ID: 1037315885

View in Genome Browser
Species Human (GRCh38)
Location 8:17599084-17599106
Sequence ATGTGGATAAAGAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 770
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 718}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037315885 Original CRISPR ATGTGGATAAAGAGGGAGAA GGG (reversed) Intronic
900031187 1:374084-374106 AGGGGGATGGAGAGGGAGAAAGG - Intergenic
900031202 1:374133-374155 AGGGGGATGGAGAGGGAGAAAGG - Intergenic
900051756 1:602333-602355 AGGGGGATGGAGAGGGAGAAAGG - Intergenic
900628815 1:3623132-3623154 GGGGGGAGAAAGAGGGAGAATGG - Intergenic
900701238 1:4049781-4049803 AGGGGGAGAAAGAGGGAGGAAGG + Intergenic
900849967 1:5135034-5135056 CAGTAGATAAAGACGGAGAAAGG - Intergenic
900856468 1:5189207-5189229 GTGTGGCTAAACAGAGAGAAAGG - Intergenic
901110325 1:6788182-6788204 ATTTCGTGAAAGAGGGAGAAAGG - Intronic
901651523 1:10745900-10745922 GTGTGGATCAAGAGGGGAAAAGG + Intronic
902315099 1:15612775-15612797 AGGAGGCTAAAGAAGGAGAATGG + Intergenic
902975058 1:20082442-20082464 ATGTGCATGAAGAGGCAAAATGG - Intronic
904593913 1:31631048-31631070 ATTTGGAGAAAGAGGGATGAGGG - Intronic
904848830 1:33441525-33441547 AGGAGGAGAAAGAGGAAGAAGGG - Intergenic
905150051 1:35920232-35920254 ATGTGGACAGAGAGGAATAAGGG - Exonic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905663131 1:39743872-39743894 AAGAGAATAAAGAGGAAGAAGGG + Exonic
905690909 1:39941991-39942013 ATGTGCACTAAGAGGGAAAATGG - Intergenic
905928547 1:41769810-41769832 AAATGGATAAATGGGGAGAAGGG + Intronic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
906731338 1:48083974-48083996 ATGAAGAAAAAGAGGGCGAATGG + Intergenic
906936490 1:50218422-50218444 ATGTGTATGATAAGGGAGAATGG - Intergenic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907440700 1:54476376-54476398 ATGTGGAAAGAGAGGGTGACAGG - Intergenic
907957098 1:59240160-59240182 ATTTGGATAAAAAGGTAGACAGG + Intergenic
908803900 1:67909818-67909840 ATGAGGATAAAACTGGAGAAAGG - Intergenic
911038440 1:93573502-93573524 ATGGAGACAAAGAGGGAAAATGG - Intronic
911628701 1:100157633-100157655 ATTAAGATAAAGTGGGAGAAGGG + Intronic
912520836 1:110243621-110243643 AAGAGGAGGAAGAGGGAGAAGGG + Intronic
912567329 1:110597469-110597491 ATGGGGAGACAGAGGGAGAGGGG + Intronic
912688942 1:111789210-111789232 ATATGAAGAAAGAGGGAGAAGGG + Intronic
912866545 1:113262856-113262878 CTGTGGCTGAAGAGGGGGAAAGG + Intergenic
913374415 1:118134748-118134770 ATGTGTATAAGGAGGGAAATTGG - Intronic
914450769 1:147789478-147789500 ATGTTGATGAAGAAGGGGAATGG + Intergenic
914734586 1:150403147-150403169 ATGTAGAGAAAGAAGGTGAAGGG - Intronic
915457866 1:156052817-156052839 ATGTGGTTAGGGAGGGAGCAAGG + Intronic
915641705 1:157232570-157232592 ATGTGCATTAAGAGGCAAAATGG - Intergenic
916145636 1:161736524-161736546 ATGTGGAGAGAGAGAGAGAGAGG + Intergenic
916390615 1:164326746-164326768 ATGAGGAGAAAGAGAGAGAAGGG - Intergenic
916490911 1:165301540-165301562 GTCTGGGTAAACAGGGAGAAGGG - Intronic
916711822 1:167417456-167417478 AAGTGGATGAAGAGGAATAAGGG + Exonic
916816863 1:168362621-168362643 ATGTGCATTAAGAGGCAAAATGG + Intergenic
917027698 1:170661224-170661246 ATGAGGATAGAGAGTGCGAAAGG + Intergenic
918319986 1:183355116-183355138 ATGTGGAAACTGAGGAAGAAAGG - Intronic
918472926 1:184893446-184893468 ATGTGGAGAAAGTGAGATAATGG - Intronic
918865408 1:189891548-189891570 ACGAGGATAAAGAGGGTGAGGGG - Intergenic
918898494 1:190380247-190380269 ATGTGGTTAATGAGGGAAAGTGG + Intronic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
921050854 1:211510417-211510439 ATGTGGTTTAAGACGTAGAAAGG - Intergenic
921271563 1:213474894-213474916 ATGTTGTTAAAGGGAGAGAATGG - Intergenic
921782864 1:219188560-219188582 ATGAGGATAAAGAGGAAGACTGG + Intronic
922331274 1:224578801-224578823 AAGAGGAGAAAGACGGAGAAGGG - Intronic
923178200 1:231489704-231489726 ATGGAAATAAAGAGGGAGCAGGG + Intergenic
923991902 1:239447394-239447416 ATGTGGGGAGAGAGAGAGAATGG + Intronic
924144301 1:241058168-241058190 ATGTGCATTAAGAGGCAAAATGG + Intronic
924589031 1:245385907-245385929 ATGTGGGAAAAGAGAGAGGATGG + Intronic
924866519 1:247987802-247987824 ATGTGGACAAAGTGGGAGAAGGG - Intronic
1062767883 10:79617-79639 ATGAGGACAAAGAGGAAGAAGGG + Intergenic
1063636270 10:7786117-7786139 ATGTTGATGATGAGGGAGACTGG + Intronic
1063786623 10:9392293-9392315 ATGTGCATTAAGAGAGAAAATGG - Intergenic
1063837635 10:10033864-10033886 ATGTTGGTAAAGATGTAGAACGG + Intergenic
1063865457 10:10360447-10360469 ATGTGAAAAAAGAGGAAGGAAGG + Intergenic
1064582066 10:16804816-16804838 AGGTAGATAATGAGGGAGAGGGG + Intronic
1065494979 10:26318554-26318576 AAGGAGAGAAAGAGGGAGAAAGG + Intergenic
1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG + Intergenic
1066389066 10:34964304-34964326 GTGTGGCTAAAGAGGGAGCAAGG + Intergenic
1066508672 10:36071059-36071081 ATGTGGATAATGGGGAAAAATGG - Intergenic
1066538902 10:36422637-36422659 GTGAGAAGAAAGAGGGAGAAAGG - Intergenic
1067270953 10:44790895-44790917 GTTTAGATAAGGAGGGAGAAAGG - Intergenic
1067290254 10:44934841-44934863 ATGTGGATGAAAAGGGAGCTGGG - Exonic
1067320446 10:45215395-45215417 AGGTAGATAATGAGGGAGAGGGG + Intergenic
1067535408 10:47106064-47106086 AAGTGAAAAAAGAGAGAGAAGGG - Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1068000956 10:51333601-51333623 TTTTGGATAAACAGGGAAAATGG - Intronic
1068344240 10:55751034-55751056 ATTTGGACAATGAGGTAGAAAGG + Intergenic
1068550166 10:58398822-58398844 ATGAAGAGAAGGAGGGAGAATGG - Exonic
1069389777 10:67921397-67921419 AAGTGGATGAACAGGGAAAATGG + Intergenic
1069872586 10:71542322-71542344 ATATGGAGAATGAGGGAGAGTGG + Intronic
1070715081 10:78714117-78714139 ATGTGCAAAAAAAGGAAGAAAGG - Intergenic
1071042485 10:81330316-81330338 ATGGAGGAAAAGAGGGAGAAGGG + Intergenic
1071061547 10:81576005-81576027 ATGAGGATAAAAAGAGGGAAAGG + Intergenic
1071112324 10:82174355-82174377 ATGTGCATAAAGAGGAAACAAGG - Intronic
1071472240 10:85991851-85991873 ATGTGGAAAATGTGGGAGGAGGG + Intronic
1071849030 10:89549927-89549949 CTCTGCTTAAAGAGGGAGAAAGG - Intronic
1072009948 10:91293718-91293740 ATGTAGATTAAGAGGGAGGTAGG - Intergenic
1072086474 10:92084537-92084559 ATGAGGGTAGAGAGGGAGATGGG - Intronic
1072894773 10:99357539-99357561 GGGTGAATAATGAGGGAGAAGGG + Exonic
1073540309 10:104312414-104312436 ATCAGGATGAAGAGGGGGAAAGG + Exonic
1073849563 10:107599070-107599092 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1074597904 10:114884184-114884206 ATGAGGAGAATGAGGGAGATGGG + Intronic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1075908031 10:126099393-126099415 AGGTGGATAGAGAGGGAGGGAGG - Intronic
