ID: 1037318409

View in Genome Browser
Species Human (GRCh38)
Location 8:17621095-17621117
Sequence TTCACCTGTGTCTGCCGAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037318409_1037318415 23 Left 1037318409 8:17621095-17621117 CCACCTCGGCAGACACAGGTGAA 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1037318415 8:17621141-17621163 CAGCGGCTACATCTGCAGGAAGG 0: 1
1: 0
2: 1
3: 24
4: 201
1037318409_1037318413 6 Left 1037318409 8:17621095-17621117 CCACCTCGGCAGACACAGGTGAA 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1037318413 8:17621124-17621146 TGCTGGGTGCAGCTCTGCAGCGG 0: 1
1: 0
2: 2
3: 28
4: 336
1037318409_1037318414 19 Left 1037318409 8:17621095-17621117 CCACCTCGGCAGACACAGGTGAA 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1037318414 8:17621137-17621159 TCTGCAGCGGCTACATCTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 131
1037318409_1037318416 29 Left 1037318409 8:17621095-17621117 CCACCTCGGCAGACACAGGTGAA 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1037318416 8:17621147-17621169 CTACATCTGCAGGAAGGACGAGG 0: 1
1: 0
2: 0
3: 10
4: 176
1037318409_1037318412 -10 Left 1037318409 8:17621095-17621117 CCACCTCGGCAGACACAGGTGAA 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1037318412 8:17621108-17621130 CACAGGTGAATTCAGCTGCTGGG 0: 1
1: 0
2: 2
3: 10
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037318409 Original CRISPR TTCACCTGTGTCTGCCGAGG TGG (reversed) Exonic
900488594 1:2935259-2935281 ATCTCCTGTGTCTGCCTTGGTGG + Intergenic
901492513 1:9603635-9603657 GTCACCTGGGTCTGCCGGGATGG + Intronic
903219814 1:21863173-21863195 TTCACCTGTGTCAGCCAGGATGG - Intronic
903780072 1:25815350-25815372 TCACCCTGTGTCTGACGAGGGGG - Intronic
905648196 1:39639427-39639449 CTCACCTGCCTCTGCCCAGGCGG + Intronic
907309120 1:53529335-53529357 CTGACCTGTGTCTACGGAGGGGG + Intronic
908790002 1:67771678-67771700 GTCGCCTGTGTCTGCTGTGGTGG - Intronic
913366796 1:118048006-118048028 TGCACCTGACTCTGCAGAGGTGG - Intronic
914251444 1:145925060-145925082 TTCACCCTTGGCTGCCGAAGAGG + Intergenic
916259299 1:162824851-162824873 TTCACCTGTGTTTGCCATGCAGG + Intronic
917851919 1:179071828-179071850 TTCACTTTTGTCTGCCTAGCAGG + Intronic
919105675 1:193147563-193147585 TTCACCTGTGTTAGCCAGGGTGG + Intronic
923910116 1:238431744-238431766 TACAGCTGTGTCTGCAGTGGTGG - Intergenic
1062799557 10:369096-369118 TTCACATGTGTCTGCCTTGGCGG + Intronic
1067646097 10:48105214-48105236 TCCACCTGTCTCTTCCGAAGGGG + Intergenic
1068228777 10:54142362-54142384 TTCTCCTGTGTCTGAAGATGAGG - Intronic
1070284225 10:75071729-75071751 CTCACCTGGGTCTGTGGAGGTGG - Intergenic
1070812143 10:79303748-79303770 TTCCCCTGTCTCTGCAGAGCAGG - Intronic
1072687978 10:97550017-97550039 TTCAGCTGTGACTGCTGGGGTGG + Intronic
1076514335 10:131034709-131034731 TTCAAATGTGTCTGCCCAGAGGG + Intergenic
1076891595 10:133287334-133287356 TTCACCTGCGCCTCCCCAGGAGG - Intronic
1076892740 10:133292666-133292688 TTCGCCTTTGTCCACCGAGGTGG + Exonic
1077095826 11:798575-798597 ATCACCTGTGTCTGCCCTGGAGG - Exonic
1081397645 11:42605827-42605849 GCCACCTGTGCCAGCCGAGGAGG + Intergenic
1081774334 11:45667024-45667046 TTCAGCAGTGTCTGGCAAGGGGG + Intergenic
