ID: 1037316318

View in Genome Browser
Species Human (GRCh38)
Location 8:17602790-17602812
Sequence GGTTTCAGCTGTGCTACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037316313_1037316318 7 Left 1037316313 8:17602760-17602782 CCCTGTCATGAGAAGGTCCACTA 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1037316318 8:17602790-17602812 GGTTTCAGCTGTGCTACAACTGG No data
1037316314_1037316318 6 Left 1037316314 8:17602761-17602783 CCTGTCATGAGAAGGTCCACTAG 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1037316318 8:17602790-17602812 GGTTTCAGCTGTGCTACAACTGG No data
1037316317_1037316318 -10 Left 1037316317 8:17602777-17602799 CCACTAGATGGCAGGTTTCAGCT 0: 1
1: 0
2: 2
3: 6
4: 141
Right 1037316318 8:17602790-17602812 GGTTTCAGCTGTGCTACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037316318 Original CRISPR GGTTTCAGCTGTGCTACAAC TGG Intronic
No off target data available for this crispr