1075909982 10:126116081-126116103 TTGTGGAGAAATGGGGAGAATGG - Intronic
1076308962 10:129488872-129488894 ATGTGGATATAGAGCAAGAGAGG + Intronic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078952947 11:16155907-16155929 ATTTGGATATTCAGGGAGAAGGG - Intronic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079260619 11:18875880-18875902 ATGTGGTTGCAGAGGAAGAATGG + Intergenic
1079405943 11:20145837-20145859 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1080440996 11:32294437-32294459 AGGTGGATAGAGGGGGAGAGAGG + Intergenic
1080943242 11:36942870-36942892 ATGAGGATGAAGAGGTAGAAGGG + Intergenic
1081194946 11:40150110-40150132 ATGGGGGTAAAGAAAGAGAATGG - Intronic
1081293621 11:41357779-41357801 ATTTTTATAAAGAGAGAGAATGG + Intronic
1081430514 11:42971681-42971703 GTGTGGAGAAAGAGAGAGATGGG + Intergenic
1082063178 11:47877776-47877798 TTGTGGAGAAAGAGGAAGGAAGG - Intergenic
1083108125 11:60378017-60378039 ATGAGGCCAAAGATGGAGAATGG + Intronic
1083405578 11:62454727-62454749 AAGAGGAAGAAGAGGGAGAAAGG + Intronic
1084181776 11:67450488-67450510 ATGTGGATGAAGGAGAAGAAAGG + Intergenic
1084893508 11:72249371-72249393 ATTTTTAAAAAGAGGGAGAAGGG - Intergenic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085353003 11:75812612-75812634 ATTTGGGAAAAGTGGGAGAAGGG + Intergenic
1085784024 11:79436099-79436121 AAGGGGATAAGGAGGTAGAAAGG + Intronic
1086021114 11:82230978-82231000 AGGTAGATAAAAAAGGAGAATGG - Intergenic
1087086448 11:94223617-94223639 ATGTAGAGAAATAGAGAGAATGG + Intergenic
1087181477 11:95146378-95146400 ATTTGGAAAAAGAGGAGGAATGG - Intergenic
1087701348 11:101440041-101440063 ATGGGGAAAGAGTGGGAGAAAGG + Intergenic
1088115277 11:106305451-106305473 ATGGGGAAAGAGAGGGGGAAGGG + Intergenic
1088613134 11:111598454-111598476 AAGAGGAGAAAGAGGGAGAGAGG + Intergenic
1088723694 11:112616539-112616561 ATATGGGGAAAGAGGGAGACTGG + Intergenic
1088725414 11:112630121-112630143 AAATGGATAAAGAGGAAGTAGGG - Intergenic
1088786455 11:113186548-113186570 ATGAAGGTAAAGAGGTAGAAAGG - Intronic
1089075987 11:115739158-115739180 ATGTGTACAGAGAGGGAGAGAGG + Intergenic
1089277390 11:117346910-117346932 AGGTGGGTAAAGAAGAAGAAGGG - Intronic
1089330239 11:117684273-117684295 GTGGGGAGAAAGAAGGAGAAGGG - Intronic
1089469225 11:118707458-118707480 AGATGGATTAAGATGGAGAATGG + Intergenic
1090016898 11:123094209-123094231 ATGAGGCTAAGGTGGGAGAATGG - Intronic
1090076154 11:123581235-123581257 ATTTGGCCAAAGAGGAAGAAGGG - Intronic
1090160309 11:124486180-124486202 AGGAGGATAAAGAGACAGAATGG - Intergenic
1090456980 11:126858529-126858551 ATGTGGAGAGAGAGAGAGAGAGG - Intronic
1090479855 11:127058629-127058651 ATGTGGCCAAAGAGGGAGCAGGG - Intergenic
1091813643 12:3419958-3419980 AGGGGGAGAAAGAGGGAGAGGGG + Intronic
1091989260 12:4941431-4941453 AAGTGGATAGAAAGTGAGAATGG + Intergenic
1092246421 12:6866847-6866869 GTGTGAATAAAGAGAGGGAAGGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092812797 12:12287379-12287401 ATATTGTTAAAGAGGGAGGAAGG - Intergenic
1093376084 12:18429590-18429612 CTGTGGACTAAGAGGGGGAAGGG - Intronic
1094156086 12:27338221-27338243 AAGTGGATAAAGCAGGAGAAGGG + Intronic
1094303064 12:28987874-28987896 CGGTGGAGAAAGAGAGAGAATGG - Intergenic
1094505191 12:31055538-31055560 CTGAGGATAAAGATGGAGAGAGG - Intergenic
1095223649 12:39651879-39651901 ATGTGAAGCAATAGGGAGAAGGG - Intronic
1095475598 12:42584310-42584332 ATGTCCCTAAAGAGGGAGACAGG + Intronic
1096212957 12:49780358-49780380 AATTGGATAAAAAGGGAAAAAGG - Intergenic
1096786999 12:54022675-54022697 AGGGGGAGAAAGAGGGGGAAAGG + Intronic
1097174114 12:57133042-57133064 TTGTGGGCTAAGAGGGAGAAAGG + Intronic
1097493726 12:60301498-60301520 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1098814414 12:75139588-75139610 ATTTAGAGAAAGAGAGAGAAAGG - Intronic
1099046369 12:77725966-77725988 GTGTGGAGAATGAGGCAGAAGGG - Intergenic
1099102832 12:78463783-78463805 ATGTGGCCAAAGAGGTAGAGAGG - Intergenic
1100280631 12:93115010-93115032 ATGCGGAGAGAGAGAGAGAAAGG - Intergenic
1101266472 12:103093575-103093597 ATGTGAATAAAGAGGGAATTAGG + Intergenic
1101523551 12:105506907-105506929 AAATAGAGAAAGAGGGAGAAAGG + Intergenic
1101624721 12:106428135-106428157 ATGTGCCTAAATAGGGACAAAGG - Intronic
1101786321 12:107886704-107886726 ATGTGGATAAAGTGGGAGGGAGG + Intergenic
1101850526 12:108398484-108398506 ATGTGAATAAAGATAGAGAAAGG - Intergenic
1102905272 12:116669846-116669868 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1103093672 12:118116071-118116093 ATGTGCATGAAGAGGCAAAATGG - Intronic
1104326701 12:127805581-127805603 AAGAGGATAAGGAGTGAGAAAGG + Intergenic
1104449785 12:128859622-128859644 ATGTGGCTGGAGAGGGAGACAGG + Intronic
1104527774 12:129540260-129540282 ATGAGTAGAAACAGGGAGAAGGG + Intronic
1105277076 13:18941197-18941219 ATGTGTAGAAAAAGGAAGAAAGG - Intergenic
1105764647 13:23547130-23547152 AGGAGGAGAAAGAGGGGGAAGGG + Intergenic
1106123977 13:26885126-26885148 GTGAGGCTGAAGAGGGAGAATGG - Intergenic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1107264958 13:38542591-38542613 GTGTGAATATAGAGGGAAAATGG - Intergenic
1107265087 13:38544403-38544425 GTTAGGATAAAGAGAGAGAAAGG + Intergenic
1107527291 13:41245880-41245902 ACAGGGATAAAGAGGGAGGAAGG - Intronic
1107650920 13:42543791-42543813 ATGTGGAAAATGAGGGAGAGTGG + Intergenic
1108035624 13:46287547-46287569 ATGTAGAGCATGAGGGAGAAAGG + Intergenic
1108102527 13:46972139-46972161 ATGAGGATAAAGAGGAAGACCGG - Intergenic
1108183593 13:47866331-47866353 AGGTAAATAAAGAGGGAGAAAGG - Intergenic
1108468064 13:50738902-50738924 ATGAGGATAGAGAGGTAGAAAGG - Intronic
1108682004 13:52788442-52788464 ATATTGAGAAAGAGGGAGAGTGG + Intergenic
1109448986 13:62483784-62483806 GAGTGGAGAAAGAGGAAGAAGGG - Intergenic
1109661122 13:65461993-65462015 ATGTGTATTAAGAGGCAGAATGG - Intergenic
1109909715 13:68893304-68893326 GAGAGGGTAAAGAGGGAGAAAGG - Intergenic
1110704022 13:78584432-78584454 ATATGGAGAAAGAGAGAGAGAGG - Intergenic
1110743638 13:79027118-79027140 ATGTTGGTAAAAGGGGAGAAAGG - Intergenic
1111079346 13:83281426-83281448 AAAAAGATAAAGAGGGAGAAAGG + Intergenic
1111153876 13:84296530-84296552 ATGCTGATAAGGAGGGAGAGAGG - Intergenic
1111344168 13:86926716-86926738 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1111781636 13:92734624-92734646 ATATGGACTAAGAGTGAGAATGG - Intronic
1111797045 13:92935064-92935086 ATGAGGATTTGGAGGGAGAAGGG + Intergenic
1112175548 13:97020007-97020029 ATATGGAGAAAGAAGGAGACTGG - Intergenic
1113101391 13:106723277-106723299 ATGTGCGTACACAGGGAGAATGG + Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113192405 13:107764457-107764479 ATGTAGACAGAGAGAGAGAAAGG + Intronic
