ID: 1037324213

View in Genome Browser
Species Human (GRCh38)
Location 8:17672559-17672581
Sequence GTCCAGGAAGAACACTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037324213_1037324216 1 Left 1037324213 8:17672559-17672581 CCTTGAGAGTGTTCTTCCTGGAC 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1037324216 8:17672583-17672605 GCTTCATCACAAGTGTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037324213 Original CRISPR GTCCAGGAAGAACACTCTCA AGG (reversed) Intronic
901858902 1:12062123-12062145 CTCCAGGAAGAAAACTCTAAAGG + Intergenic
902180411 1:14684200-14684222 CTCCAGGAATACCAATCTCAGGG + Intronic
902209123 1:14892227-14892249 CTCCAGGAAGAAAACACTCCTGG + Intronic
904058786 1:27690184-27690206 ATCCAACAAGAACCCTCTCAGGG - Intergenic
904120294 1:28193783-28193805 GTCCAGGAAACATGCTCTCAGGG - Intronic
904203214 1:28835280-28835302 GTTCAAGAACAACACACTCATGG - Intronic
904286234 1:29454769-29454791 GTCCAGGGAGCACACTGACAGGG + Intergenic
904323285 1:29710491-29710513 GCTCAGGAAGAACATGCTCAAGG + Intergenic
904490953 1:30858661-30858683 TTCCAGGAAGATCACTCTGGTGG - Intergenic
904576580 1:31508964-31508986 GACCCGGAAGGACACTCCCAGGG - Intergenic
904650312 1:32000686-32000708 GTCCAGGAAGGTCTCTCTCGGGG - Intergenic
906293401 1:44634512-44634534 GGCCAGGAAGAACTTTCTCATGG - Intronic
909797721 1:79763879-79763901 GTCCTGGAACCAAACTCTCATGG - Intergenic
912593079 1:110847159-110847181 GTCCAGGCAGAAGACTGTGAGGG - Intergenic
914903007 1:151721818-151721840 GTGCAGGAAGAACTAACTCAGGG + Intronic
915029017 1:152860134-152860156 TTCCAGGAAGACCAGGCTCATGG + Intergenic
915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG + Intergenic
915660293 1:157399896-157399918 GCCCAGGCAGAACACCCCCAAGG - Intergenic
915894812 1:159803591-159803613 CTCCAGGCAGAAGACTCCCAGGG + Intronic
918640448 1:186834534-186834556 GCCCAGGAAGTCCACTCTCCTGG + Intronic
919749253 1:201026314-201026336 GTCCAGTCAGAGAACTCTCAGGG - Intergenic
920691351 1:208148811-208148833 CTCCAGGAAGTACCCCCTCAGGG - Intronic
922447326 1:225708374-225708396 GTCAAGGAAGAAAAGACTCAAGG + Intergenic
922912171 1:229226843-229226865 GGCTATGAAGAACACTCTCGTGG + Intergenic
923155615 1:231276706-231276728 GTCAAGGAAGACAACACTCAAGG - Intronic
1063209764 10:3869461-3869483 CTCCAGGACAAAGACTCTCACGG + Intergenic
1067937104 10:50622538-50622560 GTCCAGGAAGATAAATGTCAAGG + Intronic
1070333159 10:75431956-75431978 GTGCGGGAAGAACACCCGCAAGG + Intronic
1070810661 10:79296241-79296263 CTCCAGGAAGAACGGCCTCAAGG + Intronic
1075837567 10:125468330-125468352 GTCCAGCACGATCACTCACACGG - Intergenic
1076207616 10:128615719-128615741 GTCCAGCAACTAAACTCTCAAGG + Intergenic
1078852531 11:15177849-15177871 GTCTGGGAAGAAAATTCTCAAGG + Intronic
1079318158 11:19427513-19427535 ATCCAGGTAGAAAACTCCCAAGG + Intronic
1084859215 11:72007255-72007277 GTCCAGGAAGACGTCTCCCAGGG + Exonic
