ID: 1037328299

View in Genome Browser
Species Human (GRCh38)
Location 8:17717263-17717285
Sequence GTTCTAGGGAAGGTGAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037328299_1037328308 19 Left 1037328299 8:17717263-17717285 CCAATTCTCACCTTCCCTAGAAC 0: 1
1: 0
2: 2
3: 17
4: 207
Right 1037328308 8:17717305-17717327 AAAGTTGACAGGAAGCTAATGGG No data
1037328299_1037328307 18 Left 1037328299 8:17717263-17717285 CCAATTCTCACCTTCCCTAGAAC 0: 1
1: 0
2: 2
3: 17
4: 207
Right 1037328307 8:17717304-17717326 CAAAGTTGACAGGAAGCTAATGG No data
1037328299_1037328305 8 Left 1037328299 8:17717263-17717285 CCAATTCTCACCTTCCCTAGAAC 0: 1
1: 0
2: 2
3: 17
4: 207
Right 1037328305 8:17717294-17717316 TTGGCTTTTCCAAAGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037328299 Original CRISPR GTTCTAGGGAAGGTGAGAAT TGG (reversed) Intronic
900715314 1:4140302-4140324 GCCTCAGGGAAGGTGAGAATGGG + Intergenic
900761604 1:4475760-4475782 GTACTTGGGATGGTGAGAAGCGG + Intergenic
901414886 1:9109768-9109790 GGTCTAGGGCGGGTGAGAACTGG + Intronic
901521175 1:9786344-9786366 GTTCTACGAAAGGTGAGGCTGGG + Intronic
904743441 1:32696005-32696027 GTTCTTTGGAAGAGGAGAATTGG + Exonic
905031004 1:34884703-34884725 GTTGCAGGGAAGGAGAGGATGGG - Intronic
905318575 1:37099370-37099392 GTTCTTGGGTAGGTGAGGGTCGG + Intergenic
907999588 1:59667466-59667488 GTTCTGGGTGAAGTGAGAATAGG + Intronic
908009234 1:59758801-59758823 GGACTAGGGAAGGATAGAATTGG + Intronic
910526808 1:88188402-88188424 TTGCTAGGGAAGGAGATAATGGG - Intergenic
910938280 1:92505045-92505067 GTCATAGGGTAGGAGAGAATGGG + Intergenic
912639430 1:111331024-111331046 CTTATAGGGCAGGAGAGAATGGG - Intergenic
914877861 1:151525622-151525644 GTCCTAGAGAAGGGGAGAGTTGG - Exonic
915531387 1:156504278-156504300 GCTGTAGGGAAGGTGAGAGGGGG - Intergenic
915897595 1:159823865-159823887 GTTTTGGGGAAGCTGAGAAAGGG - Intergenic
916315278 1:163441927-163441949 ATTCTTTGCAAGGTGAGAATGGG + Intergenic
918456993 1:184731457-184731479 GTTCTAGAAAACTTGAGAATTGG - Intronic
919062411 1:192650223-192650245 GCTCTAGCAAAGATGAGAATAGG + Intronic
919543865 1:198886912-198886934 GTTGTAGGGTAGAAGAGAATGGG + Intergenic
920648866 1:207822193-207822215 GTGCTTGGAAAGGTGAGGATGGG - Intergenic
920888667 1:209959761-209959783 GGGCTAGGGGAGGGGAGAATAGG + Intronic
921538330 1:216380430-216380452 GTTCTAGGGAATGTGAAAGGAGG + Intronic
922737845 1:227998962-227998984 GTTCTAGGGAACAGGAGAGTGGG - Intergenic
924043003 1:240002169-240002191 TTTCTAGGGATGGCTAGAATGGG - Intergenic
1065603799 10:27395135-27395157 GTTCTGGGGAAGGTGAAACAAGG + Intergenic
1068013054 10:51478557-51478579 GTTTTAGGGAAACTGGGAATTGG - Intronic
1068263900 10:54622342-54622364 GTTCTAGGGAAGCTGAGCGCTGG + Intronic
1068933618 10:62615638-62615660 GCTCTAGGGATGATGACAATGGG + Intronic