1113518098 13:110918558-110918580 ATGTGGATAGGAATGGAGAAGGG - Intergenic
1114136224 14:19854982-19855004 ATGTAGAGAAAAAAGGAGAAAGG - Intergenic
1114388569 14:22281339-22281361 GTTTGGATCAAGAGGAAGAAAGG + Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114525410 14:23364836-23364858 ATGAGGAGTGAGAGGGAGAAGGG + Intronic
1114573905 14:23695317-23695339 ATCTGGAAAAAGAGGGGGGAGGG + Intergenic
1114817505 14:25977978-25978000 AGGTGGATAAAGATGAAGACAGG - Intergenic
1115375832 14:32674196-32674218 ATGGTGATCAAGAGGGAGACTGG + Intronic
1115627377 14:35207541-35207563 ATGTTGATAAAAAGGGAAACAGG - Intronic
1115801279 14:36996704-36996726 AAGTGGATGGAGAGGGAGAGTGG + Intronic
1115832462 14:37357380-37357402 ATGTGGAAAAAGGGTGAAAAGGG - Intronic
1116187855 14:41621523-41621545 ATGTGTAAAAAGAGTGAGACAGG + Intronic
1116239982 14:42328272-42328294 AAGGTGATAAAGAGGGAAAAAGG - Intergenic
1116405546 14:44561209-44561231 AAGTGAATAAAGTGGGAAAAGGG - Intergenic
1116464152 14:45212646-45212668 ATGTGCATTAAGAGGAAAAATGG + Intronic
1117399463 14:55345513-55345535 GTATGGATGAAGAGGGAGAAGGG - Intronic
1117531648 14:56665728-56665750 ATATGGAGAAAGAGAGAGAGAGG - Intronic
1118020899 14:61713143-61713165 ATGAGGATAAAGAGGTGGACAGG + Intronic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1119064808 14:71514412-71514434 ATGTGCATTAAGAGGCAAAATGG - Intronic
1119266391 14:73265261-73265283 ATCTGGCTGGAGAGGGAGAAGGG + Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1119788299 14:77328645-77328667 ATGAGGAAACAGAGGGAAAATGG + Intronic
1119945132 14:78685418-78685440 ATGAGGATAGAGAGGCAGCAAGG - Intronic
1120208609 14:81612476-81612498 ATGCAGATTAAGAGGGAAAATGG + Intergenic
1120387103 14:83860504-83860526 ATGTGGATTAATAGGGAAATAGG + Intergenic
1120652800 14:87154969-87154991 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1120686496 14:87543858-87543880 AAGTAGATAAAGAAGAAGAAAGG + Intergenic
1120813822 14:88832138-88832160 ATGTGGATGAAGAGTGTGTAGGG - Intronic
1121772549 14:96561344-96561366 ATCTGGATAATTTGGGAGAAGGG - Intronic
1121777061 14:96598093-96598115 AGGAGGAGGAAGAGGGAGAAGGG - Intergenic
1121864911 14:97353719-97353741 ATGTGGCTGAGGAGGAAGAAAGG - Intergenic
1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG + Intergenic
1123825131 15:24073601-24073623 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1123894596 15:24816028-24816050 AAGAGTATAAAAAGGGAGAAAGG - Intergenic
1124228858 15:27923209-27923231 AAGTGGATAAAGTGGTAGACTGG - Intronic
1125364609 15:38900571-38900593 ATGTGGAATCTGAGGGAGAAAGG + Intergenic
1126018955 15:44380313-44380335 ATGAGGATAAAAAGGGAGGTGGG + Intronic
1126410454 15:48368124-48368146 ATGTAGAGAAAGGGGGAGAAAGG - Intergenic
1126567806 15:50117958-50117980 ATGAAGGTAGAGAGGGAGAATGG + Intronic
1126749565 15:51863114-51863136 ATTTGGATAAAGTGGAGGAAAGG - Intronic
1127684879 15:61333655-61333677 ATGTTGAGAAAGATGGAGATAGG + Intergenic
1129746950 15:78028845-78028867 ATGTGGCAAAGGAGGGGGAAGGG + Intronic
1131456901 15:92588657-92588679 AGGTGGATAGAAAGGAAGAAAGG - Intergenic
1131732029 15:95292121-95292143 ATATGGAAAAGGAGGGAAAAAGG - Intergenic
1132122466 15:99189298-99189320 GTGTGGATAAAATGGTAGAATGG + Intronic
1133664864 16:7956719-7956741 ATGTGGATACAAAGAGAGGATGG + Intergenic
1134383554 16:13750364-13750386 AAGGGGATAAAGAGGAAGACGGG - Intergenic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135617389 16:23923523-23923545 ATGTGGACCAAGAGTGGGAAAGG + Intronic
1135985762 16:27182825-27182847 ATGGGGGTAGGGAGGGAGAAAGG + Intergenic
1136029811 16:27494782-27494804 ATCTGGATGAAGATGGAGAGGGG + Exonic
1136069578 16:27779655-27779677 AAGTGGCTGAAGGGGGAGAAGGG - Exonic
1136238882 16:28932323-28932345 CTGTGGAGAGAGAGGGAGAGAGG - Intronic
1137462022 16:48673008-48673030 AAGAGGATAAAGAGAAAGAAAGG + Intergenic
1138034530 16:53590967-53590989 GTTTGGATAAAGATGGGGAAGGG + Intergenic
1138579324 16:57929974-57929996 ATGTGGAGAAATAGGAAAAATGG + Intronic
1138976899 16:62218639-62218661 AAGTGGAAAATGAGGGAGGAAGG - Intergenic
1139216406 16:65128015-65128037 ATGTGGAGAGAGAGAGAGAGAGG - Intergenic
1139294083 16:65884879-65884901 AACTGGAAAAATAGGGAGAAGGG - Intergenic
1139694245 16:68662269-68662291 ATGTGGCTAGAGAGAGAGATTGG + Intronic
1139743204 16:69053269-69053291 ATGTAACTAAATAGGGAGAATGG - Intronic
1139751849 16:69113709-69113731 ATGTGGAAGAAGAGCAAGAAAGG - Intronic
1139771364 16:69280250-69280272 CTGTGTATAAAGAGGTAGACAGG - Intronic
1140175412 16:72654442-72654464 ACTGGGATAAAGAGTGAGAAGGG + Intergenic
1140315660 16:73894317-73894339 ATGGGGAGAGAGAGGGAGAGAGG + Intergenic
1141250049 16:82347489-82347511 ATGTAGAGAGAGAGAGAGAAAGG - Intergenic
1141452045 16:84110930-84110952 ATGTGCATAAACAAGGAGACTGG + Intronic
1142024449 16:87804947-87804969 ATGTGGAGAGAGAGGGCGGATGG + Intergenic
1142333761 16:89473342-89473364 AGGTGGAGAAAGAGGCAGACTGG + Intronic
1142852806 17:2712263-2712285 ATGGGGATCAAGAGTCAGAATGG + Intronic
1143092800 17:4459016-4459038 ATGGGGAAAGAGAGGGAGAGGGG - Intronic
1143449825 17:7029454-7029476 ATGGGGAGAAAGAGGGAAGAGGG - Exonic
1143592548 17:7894346-7894368 ATGGAGAGAGAGAGGGAGAAGGG - Intronic
1143665771 17:8358726-8358748 GTGTGGAGAGAGAGAGAGAAGGG - Intergenic
1143821459 17:9567529-9567551 ATGTGGAAAATAAGGAAGAAAGG + Intronic
1143854224 17:9836717-9836739 ATGTGAATAAGCATGGAGAATGG + Intronic
1143881981 17:10036767-10036789 AAGGGGAAAAAGAGGGAGAGTGG - Intronic
1143986195 17:10916497-10916519 ATCAACATAAAGAGGGAGAAAGG + Intergenic
1144204406 17:12969239-12969261 ATGTTGATAAAGGGGGGAAAAGG - Intronic
1144809961 17:17992742-17992764 CTGGGGAGAAAAAGGGAGAAAGG - Intronic
1145993335 17:29092096-29092118 AGGTGGTTAAACAGGGAGATGGG + Intronic
1146619468 17:34386345-34386367 ACGAGGATAAAGTGAGAGAAAGG - Intergenic
1146665391 17:34699167-34699189 ATGTGGATAGAGTGGGAGGAAGG + Intergenic
1146667144 17:34712798-34712820 ATGGAGATAAAGAGAGAGAGGGG - Intergenic
1146846535 17:36184617-36184639 ATGTGGAGAAAGAAGCAGAATGG - Intronic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1148643546 17:49205953-49205975 ATGAGGCTAGAGAGGGAGATTGG - Intronic
1149148999 17:53536456-53536478 ATGTGGTGAAAGAAGGAGCAAGG - Intergenic
1149183846 17:53973981-53974003 ATGTGAATAAGGTGTGAGAAGGG - Intergenic
1149258074 17:54849608-54849630 ATGTGCATTAAGAGGGAAAGTGG + Intergenic
1150644250 17:66968403-66968425 AGGAGGAGAAAAAGGGAGAAGGG - Intronic
1151037043 17:70812524-70812546 ATATTGATACAGTGGGAGAAGGG - Intergenic
1151762503 17:76113818-76113840 TGGTGGGGAAAGAGGGAGAAGGG + Intronic
