTTTAACAAAAGGTGGCAGG - Intronic
950901609 3:16503175-16503197 TATTTTTAGCGAAGGGTGGCTGG - Intronic
953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG + Intergenic
953935159 3:47035229-47035251 CATTTTTAACAGGTGGTGCCTGG + Intronic
956734233 3:72225043-72225065 CATTTTTACCATAATGTGTCTGG + Intergenic
957119151 3:76067207-76067229 CATTTTTAACAGAAGGGAACTGG - Intronic
958728306 3:97932910-97932932 TATTTTTAGCAGAAGGGAGCAGG - Intronic
959632058 3:108517762-108517784 GAATTTAATCAGAAGGTGGCCGG - Intronic
959878313 3:111412965-111412987 CATCTTCATCACAAGGTGGCAGG + Intronic
962052578 3:131833358-131833380 CATTTATATCAGAAGAGGGCTGG + Intronic
962652962 3:137514729-137514751 CAATTATGGCAGAAGGTGACAGG - Intergenic
964812900 3:160684713-160684735 CATGTGTAGCAGGAGGTGGAGGG - Intergenic
964938139 3:162120013-162120035 GGATTTTAGCAGAAGGTGGCAGG + Intergenic
965218193 3:165892351-165892373 CATTTATGGCAGAAGGTGAATGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966092642 3:176159027-176159049 CATTTGTAGCAGAAGGAAGATGG + Intergenic
966400547 3:179542872-179542894 CAATTATGGAAGAAGGTGGCAGG + Intergenic
966698274 3:182815927-182815949 CAATTTTAGCAGGAGGTCTCTGG - Intronic
968171959 3:196517931-196517953 CTTTTCTAACAGAAAGTGGCTGG + Intergenic
968190501 3:196663845-196663867 TTATTTCAGCAGAAGGTGGCAGG - Intronic
968574077 4:1356923-1356945 CAGTTTTGTCTGAAGGTGGCCGG + Intronic
969158633 4:5235699-5235721 TATTTTTAGCAAAATGAGGCTGG - Intronic
969399257 4:6943080-6943102 CGTTTTCAGCAGAAGCTTGCTGG + Intronic
976689084 4:87849175-87849197 CTTTTTGAGCACAAGGTGGCAGG - Intergenic
976782610 4:88777769-88777791 CATTTTCAGGAGAAGATGGTAGG - Intronic
977086478 4:92605063-92605085 CAATCATAGCAGAAGGTGGAGGG - Intronic
977468401 4:97411242-97411264 CATTTTTAGCTGAAGGCTGGAGG - Intronic
977672845 4:99716015-99716037 AATTTTGGGCAGAAGGGGGCAGG + Intergenic
978194397 4:105954100-105954122 CATATTTAGTAGAAAGTGCCTGG + Intronic
978666935 4:111195191-111195213 CAATCATAGCAGAAGGTGGAGGG - Intergenic
979260103 4:118637053-118637075 CTTTTGCACCAGAAGGTGGCAGG + Intergenic
980498688 4:133619337-133619359 CAGTTATACCAGAAGGTGGCTGG - Intergenic
983814062 4:172100977-172100999 TGTTTTTAGCAAAAGCTGGCTGG - Intronic
985365775 4:189231075-189231097 CAATTGTAGCAGAAGGTGGAGGG + Intergenic
987843886 5:23256600-23256622 CATTTTTGGCAGAAGGCAGAAGG - Intergenic
988335689 5:29906043-29906065 AATTTTTAGCAGTAGGTCCCAGG - Intergenic
991482454 5:67095999-67096021 CATTTTTAGCATAATGTCACTGG - Intronic
993418668 5:87671366-87671388 CATTTATAGCAGATGGTCTCTGG - Intergenic
994537077 5:101045891-101045913 CATTAAGAACAGAAGGTGGCAGG - Intergenic
994632444 5:102302657-102302679 CATCTCTAGCAGAAGAGGGCGGG + Intergenic
995533150 5:113110736-113110758 CATCTTTGGCTGCAGGTGGCTGG - Intronic
996093959 5:119378775-119378797 CCTTTAAAGCAAAAGGTGGCTGG + Intronic
996845540 5:127895150-127895172 CACTGTTAGAAGAAGGTGGTGGG - Intergenic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
998704941 5:144748194-144748216 CATTTTTAGCAGAAGAGGAGAGG - Intergenic
999726717 5:154444732-154444754 CATGTTTAGAAGCAGGTGGCTGG - Intergenic
999983439 5:156979695-156979717 GATTTTTAGCAGAAAGTAGTGGG - Intergenic
1001079540 5:168657210-168657232 CATTTTTAAAACAAGGTCGCTGG + Intergenic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1002437957 5:179244318-179244340 CATTATTAGGAGAAGTCGGCTGG - Intronic
1002873111 6:1185717-1185739 CAGCTTTTGCACAAGGTGGCTGG - Intergenic
1005276811 6:24228341-24228363 GATTTTAAGCAGCAGGTGGTAGG + Intronic
1005471179 6:26164166-26164188 CAGTGGTAGCAGGAGGTGGCAGG + Intronic
1007425894 6:41745860-41745882 CATTTTTAACAGAAGATTTCAGG + Intronic
1007914616 6:45549408-45549430 CATTTTTATTAGAAGGAGTCAGG - Exonic
1009542868 6:64986212-64986234 AACTTTTATCAGAAGGTGCCAGG + Intronic
1011334927 6:86249971-86249993 CAGTTATGGCAGAAGGTGGAGGG - Intergenic
1011346226 6:86372007-86372029 CAATTGTAGCAGAAGGTGAAAGG + Intergenic
1011645679 6:89455730-89455752 CAATTATAGCAGAAGGTGAAGGG - Intronic
1011996319 6:93593421-93593443 CGTCTATAGCAGAAGGTGGAAGG - Intergenic
1012149207 6:95724741-95724763 CACTTCTAGCAGAATGTTGCTGG - Intergenic
1012155639 6:95816684-95816706 CATCTTTAGCAGAAGGTAATGGG - Intergenic
1012816503 6:104028546-104028568 TAGTTTTAGGAGAAGGTGGCAGG - Intergenic
1012910190 6:105109371-105109393 CATATTGAGCAGAAAGTGGAGGG + Intronic
1012926175 6:105270147-105270169 CATTTTTAGCACTAGGTGAATGG + Intergenic
1014288538 6:119531166-119531188 CAATTTTGGCAGAAGGTGAAGGG - Intergenic
1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG + Intronic
1016599057 6:145836105-145836127 CTTTTTTTTCAGAAGGAGGCAGG - Intergenic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018116976 6:160595906-160595928 CATATTTCACAGAAGGTGGAAGG - Intronic
1018842789 6:167530525-167530547 CCTTTTTATCTGAAAGTGGCAGG - Intergenic
1021902547 7:25301058-25301080 AATTTTTAGCAGTAGGTCTCTGG + Intergenic
1024562751 7:50658294-50658316 CATTTATGGCAGAAGCTGTCAGG + Intronic
1027945489 7:84739702-84739724 AAGTGCTAGCAGAAGGTGGCAGG + Intergenic
1028656815 7:93218247-93218269 GATTTTAAGCTGAAGGAGGCAGG + Intronic
1029210714 7:98905965-98905987 CATCTTTGACAGCAGGTGGCTGG + Intronic
1033351299 7:140564334-140564356 CATTTCTAACAGAAGGGGACTGG + Intronic
1033447676 7:141436781-141436803 TATTTTTAGCAGAAGGGAGAGGG - Intronic
1033681211 7:143598464-143598486 AGTTTGTAGCAGAGGGTGGCGGG + Intergenic