1069756600 10:70777509-70777531 GGTCTAGGGCAGGTGAGGTTGGG - Intronic
1070060575 10:72979498-72979520 CTTATAGGCAAGGAGAGAATGGG - Intergenic
1070723415 10:78772243-78772265 GTCCTAGGAATGGGGAGAATGGG - Intergenic
1071529756 10:86380138-86380160 GTCTGAGGGAAGATGAGAATGGG + Intergenic
1074115504 10:110454978-110455000 GTGCTGGGGAAGGAGAGAAGAGG - Intergenic
1074379048 10:112963694-112963716 TTACTTGGGAAGATGAGAATTGG + Intronic
1081885616 11:46493389-46493411 GGTCTAGGGAAAGTGGGAATAGG + Intronic
1084063219 11:66689013-66689035 GTTCCAGAGTAGGTGAGACTAGG - Intronic
1085395435 11:76204900-76204922 GGTCCAGGGAAGGAGAGGATTGG - Intronic
1085837231 11:79970160-79970182 GGGCTAGGGGAGGAGAGAATAGG - Intergenic
1085887236 11:80535227-80535249 GTACTAGGGGAGCTGAGAATGGG + Intergenic
1087309659 11:96526296-96526318 ATTGAAGGGAAGGTAAGAATAGG + Intergenic
1089207822 11:116779122-116779144 GTTCTTGGGAAGGTGGGAATTGG - Intronic
1091655960 12:2347213-2347235 GTTCGTGGGGAGGTGAGAAAGGG - Intronic
1091983978 12:4892493-4892515 GTTCTTGGGAAGGAGACACTGGG + Intergenic
1094169434 12:27477261-27477283 CTTATAGGCAAGGAGAGAATGGG - Intronic
1095621851 12:44265753-44265775 GGCCTGGGGAAGGGGAGAATGGG - Intronic
1095636187 12:44436313-44436335 CTTCTTGGGAAGGTGTGAGTGGG + Intergenic
1096111234 12:49030542-49030564 GTTCTTGGGAAGGTGAGGGTGGG - Intronic
1097088533 12:56487595-56487617 GGACTAGGGAAGGTGAGGACTGG + Intronic
1097096088 12:56549636-56549658 GTTCTGGGGAAGGGAAGGATAGG + Intronic
1098877275 12:75879096-75879118 GAATTATGGAAGGTGAGAATTGG - Intergenic
1099206286 12:79731194-79731216 GCTGCAGGGAAGGGGAGAATGGG + Intergenic
1100292547 12:93231621-93231643 GAGGGAGGGAAGGTGAGAATGGG - Intergenic
1100990722 12:100248642-100248664 ATTGAAGGGGAGGTGAGAATTGG + Intronic
1101489204 12:105196326-105196348 GTTCTGGGAAAGGAGTGAATGGG - Intronic
1103486183 12:121284267-121284289 GTTCTAGGCAGGGCGACAATTGG + Intronic
1103606213 12:122087748-122087770 GGTCTAGGGAGGGTGAGAGCAGG + Intronic
1105595882 13:21837466-21837488 TTTCTAGGGAAGTTGAGAAATGG + Intergenic
1106004871 13:25759443-25759465 GCTGTGGGGAAGGTGGGAATAGG - Intronic
1108334319 13:49423221-49423243 AATCTAGGGCAGGTGAGAATTGG + Intronic
1110746939 13:79064887-79064909 GATCTAGGGAAAGTGAGAAACGG + Intergenic
1112575087 13:100628198-100628220 GGTCTGGTGGAGGTGAGAATGGG - Intronic
1114044270 14:18708373-18708395 TTTCATGGGAAGGTGAGAAGGGG + Intergenic
1114048549 14:18898823-18898845 TTTCATGGGAAGGTGAGAAGGGG + Intergenic
1114113962 14:19502823-19502845 TTTCATGGGAAGGTGAGAAGGGG - Intergenic
1114115662 14:19620574-19620596 TTTCATGGGAAGGTGAGAAGGGG - Intergenic
1115783041 14:36792210-36792232 GTCCTAAAGAAGGAGAGAATAGG + Intronic
1116939224 14:50773809-50773831 GTAATAGGGAAGGGGAGATTGGG + Intronic
