ID: 1037308606

View in Genome Browser
Species Human (GRCh38)
Location 8:17531174-17531196
Sequence AGGAGTTTCATCTGACCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037308606_1037308609 3 Left 1037308606 8:17531174-17531196 CCTGAAGGTCAGATGAAACTCCT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1037308609 8:17531200-17531222 TATAAAGAAGCAGCAAGAGCGGG No data
1037308606_1037308610 4 Left 1037308606 8:17531174-17531196 CCTGAAGGTCAGATGAAACTCCT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1037308610 8:17531201-17531223 ATAAAGAAGCAGCAAGAGCGGGG No data
1037308606_1037308612 11 Left 1037308606 8:17531174-17531196 CCTGAAGGTCAGATGAAACTCCT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1037308612 8:17531208-17531230 AGCAGCAAGAGCGGGGAGGAAGG No data
1037308606_1037308608 2 Left 1037308606 8:17531174-17531196 CCTGAAGGTCAGATGAAACTCCT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1037308608 8:17531199-17531221 TTATAAAGAAGCAGCAAGAGCGG No data
1037308606_1037308611 7 Left 1037308606 8:17531174-17531196 CCTGAAGGTCAGATGAAACTCCT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1037308611 8:17531204-17531226 AAGAAGCAGCAAGAGCGGGGAGG No data
1037308606_1037308613 12 Left 1037308606 8:17531174-17531196 CCTGAAGGTCAGATGAAACTCCT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1037308613 8:17531209-17531231 GCAGCAAGAGCGGGGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037308606 Original CRISPR AGGAGTTTCATCTGACCTTC AGG (reversed) Intronic
902162408 1:14541872-14541894 AGGTGTTTCATCTGATGATCGGG + Intergenic
906254781 1:44339894-44339916 AGGGGTTTGCTCTGACATTCTGG + Intronic
906347595 1:45028662-45028684 AGGAGATTCATTTGAACTCCGGG + Intronic
909390781 1:75119037-75119059 AGGAGTTTTGTTTGATCTTCAGG - Intergenic
909501858 1:76343627-76343649 AGGAATTTCTTCTGACCTTGGGG - Intronic
916520832 1:165562039-165562061 AGGAGTTTCCTCTAAACTTCAGG - Intronic
916892093 1:169121932-169121954 AGGGATCTCATCTGACCTTCAGG - Intronic
919943048 1:202301497-202301519 AGGACTTTCATCTGGCCTCTTGG + Intronic
920290122 1:204916102-204916124 GGCTGCTTCATCTGACCTTCTGG + Intronic
921059589 1:211572917-211572939 AGGAGTTGCATCTCTCCTGCTGG - Exonic
922274194 1:224061560-224061582 AGGAGTTACATCTGCCAGTCAGG + Intergenic
923097878 1:230789818-230789840 AGGAGTTGGTTCTGACCCTCAGG + Intronic
923642058 1:235773225-235773247 AGGAGTATCATCTGAGCCTGGGG + Intronic
1068831553 10:61501518-61501540 AGGATGTTCTTCTTACCTTCTGG + Intergenic
1075029340 10:119011442-119011464 AGGAGTTTCATCCTTCCTTTTGG - Intergenic
1079279092 11:19072162-19072184 AGCAGTTTCAGCTGGCCTTGGGG - Intergenic
1079625776 11:22615890-22615912 AGGATTTACACCTGACATTCTGG + Intergenic
1084665678 11:70574955-70574977 ATGAGTCCCATCTGTCCTTCAGG + Intronic
1085425337 11:76399707-76399729 AGGAGTTTCCTCTTACTTGCAGG - Intronic
1085806154 11:79638315-79638337 AGGAGTTTGAGCTGACTTTTAGG - Intergenic
1086955498 11:92930810-92930832 AGGAATGTCAGCTGACCATCAGG - Intergenic
1087482924 11:98723852-98723874 AGGGCTTTCATATGTCCTTCAGG + Intergenic
1093513887 12:19962259-19962281 AAGAGACTTATCTGACCTTCAGG + Intergenic