1088584878 11:111353509-111353531 GTCCAGGCAGCAAAATCTCAAGG - Exonic
1089734897 11:120543731-120543753 TTCCAAGAGGAACACTCTCTTGG - Intronic
1090786182 11:130049439-130049461 GACCAGAAAGAACAGTCTCCAGG - Intergenic
1093636126 12:21470968-21470990 GTCCACGCAGAACTCTTTCAGGG - Exonic
1093774010 12:23051403-23051425 ACCCAGGAAAAACACTATCAGGG - Intergenic
1097161111 12:57047410-57047432 GTGCAGGCAAAACGCTCTCATGG + Intronic
1099156459 12:79182472-79182494 GTCCAGGAGGTATATTCTCATGG - Intronic
1099847046 12:88040650-88040672 GTGCAGGAAGAACAAGCTTAAGG - Intronic
1100275789 12:93070690-93070712 GTCCAGGAAGGCGACTCTGAGGG - Intergenic
1100327807 12:93555950-93555972 ATCCAGCAATACCACTCTCAGGG - Intergenic
1101885452 12:108657370-108657392 GGCCAGGAAGATGGCTCTCATGG + Exonic
1104000305 12:124855911-124855933 ATCCAGGAAAAACACCTTCATGG + Intronic
1104042196 12:125137935-125137957 CTCCAGGAAGCAGACTCTCCTGG - Intronic
1111649035 13:91066566-91066588 GAGCAGAAAGAACACTCACAGGG - Intergenic
1112278723 13:98044410-98044432 CTCCAGGTAGAGCACTCCCAGGG - Intergenic
1116373110 14:44161189-44161211 GTCCAAGAAGAAATCTCCCAGGG + Intergenic
1116996316 14:51328840-51328862 GGCCAGGAAGAACACAGTCCAGG - Intergenic
1131237938 15:90713267-90713289 GGCCCTGAAGAACACCCTCATGG + Intergenic
1137619828 16:49868776-49868798 GTACAGGAAGACCACTCTGCAGG - Intergenic
1137920715 16:52485834-52485856 GTCCAGGGAAAACACTCCAAAGG - Intronic
1139296416 16:65905449-65905471 GTCCAGCAAAAAGATTCTCAGGG + Intergenic
1140977302 16:80072283-80072305 CTGCAGAAAGAACACTCTTATGG - Intergenic
1149012502 17:51871852-51871874 GTACATGATGAACTCTCTCAGGG - Intronic
1149400890 17:56294858-56294880 GTCCTGGAAGAACTTTCACAAGG + Intronic
1149523419 17:57335770-57335792 GTCCCTGAAGAGCACTCACAAGG - Intronic
1149732071 17:58955703-58955725 GTGCAGAAAGATCACTCTGAAGG - Exonic
1151112215 17:71691475-71691497 CTCCAGACAGAACACGCTCAGGG + Intergenic
1157176668 18:45458339-45458361 TTCCAAGAAGAACATTTTCATGG - Intronic
1160471941 18:79144217-79144239 GTCCTGGAACTACCCTCTCATGG - Intronic
1163653092 19:18530168-18530190 GCCCAGGAAGACCTCTCCCAGGG - Intergenic
1163677338 19:18661795-18661817 GTCAGGGAAGCACACTCTCGGGG - Intronic
1164524768 19:29005221-29005243 GTCCCGGACGCACTCTCTCAGGG - Intergenic
1164581433 19:29437816-29437838 GACCAGGAAGGACAGACTCAGGG - Intergenic
1165984888 19:39759279-39759301 ATCATGGAAGAACACTCTGAGGG - Intergenic
928584351 2:32743409-32743431 TTCCAGGAAGCACTCTGTCAGGG - Intronic
929260971 2:39866269-39866291 GTCCTGGAAGCATTCTCTCAGGG + Intergenic
929389946 2:41458574-41458596 GTCCAGGAACCACACTTTGAGGG - Intergenic
934754064 2:96813131-96813153 GTCAAGGAAGATCACTCGGAGGG + Intergenic
937873180 2:126801041-126801063 GTCCTGGAAAAACACTCTCTGGG + Intergenic
942702264 2:178726161-178726183 GTCCAGCACTAACACTCTCATGG + Intronic
943660345 2:190553460-190553482 CTGCAGGCAGATCACTCTCATGG + Intergenic
945158813 2:206867244-206867266 GTCTAAGAAGAACACACTCATGG - Intergenic