1152948451 17:83211580-83211602 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1152948466 17:83211629-83211651 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1153707635 18:7762470-7762492 ATGAAGATAAAGAGGTAGACGGG + Intronic
1154044721 18:10894149-10894171 ATGTGCATTAAGAGGCAAAATGG + Intronic
1154235365 18:12600635-12600657 ACGTGAATAAATGGGGAGAAAGG - Intronic
1155659928 18:28236722-28236744 ATGTGGATAATGCGTGATAAAGG + Intergenic
1155851523 18:30780786-30780808 ATGTGGATGAAGAAAGAGCAGGG + Intergenic
1155992822 18:32297821-32297843 ATTTGAATAAAGATGGAGACAGG + Intronic
1156029416 18:32695087-32695109 ATATTGATAAAATGGGAGAAAGG + Intronic
1156469442 18:37368276-37368298 ATGGGGCTGAAGAGGGAGATGGG - Intronic
1156901225 18:42302368-42302390 ATGTGGATATTGAAGCAGAAGGG + Intergenic
1157390164 18:47295157-47295179 GTGTGCAGAAAGAGGGAGATGGG - Intergenic
1157461444 18:47899451-47899473 AAGTGGATGATTAGGGAGAAAGG + Intronic
1157574901 18:48737009-48737031 ATGTGGAGAATCAGGGAGACAGG - Intronic
1158330438 18:56356592-56356614 ATGCGGTTATAGAGGGAGCATGG - Intergenic
1158630768 18:59112130-59112152 GTTTGTAGAAAGAGGGAGAAGGG - Intergenic
1158654238 18:59314366-59314388 ATGTGGATAAAGAGAGGAATAGG - Intronic
1158708006 18:59811371-59811393 AGGAGAAGAAAGAGGGAGAAAGG - Intergenic
1159401402 18:67940570-67940592 ATGAGGATAGAGAGGCAAAAGGG + Intergenic
1159451152 18:68603880-68603902 ATGTGGATGAAGAGAGTAAAAGG + Intergenic
1159673587 18:71253367-71253389 AACAGGATAGAGAGGGAGAAAGG - Intergenic
1160129583 18:76212878-76212900 AGGGAGAGAAAGAGGGAGAAGGG - Intergenic
1162197488 19:8996730-8996752 ATGAGGAGAAAGAGGAGGAAGGG + Intergenic
1164082951 19:21876301-21876323 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164190931 19:22916418-22916440 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1166498120 19:43320008-43320030 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1167605638 19:50480240-50480262 ATGAGGAGGACGAGGGAGAAGGG - Intronic
1167764611 19:51473185-51473207 AAGTGGATAGAGAGGGTGAGAGG + Intergenic
1167875685 19:52410324-52410346 ATTGGGTAAAAGAGGGAGAAGGG + Intronic
924973142 2:149609-149631 TGGTGGATAGAGAGAGAGAACGG - Intergenic
925817628 2:7768905-7768927 ACGTGGCTAGAGAAGGAGAAAGG - Intergenic
927087251 2:19684669-19684691 ACGTGGATAAAGACAGAGAGAGG - Intergenic
927372161 2:22368803-22368825 ATGTAAACAAAGAGAGAGAATGG + Intergenic
929298263 2:40272350-40272372 AGGGAGATAAGGAGGGAGAAAGG + Intronic
929780322 2:44953004-44953026 ATGAGGCAAAAGCGGGAGAAGGG + Intergenic
929866361 2:45720564-45720586 ATGTGGGCAAAGAGGGATACTGG - Intronic
930167773 2:48220165-48220187 AGGTGGCTAAAGAGGGAGCAAGG + Intergenic
930269241 2:49236437-49236459 AGCTGCATAAAGTGGGAGAAAGG - Intergenic
930298135 2:49580576-49580598 ATGAATATAATGAGGGAGAAAGG + Intergenic
930380434 2:50621252-50621274 TTGTGGAGAAGGGGGGAGAAAGG + Intronic
930891094 2:56389015-56389037 TTGGGGAGAAAGTGGGAGAAGGG - Intergenic
931114387 2:59148691-59148713 ATGTGCATTAAGAGGCAAAATGG + Intergenic
931496830 2:62816894-62816916 ACGGGGATAAACAGGTAGAAGGG - Intronic
931517329 2:63057778-63057800 ATGTAGATAAAGAGGAGGAGGGG - Exonic
931756260 2:65377438-65377460 AGGAGGATAAGGATGGAGAATGG - Intronic
931895547 2:66725505-66725527 ATCAGCAAAAAGAGGGAGAAGGG - Intergenic
932175792 2:69600322-69600344 TTGTGAATAAAGAGGAAAAAAGG + Intronic
932620045 2:73259821-73259843 ATGTGGCTGAAGGGGGAGGAAGG + Intronic
933032701 2:77351752-77351774 ATGTGTGTAAAGAGGAGGAAGGG + Intronic
933064853 2:77780318-77780340 ATGTGCATTAAGAGGCAAAATGG - Intergenic
933167862 2:79095250-79095272 TTGTCGGTATAGAGGGAGAAAGG + Intergenic
933178920 2:79208063-79208085 ATGGGAATCAGGAGGGAGAAGGG - Intronic
933377792 2:81502190-81502212 AGGTGGAGCACGAGGGAGAATGG + Intergenic
933592842 2:84251633-84251655 ATATGGAGAGGGAGGGAGAAAGG + Intergenic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
933942032 2:87253066-87253088 CTATGGTTAAAGAGGCAGAAGGG + Intergenic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
936035152 2:109105214-109105236 ATGTGCATTAAGAGGCAAAACGG + Intergenic
936338190 2:111608504-111608526 CTATGGTTAAAGAGGCAGAAGGG - Intergenic
936781732 2:116040928-116040950 AAGTGGATTCAGAGGAAGAAGGG + Intergenic
936927117 2:117748782-117748804 ATGTCTCTAAAGAGGGTGAAAGG - Intergenic
936974393 2:118204708-118204730 ATGTGGAGAGACAGAGAGAAGGG - Intergenic
937392341 2:121500536-121500558 AATTAGATAAAGAGGGAGACAGG + Intronic
938131033 2:128715694-128715716 AGGAGGATAAACAGGGAGAGAGG + Intergenic
938227668 2:129629958-129629980 ATGTGGATATAGAGAGAAATAGG - Intergenic
938824925 2:134995209-134995231 AGGAGGCTGAAGAGGGAGAATGG + Intronic
939007023 2:136801026-136801048 CAGTGGGTAAAGAGGGACAAAGG - Intronic
939134482 2:138277252-138277274 ATGTGGATAAAGGCAGATAAGGG + Intergenic
939290789 2:140192339-140192361 GTGTGGAGAAAAAGGGAGAAAGG + Intergenic
940023918 2:149185078-149185100 ATGTGGTAAGAGAGGGAGACCGG + Intronic
940159117 2:150692705-150692727 ATGTGGAAAGAGAGTGAGAGAGG - Intergenic
940215985 2:151304050-151304072 CTGTGGTTAAATAGGAAGAAGGG - Intergenic
940330121 2:152465430-152465452 AAGTGGTTAAAGTGGGACAAAGG + Intronic
940398403 2:153220388-153220410 ATGTGCATTAAGAGGCAAAATGG + Intergenic
940516569 2:154691187-154691209 AGGTGAATATAAAGGGAGAATGG - Intergenic
941457778 2:165730597-165730619 AGGAGGCTAAGGAGGGAGAATGG + Intergenic
941674322 2:168327689-168327711 ATATGTATGAAGAGAGAGAAAGG - Intergenic
941770647 2:169341881-169341903 AAGTGAATAGAGAGGCAGAAAGG - Intronic
941999257 2:171629661-171629683 ATGAGGCTGAAGTGGGAGAATGG + Intergenic
942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG + Intergenic
942394000 2:175526968-175526990 ATGCAGATAAAGATGGGGAAGGG - Intergenic
942617819 2:177812798-177812820 AAGCGGGTAAAGAGGGAAAAAGG + Intronic
942634423 2:177987232-177987254 AAGGGGATGAAGAGGGAAAAGGG + Intronic
943731375 2:191306670-191306692 AGGTGAAGAGAGAGGGAGAAAGG + Intronic
943889381 2:193267043-193267065 ATGTGAACAAATAGGGAGATTGG - Intergenic
944525220 2:200612014-200612036 AGGGGGAGAAAGAGCGAGAATGG - Intronic
944572605 2:201059642-201059664 ATGAGGCTTAAGAGGGAGAAGGG - Intronic
945123393 2:206483193-206483215 ATGTGGATAACAAGGCAGAGAGG + Intronic
945342556 2:208674330-208674352 ATGTGCATTAAGAGGCAAAATGG - Intronic
945555603 2:211271540-211271562 ATGTGCATTAAGAGGCAAAATGG - Intergenic
945732983 2:213563913-213563935 ATGTGGAAAAACATGGAGTATGG + Intronic
945780842 2:214169848-214169870 CTGGGGATAAAAAGGGAAAACGG + Intronic
946565167 2:220956529-220956551 AAGTGGTGAAAGAGGGATAAAGG - Intergenic
946580082 2:221119011-221119033 ATGTAGAGAAAGAGGGAGGGTGG - Intergenic
946907175 2:224428640-224428662 TTGTGTATAAAGAGAGAGAATGG - Intergenic