1118780602 14:69005315-69005337 GGGCTAGGGAAGGTGAGGCTGGG - Intergenic
1119856885 14:77907754-77907776 GGTCTGGGGAAGCTGGGAATCGG - Intronic
1120822923 14:88929644-88929666 GACTTAGGGAAGGGGAGAATGGG - Intergenic
1121452954 14:94021037-94021059 GTGCTGGGGAAGAAGAGAATAGG - Intergenic
1121949609 14:98159873-98159895 GGTAAAGGGAAAGTGAGAATGGG + Intergenic
1125058657 15:35392024-35392046 CTTTTAGAGAAGGTGAAAATTGG + Intronic
1126463984 15:48943906-48943928 CTTCCAGGGAAGCTGAGAAATGG + Intronic
1126464040 15:48944319-48944341 CTTCCAGGGAAGCTGAGAAATGG - Intronic
1131139292 15:89964027-89964049 CTTCTTGGGCAGGAGAGAATGGG + Intergenic
1134505761 16:14805571-14805593 GGACAAGGGAAGGTGAAAATGGG + Intronic
1134574819 16:15323376-15323398 GGACAAGGGAAGGTGAAAATGGG - Intergenic
1134727627 16:16433098-16433120 GGACAAGGGAAGGTGAAAATGGG + Intergenic
1134939806 16:18278729-18278751 GGACAAGGGAAGGTGAAAATGGG - Intergenic
1137567271 16:49541120-49541142 GTTCTAGGGGAGGGAAGCATAGG - Intronic
1139076048 16:63449679-63449701 GATATAGGGGAGGTGAGAAATGG - Intergenic
1139353529 16:66353053-66353075 GTTCTGGGGAAGGTCACACTGGG + Intergenic
1140119170 16:72068547-72068569 TTTCTAGGGAAGGTAAGGCTAGG - Intronic
1140942955 16:79739238-79739260 ACTCTAGTGAAGGAGAGAATGGG - Intergenic
1143246639 17:5491973-5491995 ATTCCAGGGAAGCAGAGAATGGG - Intergenic
1143589795 17:7875807-7875829 GTTTCAGGGAAGGGAAGAATGGG - Intronic
1144645294 17:16969704-16969726 ATTCTAGGGGAGGTGGGAACTGG + Intronic
1147522532 17:41188234-41188256 GTTATAGTGAAGGAGAGGATGGG - Intergenic
1151787346 17:76281495-76281517 TTTCTAGGGAAATTGAGAAGGGG + Intronic
1153576916 18:6531581-6531603 GGTGTAGAGAAGGAGAGAATTGG + Intronic
1154497000 18:14969000-14969022 GTTCTAGGGCAGGTGAAATCTGG + Intergenic
1155195687 18:23471907-23471929 GTTCTAGGGAAAGTCAGGACTGG + Intronic
1155634645 18:27938307-27938329 TTTATAGGCAATGTGAGAATGGG + Intergenic
1156137504 18:34060209-34060231 GTTCCAGGGACTGTGAGTATGGG - Intronic
1156596153 18:38550569-38550591 GGTCTAGGGAAGGAGAGAGGTGG - Intergenic
1156702717 18:39843594-39843616 GACCTAGGGAACGTGAGAAGAGG - Intergenic
1156734576 18:40238545-40238567 GTTACAGAGAAGATGAGAATTGG + Intergenic
1156944477 18:42812670-42812692 GTTTTATGGAAGGGGAGAAAAGG + Intronic
1157197793 18:45633633-45633655 GTTTGAGGGAAGTTGAGAACAGG - Intronic
1161829995 19:6595881-6595903 GTTCTTGGGAAGGTCAGAAAAGG - Intronic
1162003653 19:7763827-7763849 GTCCTGGGGCAGGTGAGAACTGG + Intronic
1162003677 19:7763901-7763923 GTCCTGGGGAAGGTGAGAACTGG + Intronic
1164883178 19:31753422-31753444 GGGCTGGGGAAGGTGGGAATAGG + Intergenic
1166879968 19:45922837-45922859 ATCCCAGGGAAGGTGAGAAGAGG - Intergenic
926948795 2:18218618-18218640 TTTCATGGGAAGCTGAGAATTGG - Intronic
927946661 2:27138832-27138854 GCTCCAGGGAAGGTGAGAAGTGG + Intronic
