ID: 1037299387

View in Genome Browser
Species Human (GRCh38)
Location 8:17435089-17435111
Sequence CACCCTTGGGGGTTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037299380_1037299387 17 Left 1037299380 8:17435049-17435071 CCAACATCTGGCATTCAGCTGTT No data
Right 1037299387 8:17435089-17435111 CACCCTTGGGGGTTTCTCACTGG No data
1037299379_1037299387 18 Left 1037299379 8:17435048-17435070 CCCAACATCTGGCATTCAGCTGT No data
Right 1037299387 8:17435089-17435111 CACCCTTGGGGGTTTCTCACTGG No data
1037299378_1037299387 19 Left 1037299378 8:17435047-17435069 CCCCAACATCTGGCATTCAGCTG No data
Right 1037299387 8:17435089-17435111 CACCCTTGGGGGTTTCTCACTGG No data
1037299377_1037299387 20 Left 1037299377 8:17435046-17435068 CCCCCAACATCTGGCATTCAGCT No data
Right 1037299387 8:17435089-17435111 CACCCTTGGGGGTTTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037299387 Original CRISPR CACCCTTGGGGGTTTCTCAC TGG Intergenic
No off target data available for this crispr