946924686 2:224615306-224615328 ATGGGGAAAGAAAGGGAGAATGG - Intergenic
946997092 2:225405777-225405799 ATGTGGACAATGGGGGACAATGG + Intronic
946997584 2:225412683-225412705 TTTTGGAGAAACAGGGAGAAGGG - Intronic
947067499 2:226245226-226245248 ATGTAGAAAAAGAGGAAAAAAGG - Intergenic
947295819 2:228628839-228628861 ATGTGGAGAAGGAGGCAGATTGG + Intergenic
948091864 2:235301984-235302006 AGGAGGATGAAGAGGGAGGAGGG - Intergenic
948230673 2:236346864-236346886 ATGTGCATTAAGAGGCAAAACGG + Intronic
948625701 2:239266669-239266691 ATGTGGAGACAGAGGGAGAGAGG - Intronic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169473616 20:5910803-5910825 ATTTGGAAATAAAGGGAGAAGGG + Intergenic
1170391898 20:15884287-15884309 AGGTGAATAGAGAGGGAGAAGGG + Intronic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1170750952 20:19144491-19144513 ATGAGGTAAAAGAGGGAGAGAGG + Intergenic
1170956232 20:20982326-20982348 ATGTGGATGAAGAGGTATTATGG - Intergenic
1171011817 20:21513157-21513179 TTAAGGAGAAAGAGGGAGAAGGG - Intronic
1171156449 20:22878910-22878932 ATGGGGATAATGAGGGATGAAGG - Intergenic
1171266573 20:23776331-23776353 AGATGGATAAAGAGGGGGATGGG - Intergenic
1172022967 20:31927544-31927566 TAGTGGATACAGAGGTAGAAAGG + Intronic
1172206202 20:33164527-33164549 ATGTGGAGAGAGAAGAAGAAAGG - Intronic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172292194 20:33784285-33784307 ATGGGGAAGAAGAGGGAGATGGG - Intronic
1172430109 20:34883208-34883230 TTGTAGTTGAAGAGGGAGAAAGG + Intronic
1173355776 20:42288507-42288529 AAGTGGGGAAAGAGGGAGAGAGG - Intronic
1173439858 20:43066613-43066635 GTGTGGAGAACAAGGGAGAATGG - Intronic
1173490831 20:43479848-43479870 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1175773533 20:61638667-61638689 ATGTGGGCAGAGAGGAAGAAAGG - Intronic
1176673258 21:9753356-9753378 ATGTGGTTAAAGACGGACAGGGG + Intergenic
1176813611 21:13572840-13572862 ATGTAGAGAAAAAAGGAGAAAGG + Intergenic
1177158508 21:17522818-17522840 ATGTGGGTAAAGTTGGAGAAGGG - Intronic
1177192669 21:17869234-17869256 ATGTGGGTAGAAGGGGAGAAAGG + Intergenic
1177421672 21:20867348-20867370 AGGGGGACAGAGAGGGAGAAAGG - Intergenic
1178725235 21:35045548-35045570 ATGTGATGAAACAGGGAGAAGGG + Intronic
1179005234 21:37508072-37508094 GTGTGGGGAAAGAGGGAGAGAGG - Intronic
1179069409 21:38057688-38057710 ATAGGGATAGAGAGAGAGAAGGG - Intronic
1179364351 21:40742361-40742383 ATTTGTTTAAAGATGGAGAAAGG + Intronic
1179836001 21:44034028-44034050 ACGTGCATAAAGACAGAGAAAGG + Intronic
1180695758 22:17750496-17750518 ATGTTTATAGAGAGAGAGAATGG + Intronic
1181914339 22:26267527-26267549 CTCTGGGTAAAGAGGGAGTAGGG + Intronic
1182367628 22:29789499-29789521 ATGTGGCCCCAGAGGGAGAAAGG - Intronic
1182627169 22:31655955-31655977 ATGTGGATGATGAGAAAGAAAGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182640704 22:31764745-31764767 ATGGAGAGAAAAAGGGAGAAGGG - Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1183271394 22:36864799-36864821 ATGAGGATAAGGATGCAGAAGGG - Intronic
1183469321 22:37997228-37997250 AAGTGGAAAAGAAGGGAGAAAGG - Intronic
1183950221 22:41348595-41348617 AAGGGGAACAAGAGGGAGAAAGG - Intronic
1184233630 22:43171559-43171581 ATGTGGACACAGAGGGGGATGGG - Intronic
1184355361 22:43975917-43975939 ATGATGAGAGAGAGGGAGAAGGG - Intronic
1184598425 22:45528061-45528083 ATGTGTATATAGAGCGAGAGTGG + Intronic
949171849 3:1009282-1009304 TTGGGAATAAAGAGAGAGAAAGG - Intergenic
949396110 3:3616080-3616102 ATGTGGAGAAAGAGGAGGGAGGG + Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949587001 3:5451113-5451135 ATGTGGATAAGGAGTGAGAGAGG + Intergenic
949678137 3:6481732-6481754 ATGAGGACAAAGAGGCAGAGGGG - Intergenic
949906734 3:8864220-8864242 CTGTGGAGAGAGAGGGGGAAGGG - Intronic
950236507 3:11326245-11326267 AAGTGTAAAAAGGGGGAGAAGGG - Intronic
950628114 3:14263354-14263376 ATGTGCATTAAGAGGCAAAACGG - Intergenic
950922092 3:16704919-16704941 AGGAGGAGAAAGAGGGAGAGGGG + Intergenic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
951388480 3:22072678-22072700 AAAAGGAGAAAGAGGGAGAAAGG + Intronic
952002983 3:28808605-28808627 ATGTGGATAGGGAGCCAGAAGGG + Intergenic
952220749 3:31321736-31321758 ATGTTGAGAAAGAGGAAAAAAGG - Intergenic
953268525 3:41416798-41416820 AGGAGGAAAAGGAGGGAGAAAGG + Intronic
953756751 3:45653230-45653252 ATTTGGATGAGGAGGGAGAGAGG + Intronic
953869656 3:46615391-46615413 GTGTGGAAAATGAAGGAGAAGGG - Intronic
954722589 3:52578080-52578102 ATGTGAATATCCAGGGAGAAAGG - Intronic
955237989 3:57156795-57156817 ATGTGGGCAAAGCTGGAGAAGGG - Intronic
955280994 3:57594882-57594904 ATGTGCATGAACAGGGAAAAAGG - Intronic
955529682 3:59860057-59860079 AGGTGGATAATCAGGGTGAAAGG + Intronic
955715549 3:61825747-61825769 AGGAGGATGAGGAGGGAGAATGG - Intronic
957172524 3:76756908-76756930 ATGTGGAGAAAGACTGTGAAGGG + Intronic
957660863 3:83150681-83150703 ATGTGGAGTAAGAGGGACAGAGG - Intergenic
958263054 3:91404572-91404594 TTGTGTATAAAGAGGGATCATGG - Intergenic
958435376 3:94089487-94089509 ATGTGCATAAAGAGACAAAATGG + Intronic
958492710 3:94797762-94797784 ATGTGCATTAAGAGGCAAAAAGG - Intergenic
958849589 3:99307988-99308010 ATGTGGATAAAGACAAACAATGG + Intergenic
959066307 3:101660699-101660721 ATATTGATAAAGAGGGGTAATGG - Intronic
959168020 3:102805145-102805167 ATGAGGAAACTGAGGGAGAAAGG + Intergenic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
961819974 3:129571038-129571060 ACGTGGATAACGAGGGTGAGAGG + Exonic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
963020686 3:140870159-140870181 CTCTGGAGAAAGAGGGGGAAGGG + Intergenic
963197193 3:142545444-142545466 ATGTTGAAATATAGGGAGAAAGG + Intronic
964136367 3:153349237-153349259 CTGAGGGTAAAGAGGCAGAAAGG - Intergenic
964249754 3:154699354-154699376 ATGTGTATTAAGAGGCAAAATGG + Intergenic
964551199 3:157886796-157886818 ATGTAGAGGAAGAGGGAGACTGG - Intergenic
964769536 3:160210033-160210055 ATGAGGAGAGAGAGGGAGAGAGG - Intergenic
964951717 3:162303179-162303201 ATGTGTACTAAGAGGAAGAATGG + Intergenic
965307727 3:167087934-167087956 AGGAGAATAAAGAGGAAGAAAGG - Intergenic
965376105 3:167926305-167926327 ATGTGTATTAAGAGGCAAAATGG + Intergenic
965512375 3:169582402-169582424 AGGAGGAAAAAGAGGGAGATGGG + Intronic
965872472 3:173278427-173278449 TTGTAGGTATAGAGGGAGAAAGG - Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966618213 3:181935042-181935064 AGCTGGATGAAGAGAGAGAAGGG + Intergenic
967019523 3:185510302-185510324 CTGTGGACAGAGAGGGAGACAGG - Intronic
967082363 3:186061860-186061882 ATGTGAATCAAAAGGAAGAAGGG - Intronic
967577330 3:191108817-191108839 ATGGGGAGAAAGAGAGAGAAGGG - Intergenic
967805284 3:193710332-193710354 ATGAGGAAAAAAAGGGAGCAAGG - Intergenic
