ID: 1037341041

View in Genome Browser
Species Human (GRCh38)
Location 8:17845450-17845472
Sequence ATGAAGAAACAGTCAGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037341041_1037341043 -9 Left 1037341041 8:17845450-17845472 CCTCTATCTGACTGTTTCTTCAT No data
Right 1037341043 8:17845464-17845486 TTTCTTCATCCGTCACAAGGTGG No data
1037341041_1037341046 -6 Left 1037341041 8:17845450-17845472 CCTCTATCTGACTGTTTCTTCAT No data
Right 1037341046 8:17845467-17845489 CTTCATCCGTCACAAGGTGGGGG No data
1037341041_1037341045 -7 Left 1037341041 8:17845450-17845472 CCTCTATCTGACTGTTTCTTCAT No data
Right 1037341045 8:17845466-17845488 TCTTCATCCGTCACAAGGTGGGG No data
1037341041_1037341051 28 Left 1037341041 8:17845450-17845472 CCTCTATCTGACTGTTTCTTCAT No data
Right 1037341051 8:17845501-17845523 AAACCTAGTCACGGGGTCACTGG No data
1037341041_1037341050 21 Left 1037341041 8:17845450-17845472 CCTCTATCTGACTGTTTCTTCAT No data
Right 1037341050 8:17845494-17845516 TATTATAAAACCTAGTCACGGGG No data
1037341041_1037341049 20 Left 1037341041 8:17845450-17845472 CCTCTATCTGACTGTTTCTTCAT No data
Right 1037341049 8:17845493-17845515 TTATTATAAAACCTAGTCACGGG No data
1037341041_1037341048 19 Left 1037341041 8:17845450-17845472 CCTCTATCTGACTGTTTCTTCAT No data
Right 1037341048 8:17845492-17845514 ATTATTATAAAACCTAGTCACGG No data
1037341041_1037341044 -8 Left 1037341041 8:17845450-17845472 CCTCTATCTGACTGTTTCTTCAT No data
Right 1037341044 8:17845465-17845487 TTCTTCATCCGTCACAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037341041 Original CRISPR ATGAAGAAACAGTCAGATAG AGG (reversed) Intergenic
No off target data available for this crispr