1088987918 11:114926364-114926386 TTCACCTGTTTCTGCAGACCTGG - Intergenic
1091556837 12:1580434-1580456 TTCATCTCTGTCTTCCCAGGTGG - Intronic
1097250521 12:57630147-57630169 TGCACCTGTGTCTGCTGTGTTGG + Exonic
1102730253 12:115102795-115102817 ATCAGCTGTGTCTGCAGAAGAGG + Intergenic
1103980448 12:124733691-124733713 ATGACCTGTGTCTGCAGGGGAGG - Intergenic
1108743106 13:53359434-53359456 TACATCTGTGTCTGCAGAGAAGG - Intergenic
1108893424 13:55293146-55293168 TTGTCCTCTGTCTGCTGAGGTGG + Intergenic
1109398780 13:61796832-61796854 TTCACGTCTGTTTGCAGAGGAGG + Intergenic
1111099788 13:83568814-83568836 TTCTCCTGCATCTGCAGAGGTGG + Intergenic
1113739843 13:112703981-112704003 TTCACCTGCGTGTGTGGAGGAGG + Intronic
1114365943 14:22027144-22027166 TCCAGCTGTGTCTGCAGTGGTGG - Intergenic
1117628704 14:57667075-57667097 CTCTCCTCTGTCTGCCTAGGAGG - Intronic
1117889116 14:60399082-60399104 TTCACCCTTGGCTGCCGAAGAGG - Intronic
1126569369 15:50133504-50133526 ATCACCTGAGTCTGGGGAGGTGG + Intronic
1131550479 15:93352714-93352736 TTCACCTGTGTCAGCCTCTGTGG - Intergenic
1132664112 16:1073821-1073843 TTGACCAGTTTCTGCCCAGGAGG - Intergenic
1137781566 16:51101824-51101846 TTCACCTGGGCCCGCGGAGGTGG + Intergenic
1139587872 16:67915972-67915994 TTCACATGTGTCTGCCAATGCGG - Intronic
1140904156 16:79396171-79396193 CTCACCTGTGTCTCAGGAGGAGG - Intergenic
1141220581 16:82065718-82065740 TTCATCTGTGTCAGCAGAGAAGG - Intronic
1142640102 17:1280626-1280648 TGCACCTGTGTCTGCTGGGGAGG + Intronic
1147034745 17:37671599-37671621 TTGTCCTGTGTTTGCAGAGGAGG - Intergenic
1148807760 17:50272829-50272851 TTCACCTCTGTCTGCCTCGGCGG - Intronic
1160035358 18:75296709-75296731 CTCACCTGTGTGTGCAGAGCAGG + Intergenic
1163332960 19:16653079-16653101 TTCTTCTGCATCTGCCGAGGTGG - Intronic
1164038610 19:21474895-21474917 GTCACCTGGGGCTCCCGAGGTGG - Intronic
1165448388 19:35869031-35869053 GTCACCTGGGTCTGGAGAGGGGG - Intronic
1167321278 19:48798582-48798604 TTCAACTAGGTCTGACGAGGAGG - Intronic
927549912 2:23989388-23989410 ATCACCTGAGTCTGGGGAGGTGG - Intronic
929240490 2:39648499-39648521 TTGCCCTGTGCCTGCCCAGGTGG - Intergenic
937940330 2:127280352-127280374 CTGACCTGTGTCTGCCCATGAGG + Intronic
941311318 2:163935684-163935706 GTCACCTTTTTCTGCCTAGGAGG - Intergenic
942840803 2:180359081-180359103 TTCAGCTGTGTCTGCAGCGGTGG + Intergenic
947635116 2:231676421-231676443 TTCAACTGTGTCTGCACAGATGG - Intergenic
1173177082 20:40772556-40772578 TTCACCTGACTCTGGCCAGGTGG - Intergenic
1175748803 20:61480588-61480610 TTCCCCTGTGTCAGCCTAGCAGG - Intronic
1179968751 21:44821797-44821819 TTCTGCTGTGTCTGCAGAGAGGG + Intergenic
1183750791 22:39719268-39719290 TTCCCCTGGGTCTGCCCAGCAGG + Intergenic
1184944691 22:47794919-47794941 GTCACCCGTGCCTGCCCAGGTGG + Intergenic
1185134541 22:49062273-49062295 CTCCCCTGGCTCTGCCGAGGTGG + Intergenic
951274708 3:20671289-20671311 TTCACCACTGTCTGCCAAGATGG - Intergenic
954108694 3:48422560-48422582 ATGACCTGTGACTGCCTAGGAGG - Intronic
956796197 3:72720796-72720818 TTCTCCTGGGTCTCCCCAGGAGG - Intergenic
959895257 3:111598367-111598389 TTCATCTGTTTCTTCCAAGGGGG + Intronic
