ID: 1037324065

View in Genome Browser
Species Human (GRCh38)
Location 8:17670996-17671018
Sequence TTCCACTGTGAAATGGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037324056_1037324065 26 Left 1037324056 8:17670947-17670969 CCTTTGATAATAAAGGTTAAATC 0: 1
1: 0
2: 2
3: 25
4: 245
Right 1037324065 8:17670996-17671018 TTCCACTGTGAAATGGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037324065 Original CRISPR TTCCACTGTGAAATGGCATG AGG Intronic
No off target data available for this crispr