945664748 2:212726618-212726640 GGGAAGGAAGAAAACTCTCATGG - Intergenic
946464152 2:219896583-219896605 GTCCTGGGAGAAGACTCTCATGG + Intergenic
946998177 2:225420248-225420270 GCCCAGAAAGAAAACTTTCAGGG - Intronic
947909456 2:233791712-233791734 GCACAGGGAGAACAATCTCAAGG + Intronic
949047194 2:241877562-241877584 ACCCTGGAAGAACACCCTCAGGG + Intergenic
1170009272 20:11703773-11703795 GTCCAGGGACCACACTCTGAGGG - Intergenic
1170462433 20:16589792-16589814 GTGCAGGCAGAACCGTCTCATGG + Intergenic
1171969556 20:31555291-31555313 CTCCAGGGAGAACACACACATGG + Intronic
1178730506 21:35097960-35097982 GTCCATGGAGAACAATGTCAAGG + Intronic
1179610257 21:42545656-42545678 GTCCAGGAAGAGCCATATCAGGG + Intronic
1181032832 22:20156579-20156601 GTCAAGGAAAAATCCTCTCATGG + Intergenic
1182512223 22:30827631-30827653 GGCCAGGAAGAACGGTTTCAAGG + Intronic
1183820790 22:40344441-40344463 GTGGAGGGAGAACACTGTCATGG + Intergenic
1184976505 22:48066127-48066149 GTCCAGGAAGCATCTTCTCATGG - Intergenic
953767982 3:45758818-45758840 GTGCAGGAAGAAAACTCCCTTGG - Exonic
954302045 3:49705308-49705330 GTGCAGGAAGCACACTCCGAGGG + Intronic
954572963 3:51657575-51657597 GTCCAGGAATAACAATATCTAGG - Exonic
955620565 3:60858921-60858943 GTCCTGGGGGAACACTATCATGG - Intronic
959633830 3:108538869-108538891 GTGCAGCAAGAAGACCCTCACGG - Intergenic
961325297 3:126105937-126105959 GTCCAGGAAGAACTCCCTGAGGG + Intronic
963047907 3:141116807-141116829 GTCCAGTAAGAGCACTCAGATGG + Intronic
963094387 3:141520307-141520329 CACCAGGAAGAACAGTTTCAAGG + Intronic
970851709 4:20611802-20611824 GTCCCTGAAGAGCAATCTCAAGG + Intronic
970994799 4:22253359-22253381 GTCCAGGAAGGACAGGCTCTAGG + Intergenic
972328124 4:38037450-38037472 CTCCAGGCTGGACACTCTCATGG + Intronic
973212101 4:47627365-47627387 GGCAAGGAAGAACCCTCTAAAGG + Intronic
976028427 4:80720633-80720655 GTCCAAGAATAAAGCTCTCAAGG + Intronic
976688023 4:87837550-87837572 CTTCAGGAAGAACACTTTCCAGG + Intronic
979955398 4:126948018-126948040 GTCCAGGAAACACACTCTGATGG - Intergenic
980617426 4:135248931-135248953 GTTCAAGAAGAACACTCTGTTGG + Intergenic
980905010 4:138939796-138939818 GGCCAGCCAGAACACTGTCAAGG + Intergenic
982087569 4:151851731-151851753 GTCTAGGAATAACACTGTGAGGG - Intergenic
983822914 4:172218365-172218387 ATCCAAGAAAAACCCTCTCATGG - Intronic
986297246 5:6449419-6449441 GGGCAGGAAGAAAACGCTCAGGG - Intronic
986851443 5:11817916-11817938 CTCCAGGCAAAACAATCTCAGGG + Intronic
988146276 5:27312811-27312833 GTCCAGAAATATCTCTCTCAGGG + Intergenic
988879853 5:35489957-35489979 GTCAAGGAAAAACACCCTTATGG - Intergenic
991977121 5:72194346-72194368 CTCGAGGAAGAACAGTCCCAGGG + Exonic
992776469 5:80093502-80093524 TGCCAGGAAGAACACTTCCAGGG + Intergenic
996629479 5:125610104-125610126 ACCCAGGAAGAAAACGCTCATGG + Intergenic
997764415 5:136485849-136485871 GTCAAGGAAGAAGTCTCTGATGG - Intergenic
