ID: 1037309102

View in Genome Browser
Species Human (GRCh38)
Location 8:17536157-17536179
Sequence TCAGGGCCCCAGGAATACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037309102_1037309107 11 Left 1037309102 8:17536157-17536179 CCTTGGTATTCCTGGGGCCCTGA 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1037309107 8:17536191-17536213 ATGCTCCTCATTCCAACAGTGGG No data
1037309102_1037309109 17 Left 1037309102 8:17536157-17536179 CCTTGGTATTCCTGGGGCCCTGA 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1037309109 8:17536197-17536219 CTCATTCCAACAGTGGGCATTGG No data
1037309102_1037309106 10 Left 1037309102 8:17536157-17536179 CCTTGGTATTCCTGGGGCCCTGA 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1037309106 8:17536190-17536212 CATGCTCCTCATTCCAACAGTGG No data
1037309102_1037309110 18 Left 1037309102 8:17536157-17536179 CCTTGGTATTCCTGGGGCCCTGA 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1037309110 8:17536198-17536220 TCATTCCAACAGTGGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037309102 Original CRISPR TCAGGGCCCCAGGAATACCA AGG (reversed) Intronic
900410602 1:2510891-2510913 TCAGGGCCCCAGAGATGCCAGGG + Intronic
900833951 1:4985560-4985582 TGAGAGCCACAGGAAGACCATGG - Intergenic
900972902 1:6001250-6001272 TCAGGGCTCCAAGAGCACCAAGG - Intronic
901735756 1:11311134-11311156 TCAGGGGACCAGGCATACCTGGG + Intergenic
902193518 1:14780709-14780731 GCATGGCACCTGGAATACCATGG + Intronic
902271848 1:15310397-15310419 TCTGGGCACCAGGCATCCCAGGG + Intronic
903072469 1:20733047-20733069 TGAGGGCCCCTGGAGTTCCAGGG + Intergenic
904746473 1:32714376-32714398 GCAGGGCCCTAGGCATAACATGG - Intergenic
905082714 1:35338533-35338555 CCAAAGCCCCAGTAATACCAAGG + Intronic
907393772 1:54175899-54175921 TCAATCCCCCATGAATACCAAGG + Intronic
907787409 1:57626269-57626291 TCTGGGCTGCAGGAACACCAGGG + Intronic
908956202 1:69631541-69631563 CCAGGGCCCCAGGGAGGCCAAGG + Intronic
909379585 1:74983091-74983113 TCTGGGCCATAGGAATATCAGGG + Intergenic
910432203 1:87169909-87169931 TCTGGGCCCCAGGAATTACTGGG + Intergenic
911105664 1:94129551-94129573 TCTTGGCCCCAGGAAAAGCAAGG + Intergenic
912701888 1:111884174-111884196 TCAGAGCCCCAGGATCCCCAAGG - Intronic
920593148 1:207241840-207241862 ACAGGGCCCCAGGAAAGCCTGGG + Intergenic
922322654 1:224502157-224502179 TGAGGACCCCAAGAAAACCAGGG - Intronic
923314354 1:232765484-232765506 TAAGGGCCCTATGAATACCCGGG + Intergenic
923751846 1:236753921-236753943 TCAGGGCCCAAGGACAACAAGGG - Intronic
923836667 1:237618467-237618489 TCAGGACCCAAGGAACAACATGG + Intronic
924454876 1:244211177-244211199 CCAGGGCCCCAGGGAGACCCAGG - Intergenic
1063618388 10:7622181-7622203 TCAGGCCACCAGGACTCCCAGGG + Intronic
1064380728 10:14838890-14838912 TCAGGGCCTCAGGATTCCCGCGG + Intronic
1066616504 10:37300366-37300388 TCAGGGCCCCAGGAAGAAGGGGG - Intronic
1069890652 10:71650279-71650301 TCAGGGAAGCAGGAATACCAAGG + Intronic
1070471017 10:76779588-76779610 TCAGGGACCCAGAAATCTCAAGG - Intergenic
