ID: 1037295162

View in Genome Browser
Species Human (GRCh38)
Location 8:17391838-17391860
Sequence AACCCCCACTTAATGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 99}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037295162_1037295171 19 Left 1037295162 8:17391838-17391860 CCACAAAACATTAAGTGGGGGTT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1037295171 8:17391880-17391902 TGGTTGTGGGAGGAAGGGTTGGG No data
1037295162_1037295163 -1 Left 1037295162 8:17391838-17391860 CCACAAAACATTAAGTGGGGGTT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1037295163 8:17391860-17391882 TATTTTTAAACCATTTTAAATGG No data
1037295162_1037295169 14 Left 1037295162 8:17391838-17391860 CCACAAAACATTAAGTGGGGGTT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1037295169 8:17391875-17391897 TTAAATGGTTGTGGGAGGAAGGG No data
1037295162_1037295167 9 Left 1037295162 8:17391838-17391860 CCACAAAACATTAAGTGGGGGTT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1037295167 8:17391870-17391892 CCATTTTAAATGGTTGTGGGAGG No data
1037295162_1037295164 5 Left 1037295162 8:17391838-17391860 CCACAAAACATTAAGTGGGGGTT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1037295164 8:17391866-17391888 TAAACCATTTTAAATGGTTGTGG No data
1037295162_1037295170 18 Left 1037295162 8:17391838-17391860 CCACAAAACATTAAGTGGGGGTT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1037295170 8:17391879-17391901 ATGGTTGTGGGAGGAAGGGTTGG No data
1037295162_1037295168 13 Left 1037295162 8:17391838-17391860 CCACAAAACATTAAGTGGGGGTT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1037295168 8:17391874-17391896 TTTAAATGGTTGTGGGAGGAAGG No data
1037295162_1037295165 6 Left 1037295162 8:17391838-17391860 CCACAAAACATTAAGTGGGGGTT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1037295165 8:17391867-17391889 AAACCATTTTAAATGGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037295162 Original CRISPR AACCCCCACTTAATGTTTTG TGG (reversed) Intronic
907484977 1:54771213-54771235 AACCCCCCTGAAATGTTTTGGGG + Intergenic
907717257 1:56938631-56938653 AACCCATTCTTAATGTTTAGCGG - Intronic
913435404 1:118842497-118842519 AACCAACACTTAATGATTTGTGG + Intergenic
914369031 1:147006020-147006042 AAACCCCAATTAATGGGTTGTGG - Intergenic
916254365 1:162771559-162771581 ATCCCCCACTTCATATTTTAAGG + Intronic
916893914 1:169141341-169141363 ATTCCCCACTTCATCTTTTGAGG - Intronic
918287383 1:183070729-183070751 AACTCCCATTTAAGATTTTGAGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
920440196 1:205975729-205975751 AACCCTCACTGAGTGTTTGGTGG - Intergenic
920852679 1:209639193-209639215 AATCCCCACTTAATTTATGGAGG - Intronic
921822522 1:219633983-219634005 AACCCCCACTGTTTGTTTTTTGG - Intergenic
1068743286 10:60499757-60499779 AAGCCCATTTTAATGTTTTGTGG + Intronic
1069089116 10:64177890-64177912 TACCCCCACTTTATGTTTCTAGG + Intergenic
1070273170 10:74978103-74978125 CAACCCCACTTCCTGTTTTGTGG + Intronic
1075218830 10:120566373-120566395 ACTCCCCACTTAAGGTTTTTTGG + Intronic
1076108814 10:127845755-127845777 AAGCCCCACTTCAGGTTCTGGGG - Intergenic