1099984868 12:89650533-89650555 AGGAGTTTCTCCTGAGCTTTAGG - Intronic
1100733672 12:97502203-97502225 AGCAGTTTCATTTGAACTTCAGG - Intergenic
1101801972 12:108030359-108030381 AGGAGTCCCATCTAACCTTTTGG + Intergenic
1103513538 12:121491375-121491397 AGGAGTTTCAGCTGAGCTGGTGG + Intronic
1106120240 13:26854010-26854032 GGGATTTTCATCTCTCCTTCTGG - Intergenic
1111022097 13:82463926-82463948 AGAAGTTTCCTCTGACATTGGGG + Intergenic
1111043217 13:82778809-82778831 AGGAGTGTCAGCTGACCTTCAGG - Intergenic
1111810182 13:93089496-93089518 AGTAGTATCATCTCCCCTTCTGG + Intergenic
1112039216 13:95529310-95529332 AGGTGTTTCATCAGATCTTCTGG + Intronic
1112737249 13:102434717-102434739 AGGAGTTTCATTCCACCTCCTGG + Intergenic
1113169651 13:107486214-107486236 AGGATATTCATCTGTCCTTACGG + Intronic
1113699328 13:112372782-112372804 AGGAGGATCACCTGACCTTGGGG - Intergenic
1113699372 13:112373086-112373108 AGGAGCATCACCTGACCTTGGGG - Intergenic
1114397345 14:22377722-22377744 AGGAGTTTCCTCTAGCCATCAGG - Intergenic
1115716068 14:36104943-36104965 AGGATTTTTCTCTGCCCTTCTGG - Intergenic
1121652992 14:95573775-95573797 AGGAATGTCAGCTGACCGTCAGG - Intergenic
1123897073 15:24839985-24840007 CAGAGTTTCATCTGGCATTCTGG + Intronic
1125534301 15:40434650-40434672 GAGAGTTTCACCTGAGCTTCGGG + Intronic
1131852324 15:96556245-96556267 AGCAGTGTCATCTGGCCTTGTGG - Intergenic
1132076424 15:98825044-98825066 AGGAGTTCGACCTGACCTCCTGG - Intronic
1133712738 16:8417178-8417200 AGAAGTTTCACCTGACCCTCAGG + Intergenic
1134361054 16:13531567-13531589 AGAAATTTGATTTGACCTTCTGG + Intergenic
1135881275 16:26260003-26260025 AGCAGTTGCATCTGATCTCCAGG - Intergenic
1137386857 16:48049834-48049856 AGGAATGTCAGCTGACCATCAGG + Intergenic
1138028671 16:53541995-53542017 AGGAGTGGAATCGGACCTTCCGG + Intergenic
1138188029 16:54991633-54991655 AGGAGTTTCCTTTTACTTTCAGG + Intergenic
1139674523 16:68514223-68514245 AGATGTTTCTTCTGACCTCCAGG + Intergenic
1146382487 17:32341502-32341524 AGGAGTTTCCTTGAACCTTCTGG - Intronic
1147224765 17:38967876-38967898 AGGGGTTTCATCAAACCTTTTGG + Intergenic
1148897183 17:50845765-50845787 AGGAGTGTCACCTGACCTCAGGG - Intergenic
1149900542 17:60473420-60473442 TGGAGGTTCATCTTACATTCAGG - Intronic
1150635803 17:66912368-66912390 ACGACCTTCATCTGTCCTTCAGG + Intergenic
1153208992 18:2737953-2737975 AGAAGTTTGATCTAACTTTCTGG - Intronic
1155291061 18:24342566-24342588 AGGAATTTCATCTTTCCTTTGGG + Intronic
1157235611 18:45962291-45962313 AGGTTTTTCCTGTGACCTTCTGG + Intronic
1158107169 18:53898861-53898883 AGAAGGCCCATCTGACCTTCTGG - Intergenic
1159745772 18:72232847-72232869 AGGAATGTCAGCTGACCATCAGG - Intergenic
1168355717 19:55698451-55698473 AGGAGCTTCATCCGAGCTCCTGG + Intronic
927750645 2:25667072-25667094 AGGTGCTTCAGCTGACCTACTGG - Intronic
932693982 2:73938277-73938299 GGGAGTCTCCTCTGACCTCCTGG + Intronic
936691213 2:114891408-114891430 AGGAGTTTGATGTGACATACAGG + Intronic
937673937 2:124568457-124568479 AGGAATCTCATTTGGCCTTCAGG - Intronic
941048208 2:160700512-160700534 AGGAGTGTGATGTGACTTTCTGG + Intergenic
943101020 2:183486669-183486691 AAAAGTTTCATGTGACCTTTTGG + Intergenic