1071372288 10:84964049-84964071 TCAGGACCCAAAGAATAGCATGG - Intergenic
1075549484 10:123381650-123381672 TCAGGGCCACAGGAGGAGCAAGG + Intergenic
1075995456 10:126873179-126873201 TCAGGGCCCCATGAATGTAAGGG + Intergenic
1076597165 10:131631013-131631035 TCTGGGCCTCAGGGATGCCAAGG - Intergenic
1076703845 10:132290612-132290634 TAAGGTCCCCAGGACTACCCAGG + Intronic
1076880282 10:133236460-133236482 GCAGGGTCCGAGGAAGACCAGGG + Intergenic
1078503579 11:11910242-11910264 TCAGCACCCAAGGAATAACACGG + Intronic
1079084239 11:17433779-17433801 CCAGGGCCCCAGCCATACGAGGG - Intronic
1080091659 11:28355779-28355801 CCAGTCCCCCAGGCATACCAAGG + Intergenic
1081649708 11:44815614-44815636 GAATGGCCCCAGGGATACCATGG + Intronic
1081666745 11:44921092-44921114 TCAGGGCCTCAGGAATCCATGGG - Intronic
1082994614 11:59242418-59242440 TCTAGGCCCCAGGACTATCATGG + Intergenic
1083872206 11:65495890-65495912 CCAAGGCCCCATGGATACCAAGG + Intergenic
1084223205 11:67697516-67697538 TCAGAGCCCCAGGATTCCCATGG + Intergenic
1085588893 11:77738535-77738557 CCAGTGCCCCATGGATACCAAGG + Intronic
1086074989 11:82841138-82841160 TCTGGGCAGCAGGAATAACAGGG + Intronic
1086324327 11:85682795-85682817 TTAGGCCCCAAGGATTACCACGG + Intronic
1086967865 11:93048464-93048486 TCAGGGAGCCATGATTACCATGG + Intergenic
1088883541 11:113989836-113989858 TCAGGACCCAGGGAATGCCAGGG + Exonic
1089554806 11:119310501-119310523 TCAGGGCCACAGGAAGAGAAGGG + Intronic
1091989983 12:4947401-4947423 TCAGAGCCCCGGGAAGCCCAGGG - Intergenic
1092291059 12:7159637-7159659 TCCTGGCCCAAGAAATACCAGGG + Intergenic
1096839989 12:54374287-54374309 TCTGAGCCCCAGGAATAACCAGG - Intronic
1097406807 12:59199026-59199048 ACAGTGGTCCAGGAATACCAAGG - Intergenic
1101557406 12:105823171-105823193 CCAGGGACCCAGGAAGAACAAGG + Intergenic
1103020099 12:117526780-117526802 TCAGGGCCGGGTGAATACCAAGG - Intronic
1105589700 13:21780246-21780268 TCAGGGCCCTAGGATTTTCAAGG - Intergenic
1106024962 13:25947716-25947738 TCACGGCCCCAGGAAGAAGAGGG - Intronic
1106029805 13:25989935-25989957 CCAGGGCCAAAGGATTACCAAGG - Intronic
1116353491 14:43897072-43897094 TCAGTGCCCCAGGTACATCATGG - Intergenic
1119671640 14:76524336-76524358 TCAGGTCCCAAGGAACAACATGG - Intergenic
1119712354 14:76831333-76831355 CCTGGGCCCCAGGGGTACCAAGG + Exonic
1121299684 14:92860750-92860772 TCAGGACCCAAGGACTCCCAGGG + Intergenic
1121739511 14:96241564-96241586 GCATGGGCCCAGGAATGCCAAGG + Exonic
1122011743 14:98755357-98755379 TCAGGCCCACAGGAATAGAAGGG + Intergenic
1122391924 14:101395324-101395346 AGAGGGCCCCAGGCAAACCATGG - Intergenic
1122857147 14:104565430-104565452 TCTGGGCCCCAGGGCTTCCAAGG + Intronic
1202897271 14_GL000194v1_random:17410-17432 TCTGGGCCCCAGGTATACCCTGG + Intergenic
1124003492 15:25778659-25778681 TCAGGGCCCCAGGAATGCTGAGG - Intronic
1124694287 15:31850797-31850819 TCAGGCCTCCAAGAGTACCATGG - Intronic
1126790126 15:52213244-52213266 TCAGGACCCAAGGAGTACCTTGG - Exonic
1127983690 15:64052038-64052060 GCAGGGCCCCAGGCAGAGCAGGG - Intronic