1078260996 11:9708749-9708771 ATCTTCCACTTAGTGTTTTGTGG + Intronic
1081033598 11:38114987-38115009 AACCCCTATTAAATGTCTTGAGG + Intergenic
1081330136 11:41791698-41791720 AACCCTCACTTAATGCTTGTGGG - Intergenic
1086495049 11:87394667-87394689 AACCCTCACTGAAGATTTTGAGG + Intergenic
1096742286 12:53702553-53702575 GGCCCCCACTTACTGTTGTGAGG - Intergenic
1100529501 12:95450787-95450809 AACCCCCCCTTTTTTTTTTGCGG + Intergenic
1100625903 12:96331764-96331786 TACCCCCAATTAATGTGTTCTGG + Intronic
1101823840 12:108204997-108205019 AACCTCCAGTTACTGATTTGGGG + Intronic
1103447313 12:121002525-121002547 AACCCCATCTGAATGATTTGTGG - Intronic
1110017143 13:70421105-70421127 AATCCACACAAAATGTTTTGAGG + Intergenic
1112604075 13:100886989-100887011 AACCTGCATTTATTGTTTTGAGG - Intergenic
1121061767 14:90917036-90917058 AGCCACCACTTAATGTTGTCAGG + Intronic
1125127475 15:36241070-36241092 ACCCGCCACCTAAAGTTTTGGGG + Intergenic
1127130228 15:55854782-55854804 AAACCCCAATCAATGTATTGAGG + Intronic
1127678298 15:61266824-61266846 AACCCATAATTAATGATTTGGGG - Intergenic
1143267348 17:5649908-5649930 AACCCCCAATTCAACTTTTGTGG + Intergenic
1149750831 17:59143770-59143792 AACATCCAGTTAAAGTTTTGGGG - Intronic
1150156101 17:62854716-62854738 ATCCCCAAATTCATGTTTTGTGG - Intergenic
1151114445 17:71718361-71718383 TACTCCCATTTCATGTTTTGAGG - Intergenic
1153887738 18:9481974-9481996 TTCCCTCACTTAATGTTTTCAGG + Intronic
1155574940 18:27234399-27234421 AACACCCAGCTAATTTTTTGTGG + Intergenic
1156607667 18:38686707-38686729 CACACCCACATAATGTTTGGAGG + Intergenic
1156728636 18:40161889-40161911 TACCCCTACTTAATATCTTGCGG + Intergenic
1159393005 18:67819134-67819156 TTCCCCCACATAATATTTTGGGG - Intergenic
1162649034 19:12071257-12071279 ACCCACCACTTATTGCTTTGTGG - Intronic
1164275788 19:23716672-23716694 CACGCCCAGTTAATTTTTTGTGG - Intergenic
1167214938 19:48158259-48158281 AACATCCACTTAATGTTGAGTGG + Intronic
931942469 2:67267651-67267673 AGCCCCCACTTGCTTTTTTGGGG - Intergenic
936971053 2:118176605-118176627 CACCCCCACCTACTGTTTAGGGG + Intergenic
937805723 2:126141778-126141800 AACACCAACTTTTTGTTTTGTGG + Intergenic
941954426 2:171190136-171190158 AACACTCACTTTATGTTGTGAGG - Intronic
942530605 2:176905718-176905740 AACCCAAACTTAATGTATTTTGG - Intergenic
944368213 2:198949439-198949461 AACCCCCATGTAATCATTTGGGG + Intergenic
1169962535 20:11177686-11177708 ATCCCCTACTTGATGTTTTCAGG + Intergenic
1178411673 21:32368726-32368748 AACCCCCACTTTACGTCCTGGGG - Intronic
1179342463 21:40525764-40525786 AAAATTCACTTAATGTTTTGAGG + Intronic
1184403068 22:44285138-44285160 AAACTCCACTAAATGTTTAGTGG + Intronic
950362482 3:12459486-12459508 AACCCCCACTGTGTGATTTGAGG + Intergenic
951457102 3:22904831-22904853 AACACCCCCATCATGTTTTGTGG + Intergenic
956189103 3:66591584-66591606 GACCCCTACTTAATGGTTTTAGG + Intergenic
960593234 3:119385596-119385618 AATCCCCAATAAATTTTTTGTGG - Intronic
966855430 3:184190479-184190501 AATTCCAAATTAATGTTTTGAGG + Intronic
967858756 3:194136518-194136540 AACCCCTACTTAATTTTGAGGGG - Intronic
970429415 4:15975123-15975145 AACCCTTACTTAAGGGTTTGTGG - Intronic
