ID: 1037337103

View in Genome Browser
Species Human (GRCh38)
Location 8:17801730-17801752
Sequence AGGCCGGGCCGCGGTAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037337091_1037337103 -2 Left 1037337091 8:17801709-17801731 CCGCACCCAGCGCTAGGGCCCAG No data
Right 1037337103 8:17801730-17801752 AGGCCGGGCCGCGGTAGGTGGGG No data
1037337087_1037337103 9 Left 1037337087 8:17801698-17801720 CCGGGGCTCCGCCGCACCCAGCG No data
Right 1037337103 8:17801730-17801752 AGGCCGGGCCGCGGTAGGTGGGG No data
1037337086_1037337103 10 Left 1037337086 8:17801697-17801719 CCCGGGGCTCCGCCGCACCCAGC No data
Right 1037337103 8:17801730-17801752 AGGCCGGGCCGCGGTAGGTGGGG No data
1037337090_1037337103 1 Left 1037337090 8:17801706-17801728 CCGCCGCACCCAGCGCTAGGGCC No data
Right 1037337103 8:17801730-17801752 AGGCCGGGCCGCGGTAGGTGGGG No data
1037337083_1037337103 21 Left 1037337083 8:17801686-17801708 CCCCGCAGGAGCCCGGGGCTCCG No data
Right 1037337103 8:17801730-17801752 AGGCCGGGCCGCGGTAGGTGGGG No data
1037337095_1037337103 -8 Left 1037337095 8:17801715-17801737 CCAGCGCTAGGGCCCAGGCCGGG No data
Right 1037337103 8:17801730-17801752 AGGCCGGGCCGCGGTAGGTGGGG No data
1037337093_1037337103 -7 Left 1037337093 8:17801714-17801736 CCCAGCGCTAGGGCCCAGGCCGG No data
Right 1037337103 8:17801730-17801752 AGGCCGGGCCGCGGTAGGTGGGG No data
1037337085_1037337103 19 Left 1037337085 8:17801688-17801710 CCGCAGGAGCCCGGGGCTCCGCC No data
Right 1037337103 8:17801730-17801752 AGGCCGGGCCGCGGTAGGTGGGG No data
1037337084_1037337103 20 Left 1037337084 8:17801687-17801709 CCCGCAGGAGCCCGGGGCTCCGC No data
Right 1037337103 8:17801730-17801752 AGGCCGGGCCGCGGTAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037337103 Original CRISPR AGGCCGGGCCGCGGTAGGTG GGG Intergenic