ID: 1037313125

View in Genome Browser
Species Human (GRCh38)
Location 8:17577119-17577141
Sequence CGGTTTCTTCAGGAGGAACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037313125_1037313130 2 Left 1037313125 8:17577119-17577141 CCTTGTTCCTCCTGAAGAAACCG 0: 1
1: 0
2: 0
3: 6
4: 181
Right 1037313130 8:17577144-17577166 TCCTCCCGCTTCGGCGTCCCAGG 0: 1
1: 0
2: 15
3: 332
4: 2488
1037313125_1037313128 -7 Left 1037313125 8:17577119-17577141 CCTTGTTCCTCCTGAAGAAACCG 0: 1
1: 0
2: 0
3: 6
4: 181
Right 1037313128 8:17577135-17577157 GAAACCGAATCCTCCCGCTTCGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037313125 Original CRISPR CGGTTTCTTCAGGAGGAACA AGG (reversed) Exonic
903461110 1:23521614-23521636 CGATTACTTCAGCAGGTACACGG + Intronic
903540886 1:24095641-24095663 CAGTTTCTTCAGCAGTAAAATGG + Intronic
904131477 1:28278946-28278968 CTGTTTCTCCAAGAGGAACTAGG + Intronic
906516836 1:46444074-46444096 CTGTTTCTTCACCAGGAAAATGG + Intergenic
910569083 1:88680326-88680348 GGGTTTCTTAAGGAAGAAGAGGG + Intergenic
912189599 1:107322335-107322357 CACTTTTTTCAGGAGGAAGATGG + Intronic
915708709 1:157872456-157872478 TAGTGTCTTCAGGAGGAACAAGG - Intronic
916360242 1:163959769-163959791 CAGTTTCTGCAGGGGGAAAAGGG - Intergenic
920954262 1:210603128-210603150 CAGTTTCTTCTGGAGTAAGACGG + Intronic
921100793 1:211927609-211927631 AGGTTTCTTTAGGAGAAACTAGG + Intergenic
1063445056 10:6108092-6108114 CAGTTTCTTCAGGAGCCAGAAGG + Intronic
1063454305 10:6172514-6172536 CGGTTTCCTCATTTGGAACATGG - Intronic
1064751060 10:18529480-18529502 CTGTTGCTGCAGGAGGCACAGGG + Intronic
1067056654 10:43056556-43056578 CGATTTCACCAGGAGGAACTGGG - Intergenic
1068617258 10:59132799-59132821 AGGTGTCTTCAGGGAGAACAGGG + Intergenic
1073315371 10:102577028-102577050 TGGTCTCTTCAGGAAGAAGATGG + Intronic
1076290731 10:129343551-129343573 CGGTTTCTGGAGGGGGCACAGGG - Intergenic
1076644360 10:131942189-131942211 GGGTCTGATCAGGAGGAACAGGG - Intronic
1077615263 11:3669531-3669553 CTGTTTCCTCAGCAGGAATATGG + Intronic
1078522513 11:12074631-12074653 TGGTTTCTTCATCAGGAAGATGG + Intergenic
1080018020 11:27527511-27527533 CAGTTTCCTCAGGAGTAAAATGG + Intergenic
1080019603 11:27546189-27546211 AGGTTTCTTTAGGAGGATGAGGG + Intergenic
1083639383 11:64137038-64137060 CGCTTTTCTCAGCAGGAACAAGG + Intronic
1085196721 11:74677093-74677115 CGATTTCTTCAGCTGGAAAATGG - Intergenic
1086367996 11:86127651-86127673 TGCTTTCTTAAGAAGGAACATGG - Intergenic
1087203620 11:95371129-95371151 CAGTTTCTTCAGCAGTAAAATGG - Intergenic
1088823281 11:113474632-113474654 CGACTTCTTCCGGAGGAAGAAGG - Intronic
1093971615 12:25381394-25381416 TTGTTTTTTAAGGAGGAACATGG - Intergenic
1098912078 12:76219183-76219205 CAGTTTCTTCAGCAGTAAAATGG + Intergenic
1099445647 12:82748487-82748509 CAGTTTCTTCACGTGTAACATGG + Intronic
1101913795 12:108880419-108880441 CAGTTTCTTCACCTGGAACATGG + Intronic
1102005324 12:109586010-109586032 CTGTGTCTTCAGGTGGACCAAGG + Exonic
1103631669 12:122266452-122266474 CGGTTCCTACGGGAGGACCACGG + Exonic
1104929674 12:132331663-132331685 CGGCATTTTCAGGAGGGACACGG - Intergenic
1107665156 13:42680878-42680900 TGGTTTCTGCATAAGGAACAAGG + Intergenic
1109657833 13:65417490-65417512 TGGTTTCTGCATGAGGAAAAGGG + Intergenic
1110172234 13:72515277-72515299 CTGTTTCCTCAGGAGTCACATGG - Intergenic
1110330612 13:74268015-74268037 TAGAGTCTTCAGGAGGAACAAGG + Intergenic
1110655758 13:77996923-77996945 CTGTTTCTTCTGGAGGCTCAGGG + Intergenic
1110708295 13:78621001-78621023 TGCCTTCTTGAGGAGGAACAAGG + Intronic
1111978362 13:94991268-94991290 CGATTTCTTCAGGAAGCACCTGG - Intergenic
1112193800 13:97204677-97204699 CGTTTTCTTCTTGAGGAGCAGGG + Intergenic
1112666542 13:101581284-101581306 GAGTTTGGTCAGGAGGAACAGGG - Intronic
1114339099 14:21724250-21724272 TGGTTTCTTCAGGTGGAAGGAGG - Intergenic
1114539964 14:23447779-23447801 AGGCTTTTACAGGAGGAACATGG + Intergenic
1115096593 14:29644959-29644981 CAGTTTCTTTAGGTGTAACATGG - Intronic
1121871075 14:97408001-97408023 CGGTGTGTTCAGGAAGAGCAGGG - Intergenic
1125675982 15:41502838-41502860 CGAGTTCTTCAGGAGGCACGAGG + Exonic
1126508671 15:49439689-49439711 GGGTCTCCTCAGGAGGAACGTGG + Intronic
1127929109 15:63578768-63578790 AGATGTCTTCTGGAGGAACAAGG + Intronic
1128764078 15:70240371-70240393 TAGTTTCTCCAGGAAGAACAGGG - Intergenic
1129939451 15:79481066-79481088 CAGTTTCTTCAGTAGTAAGATGG - Intergenic
1130919455 15:88332077-88332099 CAGATCCTTCAGGAGGCACAAGG + Intergenic
1132366913 15:101264475-101264497 CTGTTTCTGCAGGAGGAAGCAGG - Intergenic
1135762354 16:25147431-25147453 AGGTTCCTTCAGGAGGAACCTGG + Intronic
1136117627 16:28104929-28104951 CGAGTTCTTCAGGAGAGACATGG + Intronic
1136316512 16:29457704-29457726 GAGTTTCTTCAGGAAGAACCAGG + Exonic
1136431089 16:30197046-30197068 GAGTTTCTTCAGGAAGAACCAGG + Exonic
1139105019 16:63818076-63818098 GGGTTTCTTCAGGAAAGACAGGG + Intergenic
1139508731 16:67414037-67414059 TGGTTGCTTCAGGAGGAGAATGG - Intronic
1140424018 16:74845331-74845353 CAGTTTCTTCAACAGTAACATGG + Intergenic
1142549461 17:729157-729179 CGCTTTCTTCATGTGTAACATGG + Intergenic
1143287608 17:5801911-5801933 CCAGCTCTTCAGGAGGAACATGG + Intronic
1143849534 17:9799842-9799864 CTGTTTCTTGAGGTGGAGCACGG + Intronic
1144053145 17:11515084-11515106 TGGTCTCTTCAGGAGGACCCAGG + Intronic
1144242482 17:13326942-13326964 CTGTTTCCTCTTGAGGAACATGG + Intergenic
1144569231 17:16385415-16385437 CGGTTTCTTCTGGGGATACAAGG - Intergenic
1145361479 17:22215894-22215916 CGGTTTCTTCTGGGGATACAAGG - Intergenic
1145818385 17:27811953-27811975 AGGTTGCTGCAGGAGGAGCAGGG + Intronic
1147165926 17:38593293-38593315 CGGACTCCTCAGGAGGAACAGGG + Intronic
1147203550 17:38820695-38820717 TGGTTACTTCAGTAGGACCAGGG - Intronic
1148225389 17:45895287-45895309 GGGTTTCTGAAGGAGGAAAAGGG - Intronic
1153461336 18:5336778-5336800 CAGTTTCTTCAGGAAAAGCAAGG + Intergenic
1155158218 18:23175770-23175792 GGGTTGGCTCAGGAGGAACAAGG - Intronic
1155870965 18:31027621-31027643 AAGTTTCATGAGGAGGAACATGG + Intronic
1161557778 19:4954333-4954355 TGGATACTTCAGGAGGAAGAGGG - Exonic
1162851708 19:13436134-13436156 CTGTTTCTTCAGAAAGGACAAGG + Intronic
1163486282 19:17588493-17588515 TGGTTTCTTCTGGAGGATCTAGG + Intergenic
1164467866 19:28503261-28503283 CGTGTTCTCCAGGAGGAGCAAGG + Intergenic
1164525963 19:29014044-29014066 CTGTTGCTTCAGGTGGAACGTGG - Intergenic
1165145189 19:33726043-33726065 CGGTTCTTACAGGAGGAAGAGGG - Intronic
1168070994 19:53951692-53951714 GTGTTTCCTCAAGAGGAACAGGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
929593983 2:43164429-43164451 CGGTTTCTTTAGGCAGAGCAGGG - Intergenic
931069124 2:58624748-58624770 CAGTTTCTTCAGTAGGCACCTGG + Intergenic
934112572 2:88756871-88756893 TGGTCTCTTCAGGAGGCAAAGGG + Intergenic
936163781 2:110103332-110103354 TGGTCTCTTCAGGAGGCAAAGGG + Intronic
936998581 2:118440449-118440471 CGGTTTTTTCAGGAAGCACTCGG + Intergenic
937364521 2:121251523-121251545 CAATTTCTTGTGGAGGAACAGGG + Intronic
938681398 2:133694574-133694596 CAATTTCTTCAGGAGGTATAAGG - Intergenic
939764177 2:146225248-146225270 ATGTTTCTTCAGGAAGAACTAGG - Intergenic
940164766 2:150758349-150758371 CAGTTTCTTCAGAAGGAGAAAGG + Intergenic
940261190 2:151781171-151781193 CAGTTTCTTCAGCAGTAAAATGG - Intergenic
1169459888 20:5785339-5785361 CTGTTTCCTCATGAGTAACAAGG - Intronic
1169641479 20:7757222-7757244 AGGCTTCTTGAGGTGGAACAGGG + Intergenic
1173729394 20:45317959-45317981 CGTTTTCTAGAGGAGGAACAGGG + Intergenic
1174165282 20:48579744-48579766 CAGTTTCTCCAGGAGGGGCAGGG + Intergenic
1174853585 20:54021110-54021132 CAGTTTCTTCAGTAGAAAGAAGG - Intronic
1175643208 20:60649084-60649106 TGGTTTCTTCAGGAGGCTCCAGG + Intergenic
1175709110 20:61205169-61205191 CTGTTTCATCAGGAGGATGAGGG + Intergenic
1175735396 20:61382635-61382657 CGGAAGCTTCAGGGGGAACATGG - Intronic
1176037822 20:63048982-63049004 CGGTTTATCCAGGAGGAGCCCGG + Intergenic
1179486969 21:41716714-41716736 CGGGTTCTTCTGGAGGCTCAGGG - Intergenic
1181435726 22:22909726-22909748 GGGTTCCTTCAGGAGGATCCTGG - Intergenic
950126996 3:10515745-10515767 TGGTTTCTTCATCAGTAACATGG + Intronic
950543030 3:13623449-13623471 GGGTTTGTACAGGATGAACAAGG - Intronic
952932423 3:38370640-38370662 CGGTTTCCTCATCTGGAACAAGG + Intronic
953098130 3:39798920-39798942 TGGTGTTCTCAGGAGGAACAGGG - Intergenic
953562007 3:43999065-43999087 CGGCTTTTCCAGGAGGAAGATGG + Intergenic
955914846 3:63896561-63896583 CTGTTTCTTCAGTAGTAAAATGG + Intronic
956057238 3:65312881-65312903 CGTTTTCTTCATGAGGAGAATGG - Intergenic
957414805 3:79887730-79887752 GGGATTCTTCAGGAGTAACAAGG - Intergenic
957471802 3:80668298-80668320 TGGTTTCTTCAGCAGGTCCAGGG + Intergenic
957897790 3:86446227-86446249 CTGTTTCTTCAGGCAGCACAGGG - Intergenic
959081854 3:101810598-101810620 GAATTTCTTCAGGAAGAACATGG - Intronic
962397868 3:135033283-135033305 CCCTTTCTTCAGGATGACCATGG - Intronic
965304255 3:167044093-167044115 CGAATTCTTCCGGAGGTACAAGG - Intergenic
966712067 3:182980849-182980871 CGGTTCCTTCCGGACGACCACGG + Intronic
968771772 4:2512129-2512151 AAGTTTCTTCAGCAGGCACAAGG - Intronic
968830441 4:2930871-2930893 CAGCTTCTGCAGGAGGAAGAAGG + Exonic
969680772 4:8642211-8642233 CGGTTTGCTGCGGAGGAACACGG + Intergenic
969719878 4:8887753-8887775 GAGCTTCTTCAGGAGGAGCAGGG + Intergenic
970669922 4:18384558-18384580 TGGTTTCTCCAGAAGGAACCAGG + Intergenic
972291900 4:37697409-37697431 CGATTTCTTCAGGATAAAGATGG - Intergenic
972957763 4:44414014-44414036 GGGTTTCTTCTGGAGGCTCAAGG - Intronic
973545938 4:51982147-51982169 CGCTTTGGGCAGGAGGAACATGG + Intergenic
975716274 4:77208510-77208532 AGTTTTCTTCATGAGGAGCAGGG - Intronic
976620420 4:87121240-87121262 CTCTCTCTTCAGGAGGAAAAAGG - Intronic
977008097 4:91597836-91597858 TGCTCTCTTCAGGAGGAATATGG + Intronic
978545864 4:109872450-109872472 CCATTTCTACAGGAGGATCAAGG + Intergenic
979690938 4:123557653-123557675 AGGTCTCTTGAGGAGGGACATGG + Intergenic
983873807 4:172852780-172852802 CGGTTTCTTTATCAGCAACATGG - Intronic
984287209 4:177746250-177746272 GGATTTCTTCACAAGGAACAGGG - Intronic
984835019 4:184011307-184011329 CGGTTTCTTTTGGAGCAAGAAGG - Exonic
987029840 5:13965684-13965706 CTGTTAATTCAGGAGGAACTGGG - Intergenic
990313317 5:54560896-54560918 TGGTTCCCTCAAGAGGAACATGG - Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990611283 5:57459300-57459322 CTGTTTCTTCAGGAGGCTCTAGG - Intergenic
991058722 5:62348083-62348105 CAATTTCTTCATCAGGAACAAGG - Exonic
999142956 5:149374748-149374770 CAGTTTCCTCACGTGGAACATGG - Intronic
999780469 5:154845724-154845746 CTGTTTCTTCAGTTGGAAAATGG - Intronic
1001023049 5:168199860-168199882 CGATTTCTTCATGAAGAACCTGG - Exonic
1001144054 5:169168804-169168826 TGCATCCTTCAGGAGGAACAAGG + Intronic
1006091406 6:31631230-31631252 CGCTTTCCTCTGGAGGAACCAGG + Exonic
1008418326 6:51268718-51268740 CTGTTTTCTCTGGAGGAACAGGG - Intergenic
1010563033 6:77374196-77374218 TGGTTTCTGCAGGAAGAAAAGGG - Intergenic
1012127400 6:95448189-95448211 CTGTTTCTTCAGGTGGTATACGG + Intergenic
1012485075 6:99712064-99712086 TCGTTGCTTCAGGAGAAACAGGG - Intergenic
1014835655 6:126157382-126157404 GGCTTTCTTGAGGAGGAAAAGGG - Intergenic
