ID: 1037344383

View in Genome Browser
Species Human (GRCh38)
Location 8:17882493-17882515
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037344374_1037344383 22 Left 1037344374 8:17882448-17882470 CCTTTGATCCTCATAACAATTCC 0: 1
1: 0
2: 6
3: 43
4: 270
Right 1037344383 8:17882493-17882515 CTTGATGCCCAGTGGGTAAGCGG No data
1037344380_1037344383 1 Left 1037344380 8:17882469-17882491 CCATGCGGTAGGAAAGGGCTCAG 0: 1
1: 0
2: 2
3: 19
4: 168
Right 1037344383 8:17882493-17882515 CTTGATGCCCAGTGGGTAAGCGG No data
1037344376_1037344383 14 Left 1037344376 8:17882456-17882478 CCTCATAACAATTCCATGCGGTA 0: 1
1: 0
2: 8
3: 74
4: 402
Right 1037344383 8:17882493-17882515 CTTGATGCCCAGTGGGTAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr