ID: 1037329596

View in Genome Browser
Species Human (GRCh38)
Location 8:17731290-17731312
Sequence CCTGCTCACTAGGCAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037329596_1037329604 24 Left 1037329596 8:17731290-17731312 CCTCACACTGCCTAGTGAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 156
Right 1037329604 8:17731337-17731359 TTTCTCATATGTGAGAATGGGGG No data
1037329596_1037329601 21 Left 1037329596 8:17731290-17731312 CCTCACACTGCCTAGTGAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 156
Right 1037329601 8:17731334-17731356 TGTTTTCTCATATGTGAGAATGG No data
1037329596_1037329602 22 Left 1037329596 8:17731290-17731312 CCTCACACTGCCTAGTGAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 156
Right 1037329602 8:17731335-17731357 GTTTTCTCATATGTGAGAATGGG No data
1037329596_1037329603 23 Left 1037329596 8:17731290-17731312 CCTCACACTGCCTAGTGAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 156
Right 1037329603 8:17731336-17731358 TTTTCTCATATGTGAGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037329596 Original CRISPR CCTGCTCACTAGGCAGTGTG AGG (reversed) Intronic
900150269 1:1175640-1175662 CCTGCAGACTGCGCAGTGTGTGG + Intronic
900234734 1:1582720-1582742 CCTTCAGACTAGGCAGAGTGAGG + Intergenic
902040767 1:13490700-13490722 CCTTCTGGTTAGGCAGTGTGAGG + Intronic
903790557 1:25890086-25890108 CCTACTTACCAGGCAGTGTTAGG - Intronic
904369877 1:30041784-30041806 CCTGCCCAAGACGCAGTGTGTGG - Intergenic
905872336 1:41412234-41412256 CCTGCTCACTTGGGAGGCTGAGG + Intergenic
906476417 1:46172209-46172231 GCTGCTCCCCAGGCACTGTGAGG + Intronic
907235970 1:53048093-53048115 CCAGCACACAAGACAGTGTGTGG - Intronic
907272581 1:53299517-53299539 GCTCCTCACCAGGGAGTGTGTGG + Intronic
907833049 1:58083429-58083451 CCCGCACACTGGGCATTGTGCGG - Intronic
919365937 1:196660913-196660935 ACTTCTCACTAGGAAGTGAGCGG + Intronic
919919214 1:202158314-202158336 GGTGCTCACTAGGCAGTGGTGGG - Intronic
920278561 1:204826739-204826761 ACTGGTCCCTAGGAAGTGTGGGG - Intergenic
921783669 1:219200029-219200051 ACTGCTCACTAGGTGGTGTGGGG - Intronic
922222072 1:223616255-223616277 CCTGCTTACTAGGCACAGTTTGG - Intronic
922753135 1:228080312-228080334 CCTACTCCCTAGGCAGCGTTGGG + Intergenic
923765975 1:236892737-236892759 CCTCCTCACTAGGGAATTTGTGG + Intronic
1065046991 10:21753921-21753943 CCTCCTCAGTGGGCAGGGTGAGG + Intergenic
1068819559 10:61358523-61358545 CCTACTCACAAGGCAGTTTCTGG + Intergenic
1071078532 10:81783148-81783170 TCTGGTCATTAGGAAGTGTGAGG + Intergenic
1071136828 10:82463086-82463108 GCTGCTCACTAGTCAGTTTCTGG - Intronic
1073552626 10:104417206-104417228 CCTGGTCACCAGGAGGTGTGGGG - Intronic
1075006791 10:118836329-118836351 CCTCCTCACTACTCAGAGTGAGG - Intergenic
1075263584 10:120982482-120982504 GCAGCTCACTAAGCAGTGTTGGG + Intergenic
1077252509 11:1566827-1566849 CCTGCCCACCCGGCAGTCTGAGG - Intronic
1082068018 11:47916543-47916565 TCTGCACTCAAGGCAGTGTGGGG - Intergenic
1083681336 11:64353219-64353241 CCGGCTGACCACGCAGTGTGAGG + Exonic
1085307006 11:75492189-75492211 CCTGCCCAATAGGCTGGGTGAGG + Intronic
1087604972 11:100366335-100366357 CCTGCACACAAGGCAGAGGGGGG + Intergenic
1090976488 11:131684387-131684409 GCTACCCACTAGGGAGTGTGGGG - Intronic
1091065157 11:132502813-132502835 CCTGCTCACTGGAGAGAGTGGGG + Intronic
1091589813 12:1836430-1836452 CCTGCTCATGCGGCAGTGGGTGG + Exonic
1092934435 12:13347481-13347503 TATGCTCACCAGGCAGTGGGAGG - Intergenic
1093715515 12:22377015-22377037 CCGGCCCCCTAGGCAGTGAGGGG + Intronic
1095469927 12:42525631-42525653 TCTGGTCACCAGGAAGTGTGTGG - Intronic
1096668684 12:53184615-53184637 CATCAGCACTAGGCAGTGTGTGG - Intronic
1097841400 12:64325179-64325201 CATGCTGACTGGGCAATGTGAGG - Intronic
1102371152 12:112383000-112383022 TATGCTCACTAGGCCGGGTGCGG + Intergenic
1108343153 13:49517367-49517389 CATGATGGCTAGGCAGTGTGTGG - Intronic
1109568190 13:64147725-64147747 ACTGCTCACAAGTCAATGTGGGG + Intergenic
1109884080 13:68519901-68519923 CCTGGGCACTGGGCATTGTGGGG + Intergenic
1112589452 13:100750124-100750146 CTTGCTCACTTGGCTGTGTTTGG - Intergenic
1113154601 13:107305106-107305128 CCAGCTAACTGGGGAGTGTGAGG - Intronic
1113991666 14:16032467-16032489 GCTGCTGACTGGTCAGTGTGGGG - Intergenic
1116221805 14:42096666-42096688 CCTGCCAACTTGGAAGTGTGTGG + Intergenic
1120646288 14:87078520-87078542 GCTGCTTACTAGCTAGTGTGTGG - Intergenic
1121312151 14:92941018-92941040 GCTGCACACCAGGCAGGGTGGGG + Exonic
1121789172 14:96686107-96686129 GCTGGTCACTTGGCAGGGTGGGG - Intergenic
1122302198 14:100737600-100737622 GCGGAGCACTAGGCAGTGTGCGG + Exonic
1122771114 14:104098418-104098440 CCTGCTCAGGAGCCCGTGTGGGG - Intronic
1125369183 15:38951908-38951930 CCAGCTCACTAAGCAGGGTCTGG + Intergenic
1125765145 15:42130653-42130675 CCTGCTCACTGGGGGGTCTGAGG - Intergenic
1126462341 15:48927312-48927334 CCTGCTCTCCAGCCTGTGTGGGG - Intronic
1127211571 15:56779726-56779748 CCTGCCGACCAGGCAGTGAGGGG + Intronic
1128155408 15:65388802-65388824 CTTGCTCACCACGCAGGGTGAGG - Exonic
1131404421 15:92152635-92152657 CCTGCTCTCACTGCAGTGTGGGG + Intronic
1133781404 16:8941877-8941899 GGTGCTCACTAGGAAGTGGGAGG + Intronic
1139388497 16:66589605-66589627 CCTGCAGGCCAGGCAGTGTGAGG + Intergenic
1139693842 16:68658482-68658504 ACTGCTCACTGGCCAGTGAGAGG + Intronic
1140785579 16:78338259-78338281 CCTGCTCACTAGGCAGTATCAGG - Intronic
1142394023 16:89821115-89821137 CCTTGTCACTGAGCAGTGTGGGG + Intronic
1144125327 17:12197611-12197633 GCTACTCCTTAGGCAGTGTGAGG - Intergenic
1144769114 17:17749376-17749398 CCTGATGCCTAGGCAGTGCGTGG - Intronic
1145010228 17:19363824-19363846 TTTGCTCACTAGGCAGGGGGTGG - Intronic
1145241652 17:21243809-21243831 CCTGCTCTCCAGGCAGCCTGGGG + Intronic
1145717040 17:27033245-27033267 CCTGCGCACTCGGCAGGCTGAGG - Intergenic
1146798563 17:35800321-35800343 CCTCCTCCCCAGGAAGTGTGTGG + Intronic
1149532017 17:57402965-57402987 CCCTCTCCCTAGGCAGGGTGGGG - Intronic
1150504434 17:65683598-65683620 CCCACTGCCTAGGCAGTGTGTGG - Intronic
1151453141 17:74211576-74211598 CCTGCCTCCTAGGCAGTGGGTGG - Intergenic
1152799328 17:82323610-82323632 CCTGCTCCCTAGGCCCTGAGCGG - Intronic
1154235804 18:12604388-12604410 TCTGCTCACCAAGAAGTGTGTGG - Intronic
1156018902 18:32577492-32577514 CCTGCTAACTAGAAAGTGGGAGG - Intergenic
1156552116 18:38028729-38028751 CCTCCCCACCAGGCAGGGTGTGG + Intergenic
1158237702 18:55337787-55337809 GCTGATCACTAGGCAGTCTTAGG - Intronic
1159185976 18:64974779-64974801 GCTACCCGCTAGGCAGTGTGGGG - Intergenic
1160018130 18:75159356-75159378 CCAGAGCACTAGGCAGTGTGGGG + Intergenic
1161455364 19:4367156-4367178 CCTGCTCTGCAGGCAGCGTGTGG - Intronic
1162041709 19:7974917-7974939 CCTGCTCATAGGGCAGTGGGCGG + Intronic
1164571929 19:29380879-29380901 CCTGCTCCCTGGGCACTGGGTGG - Intergenic
1164793394 19:31006655-31006677 CCTGCTAGCTAGGCACTGTGAGG - Intergenic
1165389212 19:35528682-35528704 CCAGCTCCCCAGGCAGTGAGGGG + Intergenic
1165821788 19:38681410-38681432 CCTGCTCTCTGGGCAGTGGGGGG - Intronic
1166292282 19:41870797-41870819 CCTTCTCACATGGCAGTGGGCGG + Intronic
1166793794 19:45414122-45414144 CCTGCACGCCAGGCAGTCTGGGG - Intronic
1166805510 19:45484717-45484739 GCTGCACAGTAGGCAGGGTGTGG + Intergenic
1168475338 19:56671097-56671119 CCTGCTCACTCGGCGGTGCCAGG - Intronic
1168475367 19:56671293-56671315 CCTGCTCACTTGGCGGTGCCAGG - Intronic
925217843 2:2112492-2112514 CATGCACACGATGCAGTGTGTGG + Intronic
926150381 2:10422623-10422645 ACAGCTCAGCAGGCAGTGTGGGG + Intronic
928606625 2:32948970-32948992 CCTGCACAGTAGGCAAAGTGGGG + Intronic
929574201 2:43041944-43041966 CCTGGTCTCTAGGCAGTCTGTGG - Intergenic
930039455 2:47108878-47108900 CCTGCTAAATGGGCAGGGTGCGG + Intronic
933707489 2:85302863-85302885 CTGGCTCCATAGGCAGTGTGTGG + Intronic
935390264 2:102544052-102544074 CCCTCTCACTAGGAACTGTGGGG - Intergenic