967900428 3:194444967-194444989 ATATGGTTAAAGTGGGAGAGGGG + Intronic
967980743 3:195063642-195063664 CTGTGGAGAATGCGGGAGAAGGG + Intergenic
968416187 4:436228-436250 ATGCTGATAAAAAGGGAAAAAGG + Intronic
969199646 4:5592661-5592683 ATGTGCATTAAGAGGCAAAATGG + Intronic
969233914 4:5851818-5851840 AGGAGGAGAAAGAAGGAGAAGGG + Intronic
970095639 4:12460320-12460342 CAATGGATAAAGAGTGAGAAAGG - Intergenic
970370295 4:15399102-15399124 ATGTGCATTAAGAGGCAAAATGG - Intronic
970748134 4:19324884-19324906 ATGTATATAAAGAGAGTGAAAGG - Intergenic
971218070 4:24680487-24680509 CTGCTGAAAAAGAGGGAGAAGGG + Intergenic
971383297 4:26119580-26119602 ATGTGGATAGAAAGGAAGGAGGG - Intergenic
971397319 4:26240825-26240847 TTGATGAGAAAGAGGGAGAAAGG + Intronic
971504569 4:27352201-27352223 ATGTTGACAAATAGGGACAATGG - Intergenic
971527545 4:27639860-27639882 CTGTGGATACAGAGGGACAGAGG - Intergenic
972312369 4:37892857-37892879 AGCTGGATAATGAGGAAGAAGGG - Intronic
972361382 4:38328629-38328651 ATGGAGAAAAAGAGGGAGAGAGG - Intergenic
972697085 4:41458228-41458250 ATGTGCAAAAAGAAGGAGATTGG - Intronic
972831326 4:42817012-42817034 AAGTGAATAAAGAGGGAGGCAGG + Intergenic
973009091 4:45049408-45049430 ATTTGGAGAAAGTGTGAGAAGGG - Intergenic
973074803 4:45910365-45910387 ATCTGAATAATGGGGGAGAATGG + Intergenic
973154022 4:46925873-46925895 ATGTGGCCAAAGAATGAGAAAGG - Exonic
973273941 4:48289217-48289239 ATGTGGAGAAAGCAGGAGCAAGG - Intergenic
973830940 4:54758034-54758056 ATGGGGAGAAAGAGGAAGATGGG + Intergenic
973847120 4:54924209-54924231 AAATGGACAAACAGGGAGAATGG - Intergenic
973980281 4:56303039-56303061 ATGTGTATAAAGAAGGAGTCTGG + Intronic
974020434 4:56687951-56687973 AGGTGGATAGAGAGGGAGGGAGG + Intergenic
974145541 4:57943120-57943142 ATGGGGATGAAGGAGGAGAAGGG + Intergenic
974331253 4:60481886-60481908 ATGTAAATAAAGAGAGAAAATGG - Intergenic
974622121 4:64370078-64370100 ATGTGAACAAACATGGAGAAAGG + Intronic
975835253 4:78416294-78416316 ATGTGATGAGAGAGGGAGAAAGG + Intronic
975902093 4:79165213-79165235 ATGGGGATAATGATGGAGAATGG + Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976615225 4:87069426-87069448 ATAGGGAGAGAGAGGGAGAAGGG - Intronic
977086847 4:92610545-92610567 AAGTGGAAAAGGAGGGGGAAGGG - Intronic
977329277 4:95617035-95617057 ATATTGATAAAGTGGAAGAAAGG - Intergenic
977546459 4:98387585-98387607 ATGGGGAGGAAGAGGAAGAAAGG - Intronic
977769221 4:100837299-100837321 ATGTGGAGAAAGAAAGAGAGAGG - Intronic
977912003 4:102548132-102548154 ATGTGGAGAAAGAGAGAGAAAGG + Intronic
978588381 4:110297351-110297373 CTCTGGACAAAGAGGGTGAAGGG + Intergenic
980057371 4:128091320-128091342 ATGTGAATAAAGAAAAAGAAAGG - Intronic
980092838 4:128460174-128460196 GTGTGAACAAAGAGGGGGAAAGG + Intergenic
980130736 4:128813195-128813217 AGGTGGAGAAAGGTGGAGAAAGG + Intronic
980181416 4:129406185-129406207 AGGGGTATAAACAGGGAGAATGG + Intergenic
980192826 4:129546302-129546324 ATGAGGAGGAAGAGGGAGAAAGG - Intergenic
980255000 4:130368223-130368245 CTCTGTATAAAGAGAGAGAATGG + Intergenic
980499482 4:133629836-133629858 ATGTAGAGTATGAGGGAGAAAGG + Intergenic
980571621 4:134627356-134627378 ATGTGCATTAAGAGGAAAAATGG - Intergenic
981041940 4:140231315-140231337 ACGTGGACAAAGAGTGAGTATGG - Intergenic
981466978 4:145084295-145084317 AGCTAGATAAAGAGGTAGAATGG + Intronic
981694454 4:147546156-147546178 GTGTGGAGAAGGGGGGAGAAAGG - Intergenic
982326995 4:154138047-154138069 AGGAGCACAAAGAGGGAGAAGGG + Intergenic
982469540 4:155771314-155771336 ATTTTAATAAAGAGAGAGAAAGG + Intronic
982759667 4:159266150-159266172 ATGTGGCAAAAGAAGGATAATGG + Intronic
982913539 4:161175905-161175927 AAGTGGATGAAGGGGGAGGAGGG + Intergenic
983105237 4:163678796-163678818 ATGTGGATAAACAGTGAGGCAGG - Intronic
983452108 4:167923799-167923821 AGGTGGAGAAAGGGAGAGAAGGG - Intergenic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
983827199 4:172278144-172278166 ATGTGGAGAAATGGGAAGAAAGG - Intronic
983868169 4:172792845-172792867 ATATAGATAAAGAGGGAGGAAGG - Intronic
984212585 4:176868673-176868695 ATGTGGAGAATGAGTGGGAAGGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984812267 4:183805982-183806004 ACTTAGATAAAGAGGTAGAAAGG + Intergenic
985401448 4:189598327-189598349 ATGTGGTTAAAGATGGACAGGGG - Intergenic
986465380 5:8015992-8016014 AACTGGAGAAAGTGGGAGAAGGG + Intergenic
987586326 5:19861548-19861570 TTGAGAATAAAGAGGGACAAAGG + Intronic
988737675 5:34039041-34039063 ATGTGCATTAAGAGGCAAAATGG + Intronic
988882160 5:35515533-35515555 ATGTGCATTAAGAGGCAAAATGG + Intergenic
988932448 5:36049630-36049652 ATTTGGATAAGGAGAGAAAAGGG - Intronic
989225646 5:39025130-39025152 AGGAGGAGAAGGAGGGAGAAAGG - Intronic
989512979 5:42309881-42309903 ATGTGGGTAGAGAAGGAGAAAGG + Intergenic
989559995 5:42839367-42839389 ATGTGAATAAAGAGAGAAGATGG + Intronic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
991180247 5:63742645-63742667 ATGTGCAGCAAGAGGGAGGATGG - Intergenic
992220501 5:74567450-74567472 TTGTGGATTGTGAGGGAGAATGG - Intergenic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
993099407 5:83518899-83518921 ATGTGGAGAAAGCTGGAGACAGG + Intronic
993295231 5:86130230-86130252 ATGGTGATAGAGAGGGAGATTGG - Intergenic
994860245 5:105183191-105183213 ATGTGGATAAAAAGGAAGCCTGG + Intergenic
995110162 5:108420045-108420067 ATGTGGATGAAGAGGACTAAGGG - Intergenic
995197376 5:109386814-109386836 ATGAGGATAAATAGGTAGACAGG - Intronic
995571326 5:113485577-113485599 TTGGGGATGAAGAGGGAGACAGG + Intronic
996387512 5:122925017-122925039 ATGTGGGGAGAGAAGGAGAAGGG - Intronic
996520004 5:124415592-124415614 AAGTGGACAAAGGGGGAAAACGG + Intergenic
996619291 5:125480452-125480474 ATGTGTAAAAAGAGAGAAAAGGG - Intergenic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
996847302 5:127913983-127914005 ATGTGAATAAAAATGGAGAGGGG + Intergenic
996930472 5:128880333-128880355 ATATGGAATAAGAGGAAGAAGGG + Intronic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
998533585 5:142908431-142908453 ATGCAGAGAAAGAGGGAAAAGGG - Intronic
999061022 5:148635355-148635377 TTGTGGATAGAGAGGGGGAGTGG + Intronic
999205431 5:149844651-149844673 AAATAGATAAAGAGGCAGAAGGG + Intronic
999213010 5:149906584-149906606 ATGAGGCTCAAGAGGGAGGAAGG - Intronic
999317718 5:150594954-150594976 ATGTGGAGGATGAGGGAGATGGG + Intergenic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999691502 5:154149904-154149926 CTGTGGATACAGAGGGACAGAGG + Intronic
999968545 5:156835622-156835644 ATGGAGTTGAAGAGGGAGAATGG - Intergenic
1000180748 5:158808447-158808469 ATGAGGCTAGAAAGGGAGAATGG - Intronic
1000646179 5:163762963-163762985 TTGTGGAGAGAGAGGGAGGAGGG + Intergenic
1001294500 5:170489481-170489503 ATATGGAGAAAGAAGGAGAGAGG - Intronic
1001490908 5:172154471-172154493 GGGTAGATAAAGAGGGGGAAAGG - Intronic
1001977783 5:176014349-176014371 ATGCGGACGAAGAGGAAGAAGGG + Intronic
1002018781 5:176348149-176348171 CTGTGGTTTCAGAGGGAGAAGGG - Intronic
1002742618 5:181444735-181444757 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1002742633 5:181444784-181444806 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1003039811 6:2677356-2677378 CTGTGGATCAACAGGTAGAAGGG - Intronic
1003870548 6:10399368-10399390 ATGTGGGGAAAGAGGAGGAATGG - Intronic
1004173575 6:13318750-13318772 ATATAAATAAAGAAGGAGAAGGG + Intronic
1004503515 6:16229340-16229362 ATCTGGAAAAAGAGGGAGGCAGG - Intergenic
1004716824 6:18225772-18225794 ATGTGGAAAAAATGGGATAAAGG - Intronic
1004878727 6:19984076-19984098 CTGTGGATAGAGAGGGTCAAAGG - Intergenic
1004886512 6:20056440-20056462 TTGAGAATAAAGAGGGAGCATGG + Intergenic
1004938737 6:20533480-20533502 ATATGGATAAACAGAGAAAAGGG + Intergenic
1004969791 6:20897108-20897130 ATGTGAATAAACAGCTAGAAGGG - Intronic
1005030937 6:21508485-21508507 AAGCGGATAGAGGGGGAGAAGGG - Intergenic
1005060703 6:21774514-21774536 AAGTGGGGAATGAGGGAGAAAGG - Intergenic
1005109076 6:22258851-22258873 ATGTGGGTAATGAAGGAAAAAGG + Intergenic
1005136299 6:22571932-22571954 TTGTGGAAAAATAGGGTGAAGGG + Intergenic
1005575539 6:27186034-27186056 ATCTGAATACAGAGGGGGAAAGG - Intergenic
1005579991 6:27224734-27224756 AGGTGGAGAATGAGGGAGTAGGG - Intergenic
1005938877 6:30546156-30546178 ATGCGGATGAGGAGGGAGAAGGG - Exonic
1006135385 6:31892733-31892755 ATCTGGAAGAAGAGAGAGAATGG + Exonic
1006823788 6:36918752-36918774 ATAGGGATAAAGAGAGAGATGGG - Intronic
1007224826 6:40305826-40305848 CTATGGCTAAAGAGGCAGAAGGG + Intergenic
1007307236 6:40916747-40916769 ATGTGGGTCAAGACTGAGAACGG + Intergenic
1007437111 6:41822226-41822248 ATGTGGAGAAAATGGGAGGAGGG - Intronic
1007982432 6:46172416-46172438 ATGGGGATTAAGAGGGAGGCTGG + Intergenic
1008172598 6:48227552-48227574 ATGTTGAAAAAGAGTAAGAAAGG + Intergenic
1008395414 6:51000884-51000906 AAGTGGAGAAGGAGGGACAAAGG - Intergenic
1008513417 6:52298029-52298051 ATAAGGATAGAAAGGGAGAAGGG + Intergenic
1008992353 6:57618316-57618338 TTGTGTATAAAGAGGGATCATGG + Intronic
1009180976 6:60517428-60517450 TTGTGTATAAAGAGGGATCATGG + Intergenic
1009272645 6:61633992-61634014 ATGTTGATAAACTGGGACAATGG + Intergenic
1009890099 6:69670243-69670265 ATATGCATGGAGAGGGAGAAAGG + Intergenic
1010974807 6:82299635-82299657 AGGTGGATAGATAGGTAGAAAGG + Intergenic
1011031555 6:82929793-82929815 GTGTGGATACAGAGGGAATATGG - Intronic
1011051024 6:83149761-83149783 AACAGGATAAAGAAGGAGAAGGG + Intronic
1011937833 6:92803256-92803278 ATGTGAAGAGAAAGGGAGAAAGG + Intergenic
1012237248 6:96833239-96833261 ATGTGGATACAAAGGGAGTTGGG - Intronic
1012409002 6:98934769-98934791 ATATGGATCAAGAGGAAGACTGG + Exonic
1012505496 6:99941628-99941650 ATGTGGCAAAAGAGAGAGACAGG - Intronic
1012592146 6:100995314-100995336 ATGTGGATTGAAAGGGACAAGGG - Intergenic
1013252863 6:108352121-108352143 ATGTGGAAAATGTGGGAGAGAGG - Intronic
1013571401 6:111430008-111430030 AAGTGGAAAAAGAGAAAGAAAGG + Intronic
1014191434 6:118501032-118501054 AAGTGGAAAAAGAGAAAGAAAGG - Intronic
1014260148 6:119207184-119207206 ATGTGTACAAAGAGGAAGGAAGG - Intronic
1014318517 6:119896563-119896585 ATGTGCATAAACAGAAAGAACGG - Intergenic
1014384929 6:120788371-120788393 ATGTGGTCAAAGAAAGAGAAAGG - Intergenic
1015056810 6:128912346-128912368 TTGTGTAAAAAGAGGGAGAAAGG - Intronic
1015067760 6:129052013-129052035 ATGTAGAGAGAGAGAGAGAAAGG + Intronic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1016477174 6:144440552-144440574 TTCTGGATAAAGAATGAGAAAGG - Intronic
1016723042 6:147324687-147324709 AGGAGGAAGAAGAGGGAGAAAGG - Intronic
1017913242 6:158813127-158813149 ATGTGGCTAGAGAGGAAGACAGG - Intronic
1018306883 6:162467181-162467203 CTGTGGAGAAAAAGGAAGAAGGG - Intronic
1018462920 6:164016405-164016427 ATGTAGTTAAAAAGGAAGAAAGG - Intergenic
1018777781 6:167034226-167034248 CTGTGGATTAAGAGGGATCAGGG + Intronic
1019026832 6:168972812-168972834 ATATGGAGAAAGAGAGAGAAAGG - Intergenic
1019247753 6:170720474-170720496 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1019247768 6:170720523-170720545 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1019721231 7:2572838-2572860 ACGTGGATAAAGAGAGAGGCCGG - Intronic
1020114050 7:5465662-5465684 ATCTGGAAAAAGGGGGAGAGAGG + Intronic
1021199863 7:17716682-17716704 ATGTGGAGAAAGAGAGACACAGG - Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021811288 7:24403970-24403992 GTGTGGATGAAAAGTGAGAAAGG - Intergenic
1022182245 7:27932139-27932161 ATGTGTATGGAGAGTGAGAAAGG + Intronic
1022227713 7:28380817-28380839 ATGTGTAGAAATAGGGACAATGG + Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022700052 7:32751158-32751180 ATGTGGGCAAAGAGAGACAAAGG + Intergenic
1023126272 7:36957470-36957492 ATGATGATAAAGAGAGGGAAGGG - Intronic
1023206320 7:37753913-37753935 ATGTAGATAAAAGGGGAAAAGGG - Intronic
1024193987 7:47040864-47040886 ATGTGCATTAAGAGGCAGAATGG + Intergenic
1024228118 7:47343903-47343925 CTATGGAGAAAGAGAGAGAATGG + Intronic
1024406038 7:48981808-48981830 AGGTAGATAAAGAAGGAAAAAGG - Intergenic
1024729366 7:52237007-52237029 ATGAGGAGAGAGAGAGAGAAGGG - Intergenic
1024928594 7:54645150-54645172 ATGTGGAATGAGAAGGAGAAGGG + Intergenic
1025072437 7:55912185-55912207 GTGGGGATAAAGAGTAAGAATGG + Intronic
1025299824 7:57809935-57809957 ATGAGGCTGAAGTGGGAGAATGG - Intergenic
1025710268 7:63901452-63901474 ATGTGGATATTGAGGGGGCAGGG + Intergenic
1026243985 7:68602113-68602135 ATGGGGAGAGAGAGGGAGAGGGG - Intergenic
1027857246 7:83527396-83527418 AGGTGGACAAATAAGGAGAAAGG + Intronic
1027941781 7:84691479-84691501 GAGTGGAGAAGGAGGGAGAATGG - Intergenic
1028006488 7:85575952-85575974 ATGTTGAGAGAGAAGGAGAAAGG + Intergenic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030515510 7:110533443-110533465 ATGTGCATTAAGAGGCAAAATGG + Intergenic
1030825794 7:114156089-114156111 ATGTGCATTAAGAGGCAAAATGG - Intronic
1031348050 7:120693569-120693591 AAGTGGAGGAAGAGGGAAAAAGG + Intronic
1031353699 7:120765147-120765169 TTGTGTATAGAGAGGAAGAAGGG - Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1032503234 7:132415626-132415648 AGGAGGAGAAAGAGGGAGAAAGG - Intronic
1032688489 7:134259197-134259219 ATGTCCAGAAAGAGGCAGAATGG + Intronic
1032991306 7:137397709-137397731 AAGTGGCTAACAAGGGAGAAAGG + Intronic
1034241541 7:149615091-149615113 ATGTGGATAGAGGGTGAGCACGG + Intergenic
1035149021 7:156850986-156851008 GAATGGATAAAGAGAGAGAAAGG - Intronic