928382824 2:30835057-30835079 TGTCTAGGGTAGGTGAGAAATGG - Intergenic
928664906 2:33540367-33540389 GAGCTGGGGAAGGTGAGAAAAGG + Intronic
930487502 2:52026514-52026536 ATTTTAGGTCAGGTGAGAATTGG + Intergenic
931144392 2:59501224-59501246 GATTTGGGGAAGGTGAAAATTGG - Intergenic
931166306 2:59752646-59752668 GTTGTTGGGGAGGGGAGAATGGG + Intergenic
932404848 2:71506111-71506133 GTGTTAGGGGAGGTGAGAGTGGG + Intronic
935854537 2:107259810-107259832 GAGCTAGGGAAGGTGTGAACAGG - Intergenic
937436299 2:121884660-121884682 GTGTTAGGGGAGGTGAGGATAGG - Intergenic
938425916 2:131187331-131187353 TTTCATGGGAAGGTGAGAAGGGG + Intronic
945688195 2:212998278-212998300 GTTCCAGTGAAGGTAACAATTGG - Intergenic
946137437 2:217658924-217658946 GGTATAGAGATGGTGAGAATAGG - Intronic
946274269 2:218618876-218618898 GGTTTAGGAAAGGTGAGAAGGGG + Intronic
948261013 2:236604521-236604543 GTTCTAGGGTAGCGGAGAGTAGG + Intergenic
1168847996 20:958596-958618 GTTCTCGGGGAGGTGAGAGCAGG + Exonic
1170974795 20:21152139-21152161 GTTTGAAGGAAGGTGTGAATAGG + Intronic
1171106405 20:22437487-22437509 GTTCAGGGGGAGGGGAGAATAGG - Intergenic
1172215386 20:33232137-33232159 GTTCTCCAGAATGTGAGAATGGG - Intergenic
1174301379 20:49584960-49584982 GGTCTAGGGCAGGAGAGAAGAGG + Intergenic
1178518440 21:33267283-33267305 GTGCCAGGGAAGGAGAGAAAAGG - Intronic
1180467089 22:15621487-15621509 TTTCATGGGAAGGTGAGAAGGGG + Intergenic
1180725137 22:17941387-17941409 CTTCCAGAGAAGCTGAGAATGGG - Intronic
1182548950 22:31090886-31090908 ATCCTAGGCAGGGTGAGAATAGG - Intronic
1183247863 22:36707888-36707910 GTGCAAGGGAAGCTGAGAAGAGG + Intergenic
1183350576 22:37332568-37332590 GTCCTAGGGAAGGGGAGGAATGG + Intergenic
1183985144 22:41565651-41565673 CTTTTAGGGGAGCTGAGAATTGG + Intronic
1184631757 22:45786803-45786825 GTTCTAGGGGTGGTATGAATTGG + Intronic
1185077831 22:48692786-48692808 GTTCCCAGGAAGGTCAGAATGGG + Intronic
953424270 3:42780253-42780275 GTTGTAGACAAGGTGAGATTAGG + Intronic
953983231 3:47423231-47423253 GTTCTAGGGAAAATGAGAAAAGG - Intronic
954290132 3:49645309-49645331 ATTCTAGGGAAGGTGTGGATAGG + Intronic
954311195 3:49768834-49768856 GGGCTGGGGGAGGTGAGAATGGG + Intronic
955053896 3:55439119-55439141 GTGCTGGGGCAAGTGAGAATGGG + Intergenic
955333811 3:58068886-58068908 GTTCCAGGCCAGGTGAGCATGGG + Intronic
957163208 3:76636829-76636851 CTTCTAGGCAGGGTGACAATAGG + Intronic
959043485 3:101445153-101445175 TTTCTAGGCCAGGAGAGAATGGG + Intronic
961408266 3:126698789-126698811 GTTGTAGGGAAGGGGAAACTGGG + Intergenic
962435002 3:135358078-135358100 GGTATAGGGAAGGAGAGGATGGG - Intergenic
966980591 3:185130613-185130635 GGACCAGGGAAGGGGAGAATAGG - Intronic
967024758 3:185555013-185555035 GTTCTAGGGAAGCTGAGGCAGGG - Intergenic
967282759 3:187837858-187837880 CGTCTAGGGAAGGTGAGAAAAGG + Intergenic