1033703680 7:143863349-143863371 AGTTTGTAGCAGAGGGTGGCGGG - Exonic
1037085957 8:14850848-14850870 CATCTTCTTCAGAAGGTGGCAGG - Intronic
1037293111 8:17372198-17372220 CATTTTTAGCAGAAGGTGGCAGG - Intronic
1037383406 8:18312366-18312388 CATGTTTGGCATTAGGTGGCAGG - Intergenic
1039592550 8:38761915-38761937 AATTTTTAGGAGATGTTGGCTGG + Intronic
1040733067 8:50473287-50473309 CAGTTATAGCAGAAGGTGAAGGG - Intronic
1041601732 8:59725931-59725953 CATTTTTTCCAGAACCTGGCAGG - Intergenic
1042813539 8:72852629-72852651 CATTTTTTGCACAGGATGGCAGG + Intronic
1043924131 8:86017598-86017620 CATTTTTGGCAGAGGGCCGCTGG - Intronic
1045783035 8:105890132-105890154 AATTTTTAACAGAAGGTTTCTGG - Intergenic
1047688122 8:127321940-127321962 CAGTTATGGCAGAAGGTGACAGG - Intergenic
1050280829 9:4048297-4048319 CATGTTTAGCAGAAGATGGAAGG + Intronic
1052208186 9:25869178-25869200 CAATTATAGCAGAAGGTGAAGGG + Intergenic
1052248822 9:26372688-26372710 TATGTTTAGCAGCAGGTGGGAGG - Intergenic
1056734531 9:89196732-89196754 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1056736748 9:89216158-89216180 TATTTTTAGGAGAAGGTGGTAGG - Intergenic
1058837128 9:108867368-108867390 CCTTTTTAGAAGAAGCAGGCAGG - Intergenic
1058970654 9:110079771-110079793 GATTTTTATTAGAAGGTTGCTGG + Intronic
1059633785 9:116153697-116153719 CATTTTGAGAAGAAGGAGGGAGG + Intergenic
1060256421 9:122034939-122034961 GACTTTTAGCAGAAGGGAGCTGG - Intronic
1060863715 9:126978030-126978052 CATTTTCAGCAGGAGGAGCCTGG - Intronic
1062126019 9:134863542-134863564 CAGTGTGAGCAGAACGTGGCTGG - Intergenic
1062161345 9:135081902-135081924 CATGCTTTGCACAAGGTGGCTGG + Intronic
1185684584 X:1917871-1917893 CCTTTTTAGCACACGGTGGAAGG - Intergenic
1186117782 X:6323220-6323242 CATTTTTAGCTGAGGCAGGCGGG + Intergenic
1188617228 X:32173122-32173144 CATTTTCAGCAGCATGTGGCAGG + Intronic
1189739022 X:44099896-44099918 CATTATGACCAGAATGTGGCAGG + Intergenic
1191042438 X:56098177-56098199 CATTCATAGCAGAAGGTGAAAGG - Intergenic
1191673246 X:63768793-63768815 CATTTTAAGTGGATGGTGGCAGG - Intronic
1191952346 X:66606209-66606231 TAGTTGTAGCAGAAGCTGGCTGG + Intronic
1192165575 X:68825669-68825691 TTTATTCAGCAGAAGGTGGCAGG - Intergenic
1193308106 X:79973181-79973203 CATCTTTCACAGATGGTGGCAGG - Intergenic
1195175543 X:102311931-102311953 CATGTGTAGAAGTAGGTGGCTGG - Intronic
1195183321 X:102375162-102375184 CATGTGTAGAAGTAGGTGGCTGG + Intronic
1195890642 X:109689699-109689721 CAATTTTAAAAGAAGTTGGCTGG - Intronic
1196035157 X:111135995-111136017 CACTTTAGGTAGAAGGTGGCAGG + Intronic
1196267485 X:113667429-113667451 CATTATTAGCAAAAGGAGGGTGG + Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic