ID: 1037315800

View in Genome Browser
Species Human (GRCh38)
Location 8:17598363-17598385
Sequence AGGGGTTTATTCTTTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037315800_1037315808 1 Left 1037315800 8:17598363-17598385 CCCTCCTGAAAGAATAAACCCCT 0: 1
1: 0
2: 0
3: 10
4: 181
Right 1037315808 8:17598387-17598409 GAGGGCAAATAACACATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037315800 Original CRISPR AGGGGTTTATTCTTTCAGGA GGG (reversed) Intronic
904778904 1:32930007-32930029 AGAGGTTATTTCTTTCAGCAAGG - Intergenic
906177107 1:43784053-43784075 AGGGGTGTGTGGTTTCAGGAAGG - Intronic
906932841 1:50186582-50186604 AGGAGTTTATTCTGCCATGATGG + Intronic
907495200 1:54839106-54839128 AGGGTTTTCTTCTTCCAGGGAGG + Intronic
909982768 1:82123783-82123805 AGGCCTTTATTCTTTCTGGCTGG - Intergenic
910784751 1:90984072-90984094 AGGGCTTTGTTCCTTCTGGAGGG - Intronic
915027377 1:152843574-152843596 AGGGGTTTGATCTTTGGGGAGGG - Exonic
916991471 1:170250130-170250152 AGTTGTTTATTCCTTCAGGTGGG + Intergenic
918436715 1:184521625-184521647 AGAGGATTTTTCTTTTAGGATGG + Intronic
919266631 1:195275493-195275515 ATGGGTGGATTCTTACAGGAAGG - Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
921887187 1:220318805-220318827 AGGGGTCTATTCTTAGAAGATGG - Intergenic
922541768 1:226425710-226425732 AGGAGTTTCTTCTTTCTGGTGGG + Intergenic
922970017 1:229728312-229728334 ATGGTTTTATTCTCTCAGGCTGG + Intergenic
1066197401 10:33114482-33114504 ACTGGTTTATTGTTTCAGTAGGG + Intergenic
1066802812 10:39209030-39209052 ACAGGTTAAGTCTTTCAGGAAGG + Intergenic
1073497119 10:103902552-103902574 AGGGGATTTATCTTTCATGATGG - Intronic
1073886683 10:108047863-108047885 ATGGCTTTATACTTTCATGAGGG + Intergenic
1074263176 10:111874423-111874445 AGGGGTTTATCATTTCTGGATGG + Intergenic
1077547800 11:3183390-3183412 AGGGGTTAATCCATTCATGAGGG + Intergenic
1079694366 11:23460674-23460696 AGGGTTTTATTCTTACTGGTGGG - Intergenic
1080462903 11:32471308-32471330 AGGGGTTCAGTCTTCCACGAGGG - Intergenic
1082191323 11:49248792-49248814 AGTGATTATTTCTTTCAGGAAGG - Intergenic
1083836344 11:65271042-65271064 AGGGCTTTGTTCTTTTAGGCAGG - Intronic
1084026872 11:66456129-66456151 AGGGGGCTATCTTTTCAGGAGGG - Intronic
1084587172 11:70069025-70069047 AGGGGGATATTCTTTCATCAAGG - Intergenic
1084900010 11:72302594-72302616 TGGGGTGTCTTCTTTCAGGGAGG + Intronic
1086573348 11:88309412-88309434 AGTGGTACAATCTTTCAGGAAGG + Intronic
1086674803 11:89592245-89592267 AGTGATTATTTCTTTCAGGAAGG + Intergenic
1087161488 11:94952090-94952112 TGGGATTTCTTCTTTCAAGAGGG + Intergenic
1087194339 11:95290133-95290155 AGGGCTCTATTCTGTCAGTATGG + Intergenic
1094652351 12:32390444-32390466 TGGAGTTTATTCTTTCTGGTGGG + Intergenic
1097715936 12:62966049-62966071 AGTATTTTATTATTTCAGGAAGG + Intergenic
1099432254 12:82601624-82601646 TGGAGTTTCTTCTTCCAGGAGGG + Intergenic
1099737868 12:86594216-86594238 AGAGAAGTATTCTTTCAGGAGGG - Intronic
1103231192 12:119332078-119332100 AGGGGTATATTCTTTAGAGAGGG - Intergenic
1105237056 13:18567198-18567220 CGGGGTTTCTTCTTTCTGGTGGG + Intergenic
1107104647 13:36630301-36630323 AGGGGTTTGCTCTCTGAGGAGGG + Intergenic
1109015742 13:57010727-57010749 AGGGGTTTGTTCTTTTAGCTTGG + Intergenic
1110817372 13:79876867-79876889 AGGACTGTATTCTTTCTGGAAGG + Intergenic
1114910101 14:27181601-27181623 AGGGGTGTGTTCTGTGAGGAAGG - Intergenic
1115114737 14:29866672-29866694 AGGAGTTGATGCTTACAGGATGG + Intronic
1119547113 14:75479919-75479941 CAGGATTTCTTCTTTCAGGAAGG - Intergenic
1119615488 14:76096176-76096198 AGGGCCTTCTTCTTTCAGGGAGG - Intergenic
1128047519 15:64632053-64632075 AGGGTCTTGTTCTTTCAAGACGG + Intronic
1128917743 15:71579900-71579922 TGGGGTTTTTTTTTTGAGGAGGG + Intronic
1129678361 15:77644367-77644389 AGGGGGTTGTGCTTCCAGGATGG - Intronic
1134378428 16:13701426-13701448 AATGGTTTAATTTTTCAGGAGGG + Intergenic
1136089148 16:27905957-27905979 AGGGGTTTATTCTCTCATCTGGG + Intronic
1137532433 16:49287865-49287887 AGAGGATTCTTCTTTCAGGATGG + Intergenic
1137703144 16:50512612-50512634 AGGTATTAATTCATTCAGGAGGG - Intergenic
1139171334 16:64633358-64633380 CGGGGTTTCTTCTGGCAGGAAGG + Intergenic
1142740878 17:1931342-1931364 TGGTGTTCATTCTTTGAGGAGGG - Intergenic
1144118444 17:12125290-12125312 TTGGGTCTATTCTTTCAGGCTGG - Exonic
1146109965 17:30080271-30080293 AGGGAATTATTTTTTTAGGAGGG - Intronic
1146274076 17:31503791-31503813 AGGATAGTATTCTTTCAGGATGG + Intronic
1148470953 17:47892960-47892982 AGAGATTTTTTCTTTCAAGATGG - Intergenic
1149291255 17:55219607-55219629 AGAGGTTTAAACTTTCATGAAGG - Intergenic
1150925129 17:69524897-69524919 CTGGGTTTATTCTTTCAGGCTGG - Exonic
1152462008 17:80446394-80446416 AGGGGGCTTTTCTTTCATGATGG + Intergenic
1154392155 18:13947223-13947245 TGGGGTTGATTCTTTTAGGTAGG - Intergenic
1154512479 18:15122721-15122743 CGGGGTTTCTTCTTTCTGGTGGG - Intergenic
1155653651 18:28171471-28171493 AGGGGTTTAGGCTTAAAGGAAGG - Intronic
1162341249 19:10092621-10092643 TGGGGCATATTCTCTCAGGAAGG - Exonic
1162699343 19:12501984-12502006 AGGGGTCTGTTCAGTCAGGAGGG + Intronic
1164846095 19:31433760-31433782 AGGGGCTTAGTTTTTCAGGATGG + Intergenic
1165583743 19:36893893-36893915 AGGAGTTTAGATTTTCAGGAGGG - Intronic
1167683155 19:50938276-50938298 ACAGGATTATTCTTTCACGATGG - Intergenic
929928180 2:46232163-46232185 AGGGGTTCATTCTAGCTGGAGGG - Intergenic
931219351 2:60275193-60275215 TGAGGGTTATACTTTCAGGATGG + Intergenic
931542546 2:63345471-63345493 AGCTGTATATGCTTTCAGGAAGG + Intronic
932056048 2:68445327-68445349 ATGGGGTAATTCGTTCAGGACGG - Intergenic
932394228 2:71429154-71429176 AGGGGTTTATTGATTCAGAGAGG + Intronic
933999152 2:87692231-87692253 ATGGGATTATTTTTTCAGTAAGG + Intergenic
934094891 2:88592236-88592258 AGGGGTTCATTATTTAAAGAAGG + Intronic
934838271 2:97608963-97608985 AGGAGTTGATTTGTTCAGGAGGG - Intergenic
936294692 2:111258660-111258682 ATGGGATTATTTTTTCAGTAGGG - Intergenic
936550095 2:113430118-113430140 ACAGGAATATTCTTTCAGGAGGG + Intergenic
937530251 2:122819411-122819433 AGGGTTTTATTCCTTGAAGATGG + Intergenic
939771763 2:146329080-146329102 AGGGTTTTATTTATTCAGGATGG + Intergenic
946017790 2:216617997-216618019 AGGTGTTTATTATCTCATGAAGG + Intergenic
948219630 2:236259485-236259507 AGGGCTTTATGCTTTCATGCAGG + Intronic
1170593241 20:17787007-17787029 AGGGGTTGTTTCATACAGGATGG - Intergenic
1171506413 20:25639004-25639026 AGGGGGTTACTATTTCAGAAGGG + Intergenic
1173900565 20:46584676-46584698 ACTGGTTTATTCTTTCACTAAGG - Intronic
1174182952 20:48686585-48686607 AGGAGGTTTTTCTCTCAGGAGGG - Intronic
1174911381 20:54611593-54611615 ATGAGTTTTTTCTTTAAGGAGGG + Intronic
1175157031 20:56978039-56978061 AGAAGTTTCTTCATTCAGGAGGG - Intergenic
1176781045 21:13195480-13195502 CGGGGTTTCTTCTTTCTGGTGGG + Intergenic
1178369136 21:32012465-32012487 ATGGGTTAATTCCTTCATGAGGG - Intronic
1181790722 22:25263769-25263791 AGAGGTTTACTCTATCAGCAGGG - Intergenic
1181826539 22:25520808-25520830 AGAGGTTTACTCTATCAGCAGGG - Intergenic
1182891357 22:33821397-33821419 AGGAGTTTATCATTTCAGGATGG - Intronic
949420734 3:3863096-3863118 AGGGGTGTGTTCCTTCTGGAGGG - Intronic
949924384 3:9029429-9029451 AGGGGTTTGTTTATTCAGGTAGG + Intronic
952985042 3:38771459-38771481 GGGGGTTCCTTCTTCCAGGAGGG + Intronic
953222258 3:40982988-40983010 TTTGGTTTATTCTGTCAGGAGGG + Intergenic
953254594 3:41277818-41277840 AGGGGTTTTTGCTTCCAAGATGG + Intronic
953571846 3:44077446-44077468 AGGGCTTTATTTATTCAGAAGGG - Intergenic
955807951 3:62756684-62756706 AAAGGTGTTTTCTTTCAGGAAGG - Intronic
958519456 3:95165431-95165453 ATGGTTTTATTTTTTCATGAAGG - Intergenic
959514034 3:107245517-107245539 AGGGCTTTCTTCATTCATGAAGG - Intergenic
963149639 3:142032120-142032142 AGGGTTTTGTTCTTTCATGCAGG + Intronic
965749846 3:171964639-171964661 AAAGGTTGATTCTTTCTGGAAGG + Intergenic
966569248 3:181422602-181422624 TGGGGTTTTTTCTTTCATGACGG + Intergenic
968846959 4:3048835-3048857 AGGGCTTTACTCTTCCAGAAGGG - Intergenic
969926642 4:10591834-10591856 ATGGGTTCATTCTTTCTAGAAGG + Intronic
970226976 4:13869185-13869207 AGTGGTTTATTCTGAGAGGAAGG - Intergenic
970870971 4:20816482-20816504 TTGGGTTTAATGTTTCAGGATGG - Intronic
971075886 4:23148974-23148996 AGGGCTTAATTCTCTCATGAAGG + Intergenic
973051534 4:45605039-45605061 AGGGGCTTTTTATTTCAGGCTGG + Intergenic
973208187 4:47584190-47584212 AGAGTTTTATACTTTCAGAATGG - Intronic