960128694 3:114028993-114029015 TTTAGCTCTGTCTGCTGAGGCGG + Intronic
962083370 3:132164601-132164623 TTCACCTGAGTCAGTCTAGGAGG - Intronic
962100712 3:132339473-132339495 TTCATCTGTGTCTGAGGTGGCGG - Intronic
962943347 3:140145560-140145582 CACACCAGTGTCTGCCGAGATGG - Intronic
967156937 3:186701798-186701820 TCCTCCTGTGTTTGCCAAGGAGG - Intergenic
973091779 4:46146550-46146572 CTCAGCTGTGTCTGCAGTGGTGG + Intergenic
975290885 4:72677478-72677500 TCCAGCTGTGTCTGCAGTGGTGG + Intergenic
983941689 4:173539588-173539610 TTCAGCTGTGTCTGAAAAGGGGG - Intergenic
985655762 5:1130671-1130693 TGCACCTGTGCCTGCCCAGAGGG + Intergenic
986706283 5:10457226-10457248 TGCACCTGATGCTGCCGAGGTGG - Intronic
992000702 5:72433271-72433293 ATCACCTGTGTCTTCAGAGAGGG + Intergenic
993373680 5:87122589-87122611 TTCATCTGTGTCTCCCAATGAGG + Intergenic
995897462 5:117031490-117031512 TTTACCTCTGTGTGCCAAGGTGG + Intergenic
1004424778 6:15499870-15499892 GTGTGCTGTGTCTGCCGAGGTGG + Intronic
1005463759 6:26092359-26092381 TTCACCTGGGTCAACCTAGGAGG - Intronic
1008138110 6:47800389-47800411 TTGAGCTGCGTCTGCCCAGGTGG + Intronic
1011580874 6:88862649-88862671 TGCAACTGTGTCTGAAGAGGGGG + Intronic
1018899887 6:168045739-168045761 TTCACCTGGCTTTGCCGAGGAGG - Intergenic
1019067203 6:169312296-169312318 TTCAGGTGTGTCAGCCCAGGTGG - Intergenic
1019362093 7:610077-610099 TTCACCTGTTCCTGCCCAGATGG + Intronic
1022973143 7:35535570-35535592 CTCACCTGTGTGTTCCGAGCTGG + Intergenic
1029618931 7:101677861-101677883 TTCACCTGTGTCTGCTGTGGTGG - Intergenic
1029620390 7:101686861-101686883 TTGGGCTGTGTCTGCTGAGGGGG - Intergenic
1034447827 7:151122470-151122492 TTGGCCTGTGTCTGCCCAGCAGG + Intronic
1035132519 7:156669164-156669186 TGCACCTGTGTCTGCCCAGAGGG - Intronic
1035565101 8:635979-636001 TTGGGCTGTTTCTGCCGAGGCGG - Intronic
1035628305 8:1090084-1090106 TCCACCCCTGTCTGCCCAGGAGG - Intergenic
1037318409 8:17621095-17621117 TTCACCTGTGTCTGCCGAGGTGG - Exonic
1040442512 8:47458877-47458899 TTAAACTGTGTCTGTTGAGGTGG + Intronic
1040728960 8:50419366-50419388 TCCAGCTCTGTCTGCCAAGGTGG + Intronic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1048296792 8:133220564-133220586 GCCACCTGTGTTTGCAGAGGTGG + Exonic
1052748919 9:32468912-32468934 TTCAGCTGTGTGTGCCTAGCAGG - Intronic
1053611890 9:39722318-39722340 TTCACCTGTGACTGCGGACCAGG + Intergenic
1053869929 9:42480312-42480334 TTCACCTGTGACTGCGGACCAGG + Intergenic
1054086367 9:60748837-60748859 TTCACCTGTGACTGCGGACCAGG - Intergenic
1054241631 9:62620075-62620097 TTCACCTGTGACTGCGGACCAGG - Intergenic
1054555757 9:66654598-66654620 TTCACCTGTGACTGCGGACCAGG - Intergenic
1057908949 9:99003615-99003637 TTCACCTGTGTCTGGGGTTGTGG + Intronic
1058272228 9:102986535-102986557 TTCTCCTGTGTCTGCAGTAGTGG - Intergenic
1059320381 9:113464016-113464038 TTCTCCTGTGACTGCCCAGGAGG + Intronic
1060370748 9:123068318-123068340 GTCTCCTGTGTCACCCGAGGTGG - Intronic
1060407672 9:123380996-123381018 GTCACCTGTGTCCGAGGAGGTGG + Exonic
1061048304 9:128179368-128179390 TTCACCTGTAACTGCCCTGGAGG + Exonic
1190532804 X:51396377-51396399 TACACCTGTGGCTGCCGCCGAGG + Intergenic
1199770670 X:150973394-150973416 ATCACGTGTGTTTGCTGAGGGGG + Intergenic