ID: 1037316157

View in Genome Browser
Species Human (GRCh38)
Location 8:17601336-17601358
Sequence CCTGCAGGGGATCTAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037316149_1037316157 19 Left 1037316149 8:17601294-17601316 CCATATGTATTTCTATGAATGAA 0: 1
1: 0
2: 1
3: 48
4: 475
Right 1037316157 8:17601336-17601358 CCTGCAGGGGATCTAAAGTCAGG No data
1037316147_1037316157 28 Left 1037316147 8:17601285-17601307 CCAGGTCCTCCATATGTATTTCT 0: 1
1: 0
2: 0
3: 24
4: 237
Right 1037316157 8:17601336-17601358 CCTGCAGGGGATCTAAAGTCAGG No data
1037316148_1037316157 22 Left 1037316148 8:17601291-17601313 CCTCCATATGTATTTCTATGAAT 0: 1
1: 0
2: 0
3: 27
4: 314
Right 1037316157 8:17601336-17601358 CCTGCAGGGGATCTAAAGTCAGG No data
1037316145_1037316157 30 Left 1037316145 8:17601283-17601305 CCCCAGGTCCTCCATATGTATTT 0: 1
1: 0
2: 2
3: 21
4: 196
Right 1037316157 8:17601336-17601358 CCTGCAGGGGATCTAAAGTCAGG No data
1037316153_1037316157 -9 Left 1037316153 8:17601322-17601344 CCAGAGGCACTGAGCCTGCAGGG 0: 1
1: 0
2: 2
3: 32
4: 505
Right 1037316157 8:17601336-17601358 CCTGCAGGGGATCTAAAGTCAGG No data
1037316146_1037316157 29 Left 1037316146 8:17601284-17601306 CCCAGGTCCTCCATATGTATTTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1037316157 8:17601336-17601358 CCTGCAGGGGATCTAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037316157 Original CRISPR CCTGCAGGGGATCTAAAGTC AGG Intronic
No off target data available for this crispr