973863411 4:55087754-55087776 CTGTGTTTATTGTTTCAGGATGG - Exonic
975502874 4:75106575-75106597 AGAGAGTCATTCTTTCAGGATGG - Intergenic
976683429 4:87783907-87783929 AGGAGATTATTCTTTCAAGGGGG + Intergenic
978889587 4:113807897-113807919 AGGAGTATATTCTCTGAGGAAGG + Intergenic
981189623 4:141846952-141846974 AGGGGTTCATTCTGTCAGTTGGG - Intergenic
982155259 4:152513772-152513794 AGGGCTTTAGTGTTTCAGAATGG - Intronic
982879261 4:160690477-160690499 AGGGGTTTATTCTTGTTGGTAGG - Intergenic
987069630 5:14323530-14323552 AGGAGTTTAGTCCTTTAGGAGGG + Intronic
988788289 5:34584229-34584251 ATGGATTTATCCATTCAGGAGGG + Intergenic
988876459 5:35452532-35452554 ATGGATTAATTCATTCAGGAAGG - Intergenic
990673305 5:58156742-58156764 ATGGATTTATTTTTTCAGGAGGG - Intergenic
993769912 5:91914284-91914306 CTGGGGTTATTCTCTCAGGAAGG + Intergenic
994030500 5:95136350-95136372 ATGGCTCTATTCATTCAGGAAGG + Intronic
994408876 5:99381358-99381380 CAGGGTTTTCTCTTTCAGGAAGG + Intergenic
996143682 5:119947113-119947135 AGGGGTTTTTTTTATCATGAAGG - Intergenic
996216475 5:120872669-120872691 AGGGTTTTCTTTTTTCAGGCAGG - Intergenic
996431201 5:123379607-123379629 AGGGCTTCATTCTCTCAGGAAGG + Intronic
996765706 5:127031978-127032000 AGGGTTTTAGTCTCTCAGTATGG + Intergenic
997273987 5:132567329-132567351 AGGGCTATATTCTTTGAGAAAGG + Intronic
999608338 5:153341352-153341374 GGGAGCTTATTCTTTGAGGAAGG + Intergenic
1000087339 5:157899334-157899356 AGAGTTTTATTCATTGAGGAAGG - Intergenic
1001469274 5:171998237-171998259 AGGGAATTACCCTTTCAGGATGG - Intronic
1005269391 6:24147163-24147185 AGGGGTTCCTTATTTGAGGATGG - Exonic
1005447017 6:25934385-25934407 ACGGGTTTGCTCTTTCTGGAAGG - Intergenic
1006008109 6:31019457-31019479 TGGGGCTTAATCATTCAGGAAGG - Intronic
1006248883 6:32763545-32763567 AGGTTTTTATTCTTTCCGGCAGG - Intergenic
1009273292 6:61642910-61642932 ATGGTTTTATCCTTTCAGGGTGG - Intergenic
1011117817 6:83913855-83913877 ACAGGTATTTTCTTTCAGGATGG - Intronic
1011693299 6:89888890-89888912 AGATGTTTCTTCTTTCAGCATGG + Intergenic
1011832671 6:91392155-91392177 AGGATTTTATTTTTTCAGTAAGG + Intergenic
1012134858 6:95543205-95543227 AGAGGTTTAATTTTTCAGCATGG + Intergenic
1013121667 6:107146776-107146798 ACTGTTTTATTCTTTCAGAATGG - Intergenic
1013307280 6:108861043-108861065 ATGGGTTTATTCTCTAAAGAAGG - Intronic
1014730738 6:125029152-125029174 TGGAGTATATTCTTTCAGCATGG + Intronic
1017123053 6:151041831-151041853 AGATGTTTATTGTTTAAGGATGG - Intronic
1017315709 6:153028798-153028820 AGGAGTTTATTATTTAAGCAGGG - Intronic
1020507470 7:9010560-9010582 AGGTGTTAATTCATTCATGATGG + Intergenic
1020866159 7:13565925-13565947 ATTGGTTTATTTTTTCAAGAAGG + Intergenic
1021347119 7:19542220-19542242 AGGGGGTGATGGTTTCAGGATGG + Intergenic