943376700 2:187086459-187086481 AGGTGTATCATGTGAACTTCTGG - Intergenic
945335580 2:208588867-208588889 TGGAGTCTCATCTGAACCTCAGG + Intronic
1171824367 20:29880603-29880625 AGCAATTTCATCTCACCTTAAGG - Intergenic
1172396827 20:34613037-34613059 AGGAGTTTGAGATGAACTTCAGG - Intronic
1174114233 20:48215822-48215844 AGGAGTCTCCTCTGAGCTCCTGG + Intergenic
1174167566 20:48596046-48596068 AGGAGTCTCCTCTGAGCTTCTGG - Intergenic
1174689134 20:52485819-52485841 AAGAGATTCATCTTTCCTTCAGG - Intergenic
1176904281 21:14480827-14480849 AGTGGTTTCTTTTGACCTTCTGG - Intergenic
1177096351 21:16838747-16838769 AGTTGTTTCAGCTTACCTTCAGG + Intergenic
1181090887 22:20471753-20471775 AGGAGTCCCATGTGAGCTTCGGG + Intronic
1181853407 22:25765946-25765968 AGTAGCTTCTCCTGACCTTCTGG - Intronic
1185094346 22:48798273-48798295 AGGAGTTTCATGTGATTTTTGGG + Intronic
951775809 3:26309135-26309157 AGGAATTTCAGATGACCATCAGG + Intergenic
953716131 3:45318551-45318573 AGGAGTGTCAGGTGACCATCAGG - Intergenic
953844525 3:46416885-46416907 AGGAGTGTCAGGTGACCATCAGG - Intergenic
958879950 3:99658402-99658424 AGAAGTCTCCTTTGACCTTCTGG + Intronic
960591802 3:119373816-119373838 AGTAATTTCATATGACTTTCGGG - Intronic
966281758 3:178239169-178239191 AGGATTTTCATTTCACTTTCCGG - Intergenic
969206555 4:5651594-5651616 ATGATTGTCATCTAACCTTCAGG - Intronic
974274627 4:59702446-59702468 AGTAGTTTAATCTGAACTCCAGG + Intergenic
975721769 4:77255154-77255176 AGGAGTGGCATTTTACCTTCAGG + Intronic
976012848 4:80512592-80512614 AGGAGTTACATATGAACCTCAGG + Intronic
979564337 4:122137127-122137149 AGGAGAATCATCTGAGCTTGGGG + Intergenic
979877955 4:125917203-125917225 AGGGGTTTGCTCTGATCTTCAGG + Intergenic
981936089 4:150241393-150241415 ATGAGTTTCATCTCCCCCTCTGG + Intronic
982318386 4:154055272-154055294 AAGTGTTTCATCTGACCACCAGG - Intergenic
982558914 4:156904676-156904698 AGGAGGTACATTTGAGCTTCAGG - Intronic
984491260 4:180437887-180437909 AGGAAGTTCACCTCACCTTCTGG + Intergenic
984549300 4:181141802-181141824 AGGAATTTCATAAGACCTTTTGG + Intergenic
985353304 4:189090336-189090358 AGGAGTTTCCTCAGAGCTCCTGG + Intergenic
986324885 5:6665010-6665032 AGGACTCTCATATGACCTTCTGG - Intronic
986902866 5:12458664-12458686 AGATGTTTCAGCTGACCTTATGG + Intergenic
987663106 5:20903379-20903401 AGGACATTAATCTGTCCTTCAGG + Intergenic
988759581 5:34298803-34298825 AGGACATTAATCTGTCCTTCAGG - Intergenic
992280382 5:75169295-75169317 AGGAGTTTGATTTGTCCTTCAGG - Intronic
992540447 5:77759034-77759056 AGGAGTGTCAGGTGACCGTCAGG - Intronic
995160438 5:108974394-108974416 AGGAGGTGCATCTGATCTTGGGG + Intronic
995444140 5:112223935-112223957 AAGAGTTTCATTTGAACTTTAGG + Intronic
997295932 5:132768386-132768408 AGGAGACTGATCTGACCTCCAGG + Intronic
1000169562 5:158688605-158688627 AGGAGTCTAATCTAATCTTCAGG + Intergenic
1001000147 5:167997980-167998002 AGTAATTGCATCTGACTTTCTGG + Intronic
1002157408 5:177294111-177294133 AGGAGGTTTATCTGACATTTTGG - Exonic
1003871964 6:10411076-10411098 AGGCGTTTCTTCTGCCCTTTGGG - Intronic
1004467726 6:15901532-15901554 AGGAGTGTCAGGTGACCATCAGG - Intergenic
1005105954 6:22224368-22224390 TGCAGTCTCATCTAACCTTCTGG + Intergenic