1018533387 6:164792939-164792961 AGATTTCTTCAGGAGGAGGAAGG + Intergenic
1019207442 6:170374373-170374395 CGGTGTATTTAGGAAGAACAGGG + Intronic
1021286910 7:18791650-18791672 GGGTTTCTTCAGGAGGGTGATGG + Intronic
1023268962 7:38438760-38438782 CGGTTTCTTCATGAATAAAATGG + Intronic
1025226223 7:57166586-57166608 CAGGCTCTTCAGCAGGAACATGG + Intergenic
1027574120 7:79910197-79910219 TAATTTCTTAAGGAGGAACAAGG + Intergenic
1029743389 7:102503606-102503628 CGGTTTCCTCATCAGGAAAATGG + Intronic
1029761378 7:102602767-102602789 CGGTTTCCTCATCAGGAAAATGG + Intronic
1030090066 7:105850616-105850638 CTCGTTCTTCAGGAGGCACAGGG - Intronic
1031420211 7:121542703-121542725 CTGTATTTTCAGGAGAAACAGGG - Intergenic
1032463572 7:132129357-132129379 CGGATTCTGCAGAGGGAACAGGG + Exonic
1032711239 7:134462343-134462365 CAGTTTCTTCACGTGTAACATGG - Intergenic
1034063518 7:148114953-148114975 CAGATTCTTCAGAAGCAACAGGG - Intronic
1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG + Intronic
1035455503 7:159006254-159006276 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455537 7:159006406-159006428 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455546 7:159006444-159006466 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455563 7:159006520-159006542 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1036383161 8:8252758-8252780 CGGTTTCTTCCTCTGGAACATGG - Intergenic
1037313125 8:17577119-17577141 CGGTTTCTTCAGGAGGAACAAGG - Exonic
1038401328 8:27287040-27287062 TGGTTTCCTCAGGAGGAAATGGG - Exonic
1042507625 8:69577759-69577781 CGGTTTTTTCATTAGTAACATGG - Intronic
1045972455 8:108094426-108094448 GGGTAACTTCTGGAGGAACAGGG + Intergenic
1047093105 8:121595001-121595023 CTGTTTCTTCTTGTGGAACATGG - Intergenic
1048412216 8:134186831-134186853 AGGTTGCTTAAGAAGGAACATGG - Intergenic
1048497332 8:134946231-134946253 CGGTCTCTTTAGGAGGATGAGGG + Intergenic
1048697377 8:137042854-137042876 CGGTTTCTTTATGAGTAAAAAGG + Intergenic
1049264943 8:141662776-141662798 CAGTTTCTCCAGCCGGAACATGG + Intergenic
1052956474 9:34256427-34256449 TGGGTTCTCCAGGAGGGACATGG + Exonic
1057757618 9:97850351-97850373 CAGTTTCTTGAGAAGGAACATGG - Intergenic
1062449270 9:136608710-136608732 GGGCTTCTGCAGGAGGACCAGGG - Intergenic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1185686841 X:1936166-1936188 CTGTTTGTTGAGGAAGAACAAGG - Intergenic
1186910708 X:14161567-14161589 TTCTTTCTTCAGGAGGCACATGG + Intergenic
1187987080 X:24825729-24825751 CCTTTTCTTGAGGAGGAACCAGG + Intronic
1196634716 X:117989278-117989300 CTGTTTCTTCATGAGTAAAATGG - Intronic
1196708970 X:118742982-118743004 TGGTTTCTTCAGGGGTAAAATGG - Intronic
1198411206 X:136370716-136370738 TGGGTTATTCATGAGGAACATGG + Intronic
1200223391 X:154403235-154403257 CAGTTTGTACAGGAGGGACAAGG - Intronic