935791486 2:106595016-106595038 CCTGGTCCCTGGGCAGTCTGTGG - Intergenic
936791777 2:116160650-116160672 CCTGAACAATAGGCTGTGTGGGG - Intergenic
938781306 2:134587294-134587316 CCTGGCTACTAGGGAGTGTGAGG + Intronic
938998604 2:136707524-136707546 CTTGCTTAATAGGCAGTTTGAGG + Intergenic
945751559 2:213792417-213792439 CAAGCTTATTAGGCAGTGTGAGG - Intronic
948011405 2:234652041-234652063 CCAGCTCAGTGGGCAGTGGGGGG + Intergenic
948582865 2:238999723-238999745 CCTCCTCAGAAGGCAGAGTGGGG + Intergenic
1168922574 20:1552761-1552783 CCTGCTCCTTAGGCAGTCTGTGG - Intronic
1173409773 20:42799747-42799769 CTTGCTTACGGGGCAGTGTGTGG - Intronic
1175509605 20:59514980-59515002 TCTACCCACCAGGCAGTGTGTGG + Intergenic
1178830325 21:36050902-36050924 ACTGCTCATTAGGTGGTGTGGGG + Intronic
1179982879 21:44905668-44905690 CCTGCTCACGGGGCAGCGAGGGG + Intronic
1180315604 22:11275060-11275082 GCTGCTGACTGGTCAGTGTGGGG + Intergenic
1180868762 22:19134415-19134437 CCTGCTCACAAGGCGCTGTAGGG + Exonic
1181454181 22:23046852-23046874 CTTGCTCACTTGGCACTTTGGGG + Intergenic
1182646593 22:31815070-31815092 CTTCCTCAGTGGGCAGTGTGCGG - Exonic
1183518795 22:38284140-38284162 CCTGGTCATTGGGCAGAGTGAGG + Intergenic
1185135698 22:49070909-49070931 CCTCATCAGCAGGCAGTGTGAGG - Intergenic
1185140835 22:49100459-49100481 TCTGCTCTCAGGGCAGTGTGAGG - Intergenic
950230072 3:11268737-11268759 GCTACTCCATAGGCAGTGTGTGG + Intergenic
950289223 3:11770235-11770257 ACTGCTCATCAGTCAGTGTGGGG + Intergenic
950315691 3:12000117-12000139 CCTGCTCACTACCCAGGGTCAGG - Intergenic
950520967 3:13497634-13497656 CCAAATAACTAGGCAGTGTGTGG - Intronic
953552975 3:43918697-43918719 CCTGCCCAGAAGACAGTGTGGGG + Intergenic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
956231147 3:67018305-67018327 CCTGCTCACTAGGGAGTGGGAGG - Intergenic
958441490 3:94161556-94161578 CCTCTTCACTAGGCAGTATTTGG + Intergenic
959879568 3:111428024-111428046 TCTGCTCATTTGGAAGTGTGTGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961598564 3:128040926-128040948 CCAGGTCACTAGGCTGTGTGTGG - Intergenic
966808516 3:183824741-183824763 CCCGCACACTAGGCAGTGACCGG + Intronic
969598162 4:8160407-8160429 CGTCCTCACCAGGCTGTGTGGGG - Intergenic
970052411 4:11929604-11929626 CCTGAGTACTAGGCAATGTGTGG - Intergenic
970702483 4:18758695-18758717 CCTGCTGTCAAGGCAGTTTGGGG + Intergenic
975058325 4:69963819-69963841 CCTGGTCCCTAGACAGTGTCTGG - Intergenic
975816536 4:78222894-78222916 CCTCCTCACTTGGCAGGGAGTGG + Intronic
976658405 4:87513373-87513395 CCTGTTCACTAGTCTGTTTGGGG - Intronic
977805548 4:101293331-101293353 CCTGGCCACTAGGCAGTCAGTGG - Intronic