1132589238 16:719250-719272 ACAGGGCCACAGGAGCACCACGG + Exonic
1132747492 16:1443069-1443091 TCAGAGGCCCAGGAAAGCCATGG - Intronic
1136723460 16:32340740-32340762 TCAGGGCCAGAGGAGAACCAGGG + Intergenic
1136773470 16:32859573-32859595 TCAGGGCCAGAGGAGAACCAGGG - Intergenic
1136841804 16:33546818-33546840 TCAGGGCCAGAGGAGAACCAGGG + Intergenic
1136862515 16:33712157-33712179 TCAGGGCCAGAGGAGAACCAGGG - Intergenic
1136897142 16:34001946-34001968 TCAGGGCCAGAGGAGAACCAGGG + Intergenic
1141154656 16:81588831-81588853 ACAGGGCCACAGGAAGACGACGG - Intronic
1142140726 16:88471637-88471659 TCAGGGCCCCAAGATGACCGTGG + Intronic
1203002972 16_KI270728v1_random:177025-177047 TCAGGGCCAGAGGAGAACCAGGG - Intergenic
1203075886 16_KI270728v1_random:1121683-1121705 TCAGGGCCAGAGGAGAACCAGGG - Intergenic
1203123997 16_KI270728v1_random:1560317-1560339 TCAGGGCCAGAGGAGAACCAGGG - Intergenic
1203134577 16_KI270728v1_random:1713431-1713453 TCAGGGCCAGAGGAGAACCAGGG - Intergenic
1203151969 16_KI270728v1_random:1847115-1847137 TCAGGGCCAGAGGAGAACCAGGG + Intergenic
1143403914 17:6664085-6664107 TCAAGGCCTCAGGAATTCCTGGG + Intergenic
1143659978 17:8318771-8318793 TCACGGCGCCTGGAATTCCAGGG + Exonic
1145211337 17:21015420-21015442 ACAGGGTCCCAGAAATGCCAGGG + Intronic
1146762706 17:35492370-35492392 ACAGGGGCCCAGGAAGCCCAAGG - Intronic
1148048989 17:44759940-44759962 TCAGAGCCCCAGGAAGCCCACGG + Intronic
1148050837 17:44769317-44769339 GGAGGGCCCCAGGAGTATCATGG - Intronic
1148051321 17:44771449-44771471 CCAGAGCCCCAGGCATACCCAGG + Intronic
1148921251 17:51036692-51036714 TCAGGGCCCCAGCAACATTAAGG - Intronic
1151398716 17:73841996-73842018 TCAAGGCCCCAGAAATTCCTTGG - Intergenic
1151502045 17:74496566-74496588 TCAGAGCCTCAGGAAAACCTTGG + Intergenic
1152011961 17:77724317-77724339 TGAGGGCCCCAGGAAGCCCTTGG - Intergenic
1152160207 17:78664061-78664083 TCAGGGCCCAAGGGATACCATGG - Intergenic
1153649719 18:7229340-7229362 TCAGGGTCCCAGGAGCAGCAGGG + Intergenic
1154989952 18:21591287-21591309 TCATAGGCCCAGGAATGCCAGGG + Intronic
1155640153 18:28004024-28004046 TCAGAACCCAAGGTATACCATGG - Intronic
1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG + Intronic
1157434206 18:47654734-47654756 TCAGGCTCCCAGGAATTCCTAGG - Intergenic
1157494005 18:48142531-48142553 TGAGGGCCCCAGGGCTGCCAGGG + Intronic
1158535908 18:58308311-58308333 ACAGGACCCCAGTAATACCTGGG + Intronic
1158748468 18:60228717-60228739 TCAGGGCATCAGGAACAGCATGG + Intergenic
1158847612 18:61461463-61461485 TCATGGCCCCAGGCATCCCTTGG + Intronic
1159979866 18:74765148-74765170 CCAATTCCCCAGGAATACCAAGG + Intronic
1160566582 18:79789879-79789901 TCATGGCCTCTGGAATACCAAGG - Intergenic
1161991009 19:7684200-7684222 TAAGGTCCCCAGGAATCCCCTGG - Exonic
1166377203 19:42334230-42334252 TCAGGGCCCCAGGGGAAACAGGG - Intronic
1167461139 19:49625348-49625370 TCAGTGTCCCAGGGAGACCAGGG - Intronic
1167672434 19:50861155-50861177 CCAAGGCCCCAGGTATACCAAGG + Intergenic
926195950 2:10763590-10763612 CCAGGGGCACAGGAATTCCAGGG + Intronic