968481378 4:834603-834625 GTTCTAGGGAAGGAGTGGAGGGG - Intergenic
971487987 4:27180943-27180965 GTTTTAAGGGAGGAGAGAATAGG + Intergenic
972027049 4:34394545-34394567 GTTCTAAGGAAGGGGTGAAGTGG - Intergenic
972099614 4:35397536-35397558 ATTCTAGAAAAGGTGAAAATAGG + Intergenic
975333221 4:73143452-73143474 GTGCTAGGTAATGTGAGAAATGG + Intronic
975341491 4:73246264-73246286 CTTCTAGAGAAGGGAAGAATAGG - Intronic
977214847 4:94269393-94269415 GTTTTAGTGAATATGAGAATAGG + Intronic
978328974 4:107590531-107590553 GTCTTGGGGAAGGGGAGAATGGG - Intronic
978842289 4:113229086-113229108 TTGCTAGGGAAGGTAAAAATGGG - Intronic
979968063 4:127099947-127099969 TTTCTAGTGAAGGTGTGAAATGG + Intergenic
980109657 4:128623071-128623093 GTTTTAGTGAAGCAGAGAATTGG + Intergenic
980545637 4:134258649-134258671 GTCCTTGAGAAGTTGAGAATTGG - Intergenic
981812354 4:148790083-148790105 GCTCTGGGGGTGGTGAGAATCGG - Intergenic
983565759 4:169149990-169150012 CTTCTAGGGAATGAGAGAATTGG - Intronic
992505190 5:77380411-77380433 GTTGTTGTGAAGGTGAGAAATGG - Intronic
994331935 5:98516509-98516531 GGTAAAGGGAAGGGGAGAATGGG - Intergenic
995201469 5:109429535-109429557 ATTCTAGGGAGAGAGAGAATCGG - Intergenic
995645869 5:114310698-114310720 GTTCTTAGGAAGGTGACACTTGG + Intergenic
995913134 5:117212040-117212062 GTGATAGGGATGGGGAGAATTGG - Intergenic
997191013 5:131935655-131935677 GTTCCAGGGCAGGAGATAATAGG - Intronic
997665705 5:135628094-135628116 CTTCTAGAGAAGGTGACATTTGG + Intergenic
1000313110 5:160063646-160063668 CTTCCAGTGGAGGTGAGAATGGG - Intronic
1000332775 5:160219185-160219207 GTCCTGGGGATGGAGAGAATAGG + Intronic
1001101543 5:168818481-168818503 GTTGTAGGGAACGTGGAAATGGG - Intronic
1001930893 5:175672311-175672333 GTTCTTGGGGAGGTGAGATGTGG - Intronic
1002813534 6:657152-657174 GCTGGAGGGAAGGTGAGAACGGG - Intronic
1003160323 6:3628859-3628881 GTTAGAAGGAAGGTGAGGATAGG + Intergenic
1003695560 6:8403558-8403580 GTTCCAGGGCAGGAGAGCATGGG + Intergenic
1005151548 6:22757303-22757325 TTTCTAAAGAAGGAGAGAATGGG + Intergenic
1007596028 6:43051795-43051817 TTTCTAGGAAGGGTGAGATTAGG - Intronic
1007949601 6:45859651-45859673 GTTCCAGGTAAGGTGACAAAGGG - Intergenic
1011669433 6:89668834-89668856 GTTCAAGGGAACTTGAGAGTAGG - Intronic
1013350093 6:109297883-109297905 CTTTCAGGGAAGGAGAGAATTGG - Intergenic
1014712448 6:124823135-124823157 GTGCTTGGAAAGGTGAGAAAAGG + Intronic
1015267723 6:131305735-131305757 GATCTAGAGGAGGTGAGAAGAGG + Intergenic
1016299969 6:142619779-142619801 GCCCTAAGGAAGGTGAGTATGGG + Intergenic
1016466889 6:144334520-144334542 GTTCTAGGGGAGGGGTGAAGTGG + Intronic
1016760028 6:147726703-147726725 GTTCTTGGGAAGGAGAGGTTAGG - Intronic
1017788313 6:157774285-157774307 GTGGGAGGGAAGGTGAGAGTTGG + Intronic
1018704975 6:166457417-166457439 TTTCTAAGGAAGCTGAGAATGGG + Intronic
