ID: 1037331428

View in Genome Browser
Species Human (GRCh38)
Location 8:17747482-17747504
Sequence AATTCTAGGCAGACGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037331418_1037331428 18 Left 1037331418 8:17747441-17747463 CCTTGCCTGTTTACTGTATTGAT 0: 1
1: 0
2: 1
3: 18
4: 255
Right 1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG No data
1037331417_1037331428 19 Left 1037331417 8:17747440-17747462 CCCTTGCCTGTTTACTGTATTGA 0: 1
1: 0
2: 2
3: 14
4: 209
Right 1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG No data
1037331419_1037331428 13 Left 1037331419 8:17747446-17747468 CCTGTTTACTGTATTGATAGAGG 0: 1
1: 0
2: 4
3: 10
4: 126
Right 1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037331428 Original CRISPR AATTCTAGGCAGACGGGGGC AGG Intronic
No off target data available for this crispr