ID: 1037333216

View in Genome Browser
Species Human (GRCh38)
Location 8:17765127-17765149
Sequence ACAATAGGGTTCACACTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037333212_1037333216 2 Left 1037333212 8:17765102-17765124 CCTAGATACCTCGCATGCACAGT No data
Right 1037333216 8:17765127-17765149 ACAATAGGGTTCACACTCCCAGG No data
1037333213_1037333216 -6 Left 1037333213 8:17765110-17765132 CCTCGCATGCACAGTTCACAATA No data
Right 1037333216 8:17765127-17765149 ACAATAGGGTTCACACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037333216 Original CRISPR ACAATAGGGTTCACACTCCC AGG Intronic