1035500368 8:87413-87435 AGGGGGATGGAGAGGGAGAAAGG - Intergenic
1035500383 8:87462-87484 AGGGGGATGGAGAGGGAGAAAGG - Intergenic
1035834150 8:2730345-2730367 AGGAGGATAAAGAGAAAGAATGG + Intergenic
1036149230 8:6282706-6282728 ATGTAGAGACATAGGGAGAAAGG + Intergenic
1037288600 8:17326926-17326948 TTGTAAATAAAGAGGGAAAAAGG + Intronic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037681569 8:21102015-21102037 ATTGGGATAAAGAGAGAGAAAGG + Intergenic
1038082364 8:24153355-24153377 ATGTTTAAAAAGAGGGGGAAGGG + Intergenic
1038901677 8:31851153-31851175 ATGTTGACAAAGAAGTAGAAAGG + Intronic
1038979450 8:32741736-32741758 ATGTGGAATAAGAGGCAGCATGG - Intronic
1039705645 8:40004390-40004412 ATGTAGATAAATAGGTAGATAGG + Intronic
1041218306 8:55623718-55623740 ATGCTGATAAAAAGGGGGAAAGG + Intergenic
1041698919 8:60766272-60766294 ATGTGGCTGAAGTGAGAGAAAGG + Intronic
1041717772 8:60947699-60947721 TTGTGGAAAAAGAGGTAGATTGG + Intergenic
1041751587 8:61266528-61266550 ATGTGGAGAAATAGGATGAAAGG - Intronic
1041754314 8:61296909-61296931 TTCTGGATAAAGAGAGAGAAAGG + Intronic
1041939798 8:63374741-63374763 ATAAGGAAAAAGATGGAGAAAGG - Intergenic
1042025064 8:64414589-64414611 ATTGGGAGACAGAGGGAGAAGGG - Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042673458 8:71289244-71289266 AAGTGGAAAATGAGGGAGAATGG + Intronic
1042739798 8:72030407-72030429 CTGTGGCTAAAGTGGGAGACTGG + Intronic
1042755482 8:72205805-72205827 CTGTGGCTAAAGTGGGAGAGTGG + Intergenic
1043655386 8:82658819-82658841 ATGAAGAAAAAGAGGGAGAATGG - Intergenic
1045233071 8:100324556-100324578 ATGGGGGTAAAGTGGGAGTAGGG - Intronic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045735551 8:105292532-105292554 AAGTGGATAAAGAAGGAAAGTGG + Intronic
1046288630 8:112129280-112129302 ATTTGGAAAAAAAGGGAAAATGG - Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048512136 8:135072435-135072457 ATGTGGGTAAACAGGAAGGAGGG + Intergenic
1048591600 8:135825718-135825740 AAATGGATAAAGAGGGAAAGAGG - Intergenic
1048603239 8:135941443-135941465 AGGTAGATAATGAGGGTGAAAGG + Intergenic
1050150225 9:2612604-2612626 TTGTGGATAGAGATGGAGAGGGG - Intergenic
1050418875 9:5441521-5441543 ATGTGGAGTAAGAGGGTTAAAGG + Intergenic
1050772805 9:9224302-9224324 ATGTGTATGGGGAGGGAGAAAGG + Intronic
1051189865 9:14500052-14500074 ATGTGGCTAAAGAGGTAGGCAGG - Intergenic
1051684816 9:19647031-19647053 GTGTGGAAAGAGAGAGAGAAAGG - Intronic
1052160717 9:25255336-25255358 ATGTGCACTAAGAGGCAGAATGG + Intergenic
1052294103 9:26878603-26878625 AAGTGGAGGAAGATGGAGAATGG - Intronic
1052437637 9:28449008-28449030 ATGTGAATACATAGGCAGAATGG - Intronic
1052708963 9:32029164-32029186 ATGAGGATAAAAAGACAGAAAGG - Intergenic
1053267329 9:36724812-36724834 ATTTGGAGAAAGAGGGACATTGG + Intergenic
1054973734 9:71118792-71118814 AGGTGGAACAAGAGAGAGAAGGG + Intronic
1055097690 9:72430809-72430831 TTGAGGATGAAGAGGGAGATGGG - Intergenic
1055150933 9:72998746-72998768 CTGTGGAGAAAGAGGGTGTATGG - Intronic
1055268980 9:74534328-74534350 ATGTGGATTAAAAAGGGGAAGGG - Intronic
1056009635 9:82313694-82313716 ATGTGCATAAGGAGGGAGCAGGG + Intergenic
1056643793 9:88392635-88392657 AGGTAGAAAAAGAGGGAGGAAGG - Intronic
1057011411 9:91605659-91605681 ATGAGAAAAAAGAGGTAGAATGG + Intronic
1057045454 9:91882789-91882811 ACGTGAAAACAGAGGGAGAAAGG + Intronic
1057320262 9:94006156-94006178 ACGTGGAGAAAAAGGGAGACTGG - Intergenic
1057320413 9:94007504-94007526 ACGTGGAGAAAAAGGGAGACTGG + Intergenic
1057875162 9:98747998-98748020 CTTTGGAGAAAGAGGGGGAACGG - Intronic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1059633547 9:116151245-116151267 ATATGCATAAAGAGTTAGAATGG + Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061554920 9:131361563-131361585 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1061791271 9:133060527-133060549 ATGTTGATAACGGGGGAGACTGG + Intergenic
1061794933 9:133081004-133081026 ATGTTGATAATGGGGGAGACTGG + Intronic
1061852212 9:133422881-133422903 AGATGGATGAAGAGGGAGACAGG - Intronic
1061942745 9:133891974-133891996 AGGTGGAGAGAGAGGGAGAGAGG + Intronic
1203774127 EBV:63331-63353 ATTAGGATAAACAGGGAGAGAGG - Intergenic
1203608524 Un_KI270748v1:75954-75976 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1185569788 X:1124874-1124896 AAGTGGATAGATAGGGAGATAGG + Intergenic
1186561568 X:10618918-10618940 ATGAGGAAAAGGAAGGAGAAGGG - Intronic
1186998930 X:15155233-15155255 AAATGGATAGAGAGAGAGAAAGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188422033 X:30001919-30001941 CTCTGGATAAAAAGGGAGATAGG + Intergenic
1188752836 X:33924602-33924624 ATGTGCATTAAGAGGCAAAATGG - Intergenic
1188841825 X:35026168-35026190 AAGTGAATAGAGAGGGTGAAAGG - Intergenic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189224113 X:39398360-39398382 AGAGGGAGAAAGAGGGAGAAAGG - Intergenic
1190332496 X:49244492-49244514 AGGTGGACAGAGAGGAAGAAGGG - Intronic
1190988729 X:55523601-55523623 ATGGGGATGGAGAGGCAGAAAGG + Intergenic
1191006082 X:55712812-55712834 CTATGGAAAAAGAGGAAGAAGGG + Intergenic
1191151223 X:57222368-57222390 CTGTCGATATAGAGGGAGAAAGG - Intergenic
1191166934 X:57401483-57401505 AGCTGGATATAGAGGGACAACGG + Intronic
1191884601 X:65875493-65875515 ATGTGCATTAAGAGGAAAAAAGG - Intergenic
1193453306 X:81698316-81698338 ATGTTAGTAAAGAGGCAGAATGG + Intergenic
1193505615 X:82338869-82338891 TTGTGGAAATAGATGGAGAAAGG - Intergenic
1193583727 X:83294953-83294975 ATGTGGATTAAGAGACAAAATGG + Intergenic
1193889689 X:87029633-87029655 ATGGTGATCAAGAGGGAGTAGGG + Intergenic
1194121324 X:89966792-89966814 ACATGGAAAGAGAGGGAGAAAGG + Intergenic
1194885330 X:99308619-99308641 AAAAGGATAAAGAGAGAGAAAGG + Intergenic
1195385884 X:104313290-104313312 AGGGGGACAAAGAGGGAGGAAGG - Intergenic
1195611310 X:106870461-106870483 ATGTGGCGAGAGAGGGAGAAAGG - Intronic
1196514412 X:116552682-116552704 GTATGGATAAAGGAGGAGAAGGG - Intergenic
1196610794 X:117712516-117712538 ATGTGGAAAAAGGATGAGAAAGG + Intergenic
1197148971 X:123198882-123198904 ATGTGTTTAAAGTGGGAGCATGG + Intronic
1198279457 X:135127318-135127340 ATGTTAATAAAGATGAAGAAGGG + Intergenic
1198291499 X:135245196-135245218 ATGTTAATAAAGATGAAGAAGGG - Intergenic
1198480353 X:137034575-137034597 AGGGGGAGAAAGAGGGAGAGAGG - Intergenic
1199084381 X:143611843-143611865 ATGAAGATAGTGAGGGAGAAAGG - Intergenic
1199262791 X:145795158-145795180 ATGGGGAAAGAGAGGGAGAGTGG - Intergenic
1199471287 X:148198756-148198778 ATGAGGAAGAAGAGGAAGAAGGG - Intergenic
1199899687 X:152160780-152160802 ATGTGGAGAAATAAAGAGAAAGG + Intergenic
1200474180 Y:3624243-3624265 ACATGGAAAGAGAGGGAGAAAGG + Intergenic
1200941654 Y:8788378-8788400 CTGTGGCTGAAGAGGGATAATGG - Intergenic