ID: 1037342841

View in Genome Browser
Species Human (GRCh38)
Location 8:17865128-17865150
Sequence CAAATCTGAAAATACAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037342837_1037342841 26 Left 1037342837 8:17865079-17865101 CCTGGCCTCAGAGATGGGTATTT 0: 1
1: 0
2: 2
3: 21
4: 222
Right 1037342841 8:17865128-17865150 CAAATCTGAAAATACAACCCAGG No data
1037342838_1037342841 21 Left 1037342838 8:17865084-17865106 CCTCAGAGATGGGTATTTTAAAA 0: 1
1: 0
2: 6
3: 46
4: 426
Right 1037342841 8:17865128-17865150 CAAATCTGAAAATACAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037342841 Original CRISPR CAAATCTGAAAATACAACCC AGG Intronic
No off target data available for this crispr