926613940 2:14976086-14976108 TCAGGGCCCTAGGAATAATGGGG + Intergenic
926765884 2:16322418-16322440 ACAGGACCCCAGGAATGCTAAGG - Intergenic
928915879 2:36469808-36469830 ACAAGGCCCCAGGAACACGAGGG - Intronic
929978417 2:46656613-46656635 TTATGGCCCCAGGAATTTCAAGG - Intergenic
933251879 2:80038343-80038365 TCAGAGCCCCAGGAAGCCCCAGG - Intronic
934934626 2:98455845-98455867 TCAGAGACCCTGGAGTACCAAGG + Intronic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
938027101 2:127959157-127959179 TCGGGACCCCAGGAATGGCACGG + Intronic
939422491 2:141991939-141991961 CCAGTCCCACAGGAATACCAGGG - Intronic
940279875 2:151978227-151978249 TCCAGGCCCCATGAAGACCATGG + Intronic
940648526 2:156417029-156417051 TCAGTGCCACAGGATTACAAAGG - Intergenic
942665885 2:178316855-178316877 TCAGTCCCCCAAGGATACCAAGG + Intronic
943285011 2:185986864-185986886 TCTGGGTTCCAGGAAAACCATGG - Intergenic
943660453 2:190554276-190554298 TCAGTGCGCCTGGAACACCAGGG + Intergenic
944507735 2:200430175-200430197 TCCAGGCCCCAGAAATACAATGG - Intronic
948456903 2:238108793-238108815 CCGGGGCCCCAGGAAGACCTTGG - Intronic
1168853156 20:990225-990247 TCAGGTCCCGAGGCACACCAGGG + Intronic
1170336698 20:15278065-15278087 TCAGGGTCCCAGTGATAGCAAGG + Intronic
1170719072 20:18859524-18859546 AAAGGGCCCCAGGTATACCTGGG + Intergenic
1172385680 20:34532502-34532524 TTAGGCCCCCAGGAATGCGAGGG + Intronic
1173458281 20:43221468-43221490 TCAGGCCCCCAGGAAGCTCATGG - Intergenic
1173782932 20:45771613-45771635 CCTTGGCCCCAGCAATACCATGG - Intronic
1174573753 20:51523176-51523198 GCAGGGCCCCAGGAACTCCACGG + Exonic
1176616955 21:9033399-9033421 TCTGGGCCCCAGGTATACCCTGG + Intergenic
1177820029 21:26021510-26021532 TCACTGCCAAAGGAATACCAAGG + Intronic
1178095675 21:29212500-29212522 TCTGGGCCCCAGCAACAGCACGG - Intronic
1178144967 21:29728694-29728716 TCTGGGCCCTAGGGATACAAAGG + Intronic
1178671527 21:34595631-34595653 TCAGGTTCCCAGGAAGGCCAGGG + Intronic
1182288787 22:29263730-29263752 TGAAGGCCCAAGCAATACCAAGG - Intronic
1182575912 22:31272764-31272786 TCAGAGCCCTGGGAATTCCAGGG + Intronic
1183656929 22:39191503-39191525 CCGGGACCCCAGGAACACCATGG + Intergenic
1184015761 22:41784659-41784681 TGAGGGCACCAGGGCTACCAGGG - Exonic
1184278147 22:43422064-43422086 TCAGGGTCCCAGGAAGAGCCCGG - Intronic
1184369602 22:44074242-44074264 TCAGGGGCTCAGAAATGCCAGGG - Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185141166 22:49102096-49102118 TCAAGGTCTCAGGAATAACAGGG - Intergenic
1185339853 22:50286387-50286409 GCAGGGCCCCCTGAAGACCAGGG - Intronic
950526000 3:13523640-13523662 GCAGACCCCCAGGAATCCCAAGG + Intergenic
951641869 3:24845387-24845409 TCAGGGACCCAGGATAACAAAGG + Intergenic
953770306 3:45774619-45774641 CCATGGGCCCTGGAATACCATGG + Intronic
959579184 3:107966921-107966943 TCAGGGCCACAGTAAGAGCAGGG - Intergenic
959684638 3:109131003-109131025 TCAAGGACCCAGGAATTTCAAGG + Intergenic
959970441 3:112403361-112403383 TCAAGGCCCCAGGCCTATCATGG - Intergenic
960813335 3:121647362-121647384 TCAGGGCCCAAAGCATCCCATGG - Exonic