1019752246 7:2738614-2738636 CTTCTAGGGAGGGAGGGAATGGG + Intronic
1020507331 7:9008332-9008354 GAACTAGGGGAGGGGAGAATTGG - Intergenic
1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG + Intergenic
1023318997 7:38973563-38973585 TTTCTAGGGAAGTTGAGGACAGG - Intergenic
1023622444 7:42087096-42087118 GTTCTAGGAAAGGTGAAAAGGGG + Intronic
1023849196 7:44140825-44140847 GCTCTAGGGAAGGTGGGAGGTGG + Intronic
1024385686 7:48748823-48748845 GTGCTAGGGAGGGTGTGAGTGGG + Intergenic
1024843318 7:53613390-53613412 GTTATTGGGAAAGTGAGAATAGG - Intergenic
1027948507 7:84781115-84781137 CTCCTAGGGAAGGGGTGAATTGG - Intergenic
1030993798 7:116334058-116334080 GTTCTCAGAAAGGAGAGAATGGG - Intronic
1031184749 7:118462072-118462094 GTATTAGGGAAGTTGAGGATGGG + Intergenic
1031496705 7:122458134-122458156 CCTCTAGGGAAAGTGAGAAGGGG + Intronic
1033792608 7:144809432-144809454 GTTATAAGGTGGGTGAGAATGGG - Intronic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1034131085 7:148718378-148718400 GTTGTGGGGATGGTGGGAATGGG - Intronic
1036678278 8:10852301-10852323 GTTCCAGGGAAGGTGACCCTTGG + Intergenic
1037328299 8:17717263-17717285 GTTCTAGGGAAGGTGAGAATTGG - Intronic
1039535678 8:38310190-38310212 GTTGTAGGGGAGGTGAGATGAGG - Intronic
1040408405 8:47132112-47132134 GCTCTAGGGAAGGTTAACATGGG + Intergenic
1041326119 8:56666814-56666836 GTTTTAGTGAATGTGACAATTGG - Intergenic
1041337095 8:56798348-56798370 GTTCTAGGCAAGATGTGGATGGG - Intergenic
1041449039 8:57987943-57987965 ATTCCAGGGAAAATGAGAATTGG + Intergenic
1042318080 8:67445314-67445336 GTTCTAGAAAAGATGTGAATGGG + Intronic
1044849813 8:96417451-96417473 GTTTAACAGAAGGTGAGAATGGG + Intergenic
1050484561 9:6120068-6120090 GTCTGAGGGGAGGTGAGAATGGG - Intergenic
1051895450 9:21982268-21982290 ATTCTTGGGAAGATGATAATAGG - Intronic
1054832262 9:69638993-69639015 GTTTTAGGGACCCTGAGAATGGG - Intronic
1059013433 9:110488048-110488070 GTTCTGAGGATGGAGAGAATGGG + Intronic
1060100446 9:120836003-120836025 GTGCTTGGGGAGGGGAGAATAGG - Intronic
1060497230 9:124127549-124127571 GTTCTAGGGAAAGGGAGAATGGG + Intergenic
1188192875 X:27193849-27193871 GTTCTAGAGAGAGTGAGAGTAGG - Intergenic
1190388455 X:49908448-49908470 GTGGTAGAGAAGGTGAGAAGTGG + Intergenic
1193011598 X:76681705-76681727 GTTCTAGTTAAGGTGAGCAAAGG - Intergenic
1193082045 X:77415722-77415744 GTTCCAGGCAAGGGGAGAAATGG - Intergenic
1195927655 X:110042189-110042211 GGCCTGGGGAAGGTAAGAATTGG - Intronic
1196281719 X:113830196-113830218 GTTATGGGGAAGGAGAGAAGGGG - Intergenic
1197167113 X:123390468-123390490 GTTATAGGCCAGGAGAGAATGGG - Intronic
1197373031 X:125647574-125647596 GTACCAGGGAAGGTGGGCATTGG - Intergenic
1198787556 X:140305394-140305416 GTTACAGGGAAGATGCGAATGGG + Intergenic
1200657731 Y:5924723-5924745 GTTCTAGGGAGGGAGAGATGGGG + Intergenic