1022992384 7:35721241-35721263 AAGGGTATATTCTTGCTGGATGG + Intergenic
1026385113 7:69839115-69839137 AGGGGTTCATACACTCAGGAAGG - Intronic
1027526017 7:79269803-79269825 AGGGGGTTATTTTTTAAAGAAGG - Intronic
1031942906 7:127808086-127808108 GGGAGTTTTTTTTTTCAGGAAGG + Intronic
1033078575 7:138272454-138272476 AGGGTTTTATTCTTTCACATAGG - Intergenic
1035705401 8:1670892-1670914 ACGGGTTCCTTCTTTCAGGGAGG + Intronic
1037073049 8:14676120-14676142 AGGTCTTTATTCTTTCTGGTAGG - Intronic
1037315800 8:17598363-17598385 AGGGGTTTATTCTTTCAGGAGGG - Intronic
1037971177 8:23173061-23173083 AGGAGTTTCTTCTTTCTGGTGGG + Intergenic
1038579702 8:28737257-28737279 TAGGGCTTATTCTTTCTGGAAGG + Intronic
1039275876 8:35933774-35933796 AGTGGTTTTTTCTTTCAGATAGG + Intergenic
1041007732 8:53511631-53511653 AGGGGTTTTTTCTTTAAAAAAGG + Intergenic
1041068691 8:54105393-54105415 TGGAGTTTATTCTTTCTGGTGGG - Intergenic
1044188962 8:89291103-89291125 AGGGGTTTATTCTTTATGTAAGG + Intergenic
1047460467 8:125059121-125059143 AGGATTTTATCCTTTTAGGAAGG - Intronic
1049902849 9:186702-186724 ACAGGAATATTCTTTCAGGAGGG - Intergenic
1051263749 9:15291042-15291064 AGAGTTTTATCCTCTCAGGAGGG - Intronic
1051880820 9:21838009-21838031 AGGTGTGTAGTCTTTCTGGAAGG + Exonic
1053111110 9:35460847-35460869 AGGGGTTGAGCCTTCCAGGACGG - Intergenic
1053745868 9:41196988-41197010 ACAGGAATATTCTTTCAGGAGGG - Intronic
1054442611 9:65280692-65280714 AGGGTATTATCCATTCAGGAAGG - Intergenic
1054481404 9:65668228-65668250 ACAGGAATATTCTTTCAGGAGGG + Intergenic
1054487668 9:65740810-65740832 AGGGTATTATCCATTCAGGAAGG + Intergenic
1054682475 9:68234285-68234307 ACAGGAATATTCTTTCAGGAGGG + Intronic
1058414974 9:104778021-104778043 AGAGAATTATTGTTTCAGGAAGG - Intergenic
1202782000 9_KI270718v1_random:7767-7789 ACAGGAATATTCTTTCAGGAGGG - Intergenic
1186108940 X:6235648-6235670 AGGGGTTTATATTCCCAGGATGG + Intergenic
1186147880 X:6643941-6643963 AGGGGATTATTTTTTAGGGAGGG - Intergenic
1186387804 X:9127611-9127633 ATGGATTAATCCTTTCAGGAGGG - Intronic
1187659918 X:21532830-21532852 AGGAGCTTATACTTTGAGGAAGG + Intronic
1194574566 X:95596370-95596392 AGGTGTTTTATCTTTTAGGAAGG - Intergenic
1194668187 X:96698605-96698627 AGGGGCTTTTTCTTTGGGGAAGG - Intronic
1195869500 X:109471412-109471434 AGGGTTGCATTCATTCAGGAGGG - Intronic
1199452398 X:147991269-147991291 AGGAGGTTATTATTTCATGAGGG - Intronic
1199751501 X:150823843-150823865 ATGGGTTAATTCATTCATGAGGG + Intronic
1199782684 X:151077076-151077098 AATGGTTTAGTCTTTCTGGAAGG + Intergenic
1199822757 X:151465652-151465674 TGGAATTTTTTCTTTCAGGAAGG - Intergenic
1200225937 X:154417550-154417572 AGGGGTTTATTATTTCTAGCTGG + Intronic
1201488464 Y:14515476-14515498 AGGGGTTTATATTCCCAGGATGG - Intergenic
1202046810 Y:20743827-20743849 AGGCATTTTTTCTTGCAGGAGGG - Intergenic