ID: 1037308610

View in Genome Browser
Species Human (GRCh38)
Location 8:17531201-17531223
Sequence ATAAAGAAGCAGCAAGAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037308606_1037308610 4 Left 1037308606 8:17531174-17531196 CCTGAAGGTCAGATGAAACTCCT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1037308610 8:17531201-17531223 ATAAAGAAGCAGCAAGAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037308610 Original CRISPR ATAAAGAAGCAGCAAGAGCG GGG Intronic
No off target data available for this crispr