998303532 5:141050861-141050883 GTCCAGTAAGTACACTGACAGGG - Intergenic
1000850914 5:166339507-166339529 GTCCAGGAAGATCAGAGTCATGG - Intergenic
1003449833 6:6220268-6220290 GGCCAGGAAGAACAGTCTCAGGG + Intronic
1003468640 6:6407182-6407204 TTGAAGGAAGAAGACTCTCAAGG - Intergenic
1005871523 6:29977177-29977199 GACCAGGAAAAAGCCTCTCAGGG + Intergenic
1006070350 6:31494081-31494103 GGCCAGGAAAAAGCCTCTCAGGG - Intergenic
1007771130 6:44193127-44193149 GTCAAGGAAGAGAACACTCAGGG + Intergenic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1009432172 6:63576568-63576590 GTCCAGGATAACCACTCTTATGG - Exonic
1010327395 6:74580867-74580889 CTCAAGGAAGAGCAGTCTCATGG + Intergenic
1010749511 6:79602334-79602356 GTCCAGGAAGACCTCCCTGAGGG + Intergenic
1017709596 6:157155412-157155434 GTCCACGAAGGGCTCTCTCAGGG - Intronic
1017802147 6:157906915-157906937 GTCCAGGATGAGAACACTCAAGG - Intronic
1020675389 7:11178078-11178100 CTCCACGAAGAACACTCAAATGG - Intergenic
1021836195 7:24677810-24677832 GTCTAAGACGACCACTCTCAAGG + Intronic
1021955794 7:25823206-25823228 CTCCAGGGAAAACATTCTCATGG + Intergenic
1023819909 7:43974925-43974947 GTCCAGGAAGTGACCTCTCAGGG - Intergenic
1025016255 7:55441183-55441205 TTCCTGGAAGAACAGCCTCAAGG + Intronic
1029748184 7:102528378-102528400 GTCCAGGAAGTGACCTCTCAGGG - Intergenic
1029766131 7:102627465-102627487 GTCCAGGAAGTGACCTCTCAGGG - Intronic
1032403408 7:131639179-131639201 ATTCAGCCAGAACACTCTCAAGG + Intergenic
1032571075 7:132997966-132997988 GTCAAGGAAGAAAAATTTCAGGG + Intronic
1035131705 7:156660769-156660791 GGCCAGGAAACCCACTCTCAAGG + Intronic
1036086600 8:5619249-5619271 GTCCAGGAGGATCATCCTCATGG + Intergenic
1037324213 8:17672559-17672581 GTCCAGGAAGAACACTCTCAAGG - Intronic
1039856286 8:41417140-41417162 GTCAAGGAAGTACCCTGTCATGG + Intergenic
1040713242 8:50215107-50215129 GTCCCGGAAGATCATTCTCCTGG + Intronic
1041817172 8:61987125-61987147 GTCATGAAAGGACACTCTCAAGG - Intergenic
1042327656 8:67545462-67545484 GACCAGGAAGAAAACATTCAAGG - Intronic
1045683657 8:104689111-104689133 GTCAAGGCAGGGCACTCTCAAGG - Intronic
1047248538 8:123164821-123164843 GTGTAGGAAGACCACTCACAGGG - Intergenic
1055467664 9:76581849-76581871 GTCCAGGAGGTATAGTCTCAAGG + Intergenic
1056491488 9:87112180-87112202 GACCAGGAAGAACATTTTAAGGG + Intergenic
1058275801 9:103039155-103039177 CTACAGGAAGAGCACTCTCCAGG + Intergenic
1058981419 9:110174092-110174114 GTCCAGGAAAGAGGCTCTCAGGG + Intergenic
1186750947 X:12620462-12620484 GTCCAGCAATAACCCTCCCAGGG + Intronic
1186878610 X:13841725-13841747 GTCCAGAACTAACACTTTCATGG + Intronic
1194088683 X:89559899-89559921 GTACAGGAAGCCCACTCTAAGGG - Intergenic
1194869135 X:99105967-99105989 GGCCAGGAAGTACAATGTCAAGG - Intergenic
1198374732 X:136027432-136027454 GAACAGGAAAAAAACTCTCATGG + Intronic
1199905145 X:152219852-152219874 GTATTAGAAGAACACTCTCAGGG - Intronic
1200924393 Y:8641497-8641519 GTTCATGGAGAACACCCTCATGG + Intergenic