1006269483 6:32952933-32952955 AGGAGTACCATCTTACCTTCAGG + Exonic
1006324383 6:33342305-33342327 AGGAGGATCATCTGACCTGGAGG + Intergenic
1007619752 6:43204702-43204724 AGGGGTTTCATCTCAGCCTCTGG - Intronic
1013670807 6:112400266-112400288 AGGTGTTTGATCTGTCCTTTTGG + Intergenic
1014151845 6:118066358-118066380 AGGAGTTTCAGGTGACCTCTAGG + Intronic
1017662269 6:156686727-156686749 AGGAGATGCAACTAACCTTCCGG + Intergenic
1020788090 7:12593630-12593652 AGGATTTTCATCTGCCTTTTGGG + Intronic
1024503386 7:50138498-50138520 TGGAATTTCATCTGATTTTCTGG + Intronic
1025770744 7:64503404-64503426 AGGAGTTTCACCTGTCATCCAGG + Intergenic
1027123177 7:75536941-75536963 AGCAATTGCATCTGATCTTCCGG + Exonic
1028656082 7:93208605-93208627 ATGAGTTTCATCTTGCCTGCCGG + Exonic
1029727193 7:102414791-102414813 AGGAGGATCACCTGACCTTGGGG + Intronic
1032627755 7:133611011-133611033 TGGAGTTTCACCTGAACTCCCGG + Intronic
1033897407 7:146090916-146090938 CGGAGTTTCATTTTACCATCTGG + Intergenic
1035157747 7:156928098-156928120 AGGAGTGTCAGGTGACCATCAGG + Intergenic
1037308606 8:17531174-17531196 AGGAGTTTCATCTGACCTTCAGG - Intronic
1039618793 8:38977976-38977998 GGGAAGATCATCTGACCTTCGGG + Exonic
1040857471 8:51962734-51962756 AGGAATTTGGTTTGACCTTCTGG - Intergenic
1041500695 8:58535255-58535277 AGGGATTTTCTCTGACCTTCTGG + Intergenic
1044888457 8:96805918-96805940 CGGGGTTGCATATGACCTTCTGG + Intronic
1046543765 8:115620756-115620778 AGGTCTTTCTTCTGACTTTCAGG - Intronic
1046903509 8:119547257-119547279 AGGAGTTTAACATGAACTTCAGG + Intergenic
1047536536 8:125725285-125725307 TGGAGTTTAATCTGAAGTTCTGG + Intergenic
1051951894 9:22645935-22645957 AGGTGGTTCATAGGACCTTCAGG + Intergenic
1051972913 9:22912806-22912828 AGGAATGTCAGCTGACCATCAGG + Intergenic
1052155174 9:25178281-25178303 AAGAGTTTCACCTGATGTTCTGG + Intergenic
1053667982 9:40329943-40329965 AGCAGTTTCATCAGAAGTTCAGG - Intergenic
1053748840 9:41233594-41233616 AGCAATTTCATCTCACCTTAAGG + Intergenic
1054337537 9:63819793-63819815 AGCAATTTCATCTCACCTTAAGG - Intergenic
1054516629 9:66046342-66046364 AGCAGTTTCATCAGAAGTTCAGG + Intergenic
1056810722 9:89761889-89761911 AGGATTGTCATCTGAGCTTCTGG - Intergenic
1057821736 9:98336723-98336745 AGGATTTACATCTGCCATTCTGG - Intronic
1060456017 9:123798506-123798528 GGGAGTTTCATCTTTCTTTCTGG + Intronic
1060846602 9:126842433-126842455 TGGGGTTTCCTCTGACATTCTGG - Intergenic
1203377438 Un_KI270442v1:387043-387065 AGCAATTTCATCTCACCTTAAGG - Intergenic
1186164673 X:6813927-6813949 AGGAGTCACATCTGGGCTTCAGG + Intergenic
1186617105 X:11200743-11200765 AAGAGTTCCATCTGACTTCCTGG - Intronic
1187480853 X:19653842-19653864 TGGAGTTTCTTCTGAACTTTGGG - Intronic
1187764153 X:22621027-22621049 AGCTGTGTCATCTGAGCTTCAGG + Intergenic
1189537157 X:41947330-41947352 AAGTGTCTTATCTGACCTTCTGG + Intergenic
1191224321 X:58026146-58026168 AGGAGTTTCAACAGGCTTTCGGG + Intergenic
1191778587 X:64844408-64844430 AGGACTTTCATCTGCCCTCTGGG - Intergenic
1192671036 X:73141774-73141796 TGGGGCTTCATCTGCCCTTCAGG + Intergenic
1201558809 Y:15292962-15292984 AGGAGTCACATCTGGGCTTCAGG + Intergenic