961055948 3:123789116-123789138 CCAGGGCTCCACGAATGCCAGGG - Intronic
964925521 3:161951861-161951883 TCTAGGCCCCAGAAATACAACGG - Intergenic
965114257 3:164467186-164467208 TCAGGGACCAAGGATTATCACGG + Intergenic
967543170 3:190692930-190692952 TCAGGTTCCCAAGAAAACCAAGG - Intergenic
968131839 3:196196692-196196714 TCAGGGCCCCAGAAATGGTAAGG + Intergenic
969193512 4:5542891-5542913 TCAGTGGCCCTGGAACACCAAGG - Intronic
970519457 4:16867397-16867419 TCAGGGCACTAGAAATACAAAGG + Intronic
975399119 4:73914126-73914148 TCTATGCCCCAGCAATACCATGG - Intergenic
980565253 4:134531280-134531302 TCTGGGCTCCAAGAATAGCAAGG - Intergenic
981505678 4:145496721-145496743 CCAGTGCCCCAGGTATACCAAGG + Intronic
984885949 4:184449451-184449473 TCTGGGCCCTGGGAATAGCATGG - Intronic
984934766 4:184880546-184880568 TAGTGGCCCCAGGAATTCCATGG + Intergenic
986343957 5:6817242-6817264 TCTTGGCTCCAGCAATACCAGGG + Intergenic
986572596 5:9181100-9181122 TCAGGCCCCCAGGTACATCAGGG + Intronic
988484592 5:31658181-31658203 TCAGGGCCCCAGTCACCCCAGGG + Intronic
993493859 5:88586076-88586098 TCTAGGCCCTGGGAATACCAAGG + Intergenic
995709334 5:115018995-115019017 TCATGTCCATAGGAATACCAAGG + Intergenic
996528810 5:124505512-124505534 TCAGGGGTCCAGGAAAACCTGGG - Intergenic
998477867 5:142436533-142436555 TCAGAACCCCAGGAATGCCTAGG - Intergenic
999795702 5:154987942-154987964 TCAGGACCCCAGGTTTTCCAAGG - Intergenic
1002055013 5:176593819-176593841 ACAGGGGCCCAGGTATAACACGG + Intronic
1003057947 6:2840446-2840468 TCTGGTCCCCAGAAAAACCATGG + Exonic
1004513930 6:16306077-16306099 TCAGGGCTCCAGGCATCCCCGGG - Exonic
1005814510 6:29539864-29539886 TCATAGCCCTAGGAAAACCAAGG + Intergenic
1007341674 6:41194591-41194613 CCAGGGACCCAGGAGGACCATGG - Exonic
1007452868 6:41953512-41953534 TCAGTGCCCAAGGAATCTCATGG + Intronic
1009380066 6:63016698-63016720 TCAGGGCTCTTGGGATACCAGGG - Intergenic
1014469163 6:121793922-121793944 ACAGGGCCCCAGCATGACCAAGG + Intergenic
1014867792 6:126553132-126553154 TCAGGGCCCCTGGAAAAAGATGG + Intergenic
1015358021 6:132303381-132303403 TCAGTCCCCCATGGATACCAAGG - Intronic
1015842731 6:137491141-137491163 TCAGGGACCCAGGAAAGACAGGG + Intergenic
1016244603 6:141967213-141967235 TCATGGCCCCAGCTATACCTTGG + Intergenic
1016340354 6:143055395-143055417 TGAGGATCCCAGGAATCCCAAGG - Intergenic
1018027586 6:159818101-159818123 GCAGGGCCCCGGCAAAACCACGG - Intronic
1020070998 7:5227007-5227029 TCAGGGCCCCAGGGGCATCACGG - Intronic
1020901167 7:14005259-14005281 TCTGAGCCCCAGTAATACCATGG - Intergenic
1025192038 7:56903098-56903120 CCATGGCCCCAGGAATAGAATGG + Intergenic
1025679914 7:63673833-63673855 CCATGGCCCCAGGAATAGAATGG - Intergenic
1027260705 7:76462354-76462376 CCAGGGCCCCAGGAACTCCTGGG - Intronic
1027312084 7:76960467-76960489 CCAGGGCCCCAGGAACTCCTGGG - Intergenic
1029083079 7:97990043-97990065 GCAGCGCTCCAGGAATGCCAAGG - Exonic
1029446386 7:100615161-100615183 TCAGGTCCGGAGGAACACCATGG - Exonic