977360308 4:95995141-95995163 ATCCAACATTTAATGTTTTGGGG - Intergenic
977993464 4:103473830-103473852 AATCCCCATTTTATGTTTTCGGG + Intergenic
978638470 4:110840241-110840263 AACCCTCAGATAATGTGTTGTGG + Intergenic
978805665 4:112797671-112797693 AACCCCAACTTATTGTTATTAGG - Intergenic
980689622 4:136278589-136278611 AACAACTACTTATTGTTTTGTGG - Intergenic
984673188 4:182516114-182516136 AATCCCCACATAATTTGTTGTGG + Intronic
987374419 5:17219632-17219654 AACGCCCACTGACAGTTTTGAGG - Intronic
987682105 5:21149550-21149572 TACCCCCAGTTATTGTTTAGTGG - Intergenic
988190054 5:27918765-27918787 AACTACCAGTTTATGTTTTGGGG + Intergenic
990827330 5:59915849-59915871 AACCCCCACTGTATTTTTTCCGG - Intronic
996678995 5:126209406-126209428 CACCCCCACTTCTTGTTTTTAGG - Intergenic
997308832 5:132862678-132862700 AACCCCCATTTTTTTTTTTGAGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001973869 5:175980354-175980376 AACCTCCCTTTACTGTTTTGAGG - Intronic
1002243563 5:177863425-177863447 AACCTCCCTTTACTGTTTTGAGG + Intergenic
1006031770 6:31181235-31181257 AACCCCAAATTATTTTTTTGGGG - Intergenic
1015408445 6:132864095-132864117 CACCCCCACTTCCTGTTTTCTGG + Intergenic
1019053648 6:169204023-169204045 ATTCCACACTTAACGTTTTGAGG + Intergenic
1019860940 7:3657572-3657594 AAGCCTGACTTAATGTTTAGGGG + Intronic
1023254218 7:38296921-38296943 ATCCCTCTGTTAATGTTTTGGGG + Intergenic
1025008088 7:55370689-55370711 AACCCCCACTTAATCTTTCAAGG - Intronic
1026182041 7:68050085-68050107 CATGCCCACTTAATTTTTTGGGG - Intergenic
1027869516 7:83688837-83688859 ATCCCACACCTAATGTTTTTAGG - Intergenic
1029097248 7:98097486-98097508 ATCCCCCACTTTATGTATTTTGG + Intergenic
1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG + Intronic
1037295162 8:17391838-17391860 AACCCCCACTTAATGTTTTGTGG - Intronic
1037474196 8:19240266-19240288 TGCCCTCACTTAATCTTTTGAGG + Intergenic
1041799153 8:61779858-61779880 AACACCTACTTAATGTTTACCGG + Intergenic
1042518108 8:69681170-69681192 ACCATCCACTGAATGTTTTGGGG - Intronic
1046561666 8:115845710-115845732 ATCCCCAACTTAATTTTTAGTGG + Intergenic
1049059097 8:140262261-140262283 AACTCCCACTTAGTTGTTTGGGG - Intronic
1050641150 9:7668896-7668918 AACTCCCATTTCATGTTTTGTGG - Intergenic
1050745849 9:8875098-8875120 AATCCCCCTTTAAAGTTTTGGGG + Intronic
1050823778 9:9917243-9917265 AAACCCAACTTTTTGTTTTGTGG - Intronic
1051188587 9:14486751-14486773 ATACCCCAGTTAATATTTTGTGG - Intergenic
1052007206 9:23362505-23362527 ACCTCCCAATTAATCTTTTGAGG - Intergenic
1052401328 9:28003837-28003859 AATCCTCACTTAATGTTGTTAGG - Intronic
1060460204 9:123845511-123845533 CACACCCACTTAATTTTTTGGGG - Intronic
1187233810 X:17447421-17447443 AATTCCCACTTAATTTCTTGTGG - Intronic
1187287008 X:17915351-17915373 AATGCCCACTTAATGTTTTGTGG - Intergenic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1194270210 X:91804283-91804305 AACTGCCACTTCATATTTTGTGG - Intronic
1196539985 X:116896356-116896378 AACCACCACTTTATCTTTTTTGG - Intergenic
1199433290 X:147784916-147784938 AATCCCCACAAAATCTTTTGAGG - Intergenic
1200587447 Y:5025726-5025748 AACTGCCACTTCATATTTTGTGG - Intronic