ID: 1037312473

View in Genome Browser
Species Human (GRCh38)
Location 8:17571407-17571429
Sequence GACTCAGATAGGCTTCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037312466_1037312473 30 Left 1037312466 8:17571354-17571376 CCAGCCAGAAGCTCCCGGAGAGA No data
Right 1037312473 8:17571407-17571429 GACTCAGATAGGCTTCCTTTTGG No data
1037312468_1037312473 26 Left 1037312468 8:17571358-17571380 CCAGAAGCTCCCGGAGAGAGGAA No data
Right 1037312473 8:17571407-17571429 GACTCAGATAGGCTTCCTTTTGG No data
1037312469_1037312473 17 Left 1037312469 8:17571367-17571389 CCCGGAGAGAGGAATATGATCTT No data
Right 1037312473 8:17571407-17571429 GACTCAGATAGGCTTCCTTTTGG No data
1037312470_1037312473 16 Left 1037312470 8:17571368-17571390 CCGGAGAGAGGAATATGATCTTC No data
Right 1037312473 8:17571407-17571429 GACTCAGATAGGCTTCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037312473 Original CRISPR GACTCAGATAGGCTTCCTTT TGG Intergenic
No off target data available for this crispr