1030434800 7:109502809-109502831 TCAGGACCCAAGGAACAACATGG - Intergenic
1032145288 7:129374045-129374067 TCAGGGCCCCAAGATTATCCGGG + Intronic
1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG + Intronic
1034419044 7:150979410-150979432 GCAGGGCCCCGGGAAGGCCAGGG + Intergenic
1034957611 7:155344615-155344637 GGAGGGCCCCAGGAAGACCCTGG - Intergenic
1035106450 7:156445405-156445427 TCTGTGCCCAAGGAACACCAAGG - Intergenic
1037309102 8:17536157-17536179 TCAGGGCCCCAGGAATACCAAGG - Intronic
1038235189 8:25746150-25746172 GCAAGGCCCCAGGAATGCAAAGG + Intergenic
1040494775 8:47956819-47956841 TCAGGGCCCCAGGGAGCCCAGGG + Intronic
1043158290 8:76814446-76814468 CCATGGACCCAGGAATTCCATGG + Intronic
1044669512 8:94664732-94664754 TCAGGGCACGAGGTTTACCATGG + Exonic
1045321021 8:101081182-101081204 ACGGGGCCACAGGCATACCAAGG + Intergenic
1047489344 8:125361906-125361928 TCTGGGTCCCAAGAATTCCAAGG - Intronic
1049507505 8:143011321-143011343 TCAGGACCCCTGGAAGCCCACGG - Intergenic
1049544298 8:143222213-143222235 TCATGCCGCCAGGAACACCAGGG - Intergenic
1052343116 9:27382396-27382418 TCAGGGCACCAGGAATAACTAGG - Intronic
1055375129 9:75640648-75640670 TCTGTGGCTCAGGAATACCAGGG - Intergenic
1055558903 9:77503033-77503055 TCAGGGCCCAAGGAAGGACACGG - Intronic
1056200181 9:84267974-84267996 CCAATCCCCCAGGAATACCAAGG - Intergenic
1056397886 9:86198023-86198045 TCAGGGGCACAGGAACACAAGGG + Intergenic
1057213843 9:93217632-93217654 TCAGGGCCACAGGAGGACCATGG - Intronic
1057281597 9:93716646-93716668 TCTGGGCCCCACTGATACCAGGG + Intergenic
1059180374 9:112206581-112206603 TCAAGACCCCATGGATACCAAGG + Intergenic
1059336558 9:113572679-113572701 TCAGGGCCCAAGGCATAGCCAGG - Intronic
1059404820 9:114093136-114093158 CCAGAGCCCCAGGGATTCCAGGG - Intronic
1060679820 9:125552285-125552307 CCTGGGCCCCAGGAATCCCCTGG - Intronic
1061309657 9:129753821-129753843 TCATGGCCCAAGGAATACCAGGG + Intergenic
1061564212 9:131426893-131426915 CCATGGGCCAAGGAATACCAGGG - Intronic
1061746722 9:132745622-132745644 TCAGGGCCCCAGTGTCACCACGG - Intronic
1061944335 9:133900288-133900310 TCTGAGCCCCAGTATTACCAGGG - Intronic
1062193023 9:135257327-135257349 TCAGGGCCGCTGGAGGACCAGGG - Intergenic
1203760248 EBV:9232-9254 CCAGGGGCCCAGGAAGACTACGG - Intergenic
1186768570 X:12795150-12795172 TAAGGGCCCCATGATTACAATGG + Intronic
1186783391 X:12935879-12935901 TCAAGGCCCAGGGACTACCATGG - Intergenic
1192165274 X:68823993-68824015 TCAGGGGCACAGGAATTCGAGGG - Intergenic
1194044704 X:88987625-88987647 TCAGAGCCCAAGGACTATCATGG + Intergenic
1194525067 X:94968068-94968090 TCTGGGCCACAGAAATGCCAGGG + Intergenic
1194678948 X:96828125-96828147 ACAGGGTCCCAGGAATACCCTGG + Intronic
1194710665 X:97232657-97232679 TCAGAGCAACAGGAATATCAGGG - Intronic
1197064338 X:122220773-122220795 TCAGGGGCCCAGGACCAGCATGG + Intergenic
1200119494 X:153783635-153783657 TCCGGGCCCCAGGGCTCCCATGG - Intronic
1201150355 Y:11092250-11092272 TCTGGGCCCCAGGTATACCCTGG + Intergenic
1201257505 Y:12123712-12123734 TCAATCCCCCATGAATACCAAGG + Intergenic