978337630 4:107686808-107686830 CCTGTTCACTAGCCAGAGTTGGG - Intronic
985514690 5:335488-335510 CCTGCCCACAAGACAGAGTGTGG - Intronic
988776215 5:34480108-34480130 CCTGCTCCCCAGGGAGGGTGGGG + Intergenic
989780367 5:45257060-45257082 CATCCTCACAAGGCAGGGTGGGG + Intergenic
992160852 5:73999937-73999959 CTAGCTCAGTAGGCAGTATGAGG + Intergenic
995458080 5:112373095-112373117 CCTGCTCAGTCTGCAGTGTGGGG - Intronic
998449127 5:142220815-142220837 CCAATTCACTGGGCAGTGTGGGG + Intergenic
998879654 5:146633184-146633206 CCTGCTGAGTATGCAGAGTGAGG + Intronic
999934217 5:156467984-156468006 CTTGCTCACTCTGCAGTGTTAGG + Intronic
1001601831 5:172934128-172934150 CCTGCTCCCAGGGCAGAGTGCGG - Intronic
1001980552 5:176034902-176034924 CCTGCTCCCCAGGGAGTGTTGGG - Intergenic
1002236909 5:177809163-177809185 CCTGCTCCCCAGGGAGTGTCGGG + Intergenic
1006259425 6:32855183-32855205 ACTGCTCATTTGGCAGTGAGGGG - Intronic
1006521877 6:34575531-34575553 CCTGCTGAGTAGGGAGAGTGGGG + Intergenic
1007363347 6:41373630-41373652 CCTGCTCACCCTGCAGGGTGCGG + Intergenic
1007722375 6:43892657-43892679 CTTCCTCACTGGGCAGGGTGAGG - Intergenic
1010906616 6:81499265-81499287 CCTACCCACCAGGCTGTGTGTGG - Intronic
1011002628 6:82608093-82608115 CTTGCTCACAGGGCAGTGAGAGG + Intergenic
1014183381 6:118408571-118408593 CCTGCTTACAAGGCAGTCTTGGG + Intergenic
1020208769 7:6141985-6142007 CGTGCTCTCTGGGCAGTGTGTGG + Intronic
1026535094 7:71232676-71232698 GCTGCCCCATAGGCAGTGTGTGG + Intronic
1034947470 7:155272236-155272258 TCTGCACTCTAGGCAGTGTTTGG - Intergenic
1037329596 8:17731290-17731312 CCTGCTCACTAGGCAGTGTGAGG - Intronic
1038333047 8:26624594-26624616 CGTGCTCTCTAGCCAGGGTGGGG + Intronic
1048938315 8:139375334-139375356 GCTGCCCCATAGGCAGTGTGTGG + Intergenic
1049080549 8:140440158-140440180 CCTGGCCACAAGGCAGTGTCAGG + Intronic
1056824372 9:89866295-89866317 CCTGCTCCTTCTGCAGTGTGGGG + Intergenic
1059247081 9:112857508-112857530 CCTGCTCACTCAGCAGCGTGTGG + Intronic
1061779472 9:132987274-132987296 CCTGGTCTCTGGGCACTGTGGGG - Exonic
1187803567 X:23093028-23093050 CCCCCTCACTCAGCAGTGTGGGG - Intergenic
1191210853 X:57883239-57883261 CCAGGTCACTAGACACTGTGTGG - Intergenic
1192224180 X:69217121-69217143 CCTGCTCGCTAGGAAGTATGTGG + Intergenic
1195196669 X:102503692-102503714 ACTGCTCCCTTGGCAGTGAGAGG + Intergenic
1199239083 X:145525959-145525981 GCTGCTAACTCTGCAGTGTGGGG - Intergenic
1202268324 Y:23044303-23044325 CCTGCTACCTAGGCTATGTGGGG + Intergenic
1202421316 Y:24678047-24678069 CCTGCTACCTAGGCTATGTGGGG + Intergenic
1202449470 Y:24992035-24992057 CCTGCTACCTAGGCTATGTGGGG - Intergenic