ID: 1037345178

View in Genome Browser
Species Human (GRCh38)
Location 8:17891096-17891118
Sequence TCTTCGTGCTTACATTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037345178_1037345181 20 Left 1037345178 8:17891096-17891118 CCTGTACAATGTAAGCACGAAGA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1037345181 8:17891139-17891161 ATGTATACTGCCCTAATGCTAGG No data
1037345178_1037345182 23 Left 1037345178 8:17891096-17891118 CCTGTACAATGTAAGCACGAAGA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1037345182 8:17891142-17891164 TATACTGCCCTAATGCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037345178 Original CRISPR TCTTCGTGCTTACATTGTAC AGG (reversed) Intronic
901559180 1:10056511-10056533 TCTTGGAGCTTGTATTGTACTGG + Intronic
901903090 1:12383791-12383813 TCTTGGAGCTTACATTCTAGTGG + Intronic
905069627 1:35213933-35213955 TCCTGGAGCTTACATTGTAGTGG - Intergenic
907485036 1:54771741-54771763 TCATGGAGCTTACATTCTACTGG - Intergenic
907574869 1:55517315-55517337 TCTTGGAACTTACATTGTAATGG + Intergenic
907804742 1:57806897-57806919 TCTTGGAGCTTACATTTTAGTGG - Intronic
910011301 1:82466232-82466254 TTTTGGTGCCTACATTGCACAGG - Intergenic
911337679 1:96600697-96600719 TCATCGTGCTTACCTTCTCCTGG + Intergenic
911378005 1:97075425-97075447 TCAAGGTGCTTACAATGTACAGG - Intergenic
912565285 1:110583228-110583250 TCTTGGGGCTTACATTCTAGTGG + Intergenic
919071186 1:192756953-192756975 TCTTCCTGCTTCCTTTGTCCTGG + Intergenic
921727347 1:218538460-218538482 TCTGTGTGCTTACATTGTGAAGG - Intergenic
921780870 1:219161880-219161902 TTTTCTTGCTTACCTTGTTCTGG - Intergenic
921816837 1:219573954-219573976 TCATGGGGCTTACATTTTACTGG + Intergenic
921883526 1:220280184-220280206 GCTTAGTCCTTACATTCTACAGG - Intergenic
1065061285 10:21903788-21903810 TCATGGAGCTTACATTCTACTGG + Intronic
1069390258 10:67927871-67927893 TCATGGTGCTTACATTGTGGTGG + Intronic
1071353590 10:84770681-84770703 TCATGGAGCTTACATTGTAGTGG + Intergenic
1071739466 10:88340755-88340777 TCCTTGTACTTACATTCTACAGG - Intronic
1071795728 10:89003007-89003029 TCTTCATGCTTTTATTTTACAGG + Exonic
1072842410 10:98789073-98789095 TCATGGAGCTTACATTCTACTGG - Intronic
1073518009 10:104096086-104096108 TGGTCTTGCTTACATTGCACAGG - Intergenic
1075288234 10:121205391-121205413 TCTTCATGCTTGCATGGGACAGG - Intergenic
1076979637 11:197655-197677 TCTTGGGGTTTACATTGTAACGG - Exonic
1078125872 11:8562867-8562889 TCTTGGAGCTTACATTATAGTGG + Intronic
1080854128 11:36097057-36097079 GCTTTGTGCTGACCTTGTACTGG + Intronic
1082079562 11:48001678-48001700 TCTTCTTGCTTTCATTTTACAGG + Intronic
1083928026 11:65820793-65820815 TCTTGGTGCTTACATTGTTGTGG - Intergenic
1085335598 11:75691655-75691677 TCATAGTGCTTACATTGGATTGG + Intergenic
1093973339 12:25394551-25394573 TCGTGGAGCTTACATTTTACTGG - Intergenic
1094599694 12:31897882-31897904 CCTTATTGCTTATATTGTACAGG - Intergenic
1097848839 12:64391573-64391595 TCTTCCTGCATAGATTGTCCTGG - Intergenic
1098823593 12:75265158-75265180 TCTTGGAGCTTACATTCTAATGG - Intergenic
1098838927 12:75455532-75455554 TCTTCATGCTTACTGTGTAGAGG + Intergenic
1099245898 12:80192953-80192975 TCTTCATTCTTACATAGTATGGG + Intergenic
1101298905 12:103457491-103457513 TCTTCCTGAATACAGTGTACAGG - Intronic
1101685704 12:107017987-107018009 TCATGGTGCTTACACTGTAGTGG - Intronic
1103692150 12:122783933-122783955 TCTTTGTGTTTACATTCTATGGG + Intronic
1107881668 13:44837466-44837488 TCTTGGAGCTTATATTCTACTGG - Intergenic
1111104831 13:83631158-83631180 TCTTTGTGCCTCCATTGTATTGG - Intergenic
1113456625 13:110454047-110454069 TCTTCGTGGTTTGATTTTACTGG - Intronic
1115865687 14:37744278-37744300 TCATAGAGCTTACATTGTAGTGG + Intronic
1118069002 14:62224434-62224456 TCTTCCTGGTTACATTGTGTTGG + Intergenic
1120159685 14:81131874-81131896 TCCTCATGCTTACATTCTAGTGG - Intronic
1122471782 14:101972939-101972961 TCTCTATGCTTACATTTTACAGG + Intronic
1125059945 15:35407514-35407536 TATTGGAGCTTACATTGTAATGG + Intronic
1125069936 15:35542342-35542364 ACTTCATAATTACATTGTACAGG - Intronic
1125117680 15:36114298-36114320 TCTTGATGCTTACAGTATACAGG + Intergenic
1125781295 15:42270873-42270895 TCATCGAGCTTACATTCTAGTGG - Intronic
1126133526 15:45367846-45367868 TTTTGGTGCTTACCTTGTTCTGG - Intronic
1127230648 15:56990484-56990506 TCGTGGTGCTTATATTTTACAGG + Intronic
1134101338 16:11454004-11454026 TCTATGTTCTTCCATTGTACTGG - Intronic
1134294227 16:12931204-12931226 TCTTCTTGCTTACCTTTTCCTGG + Intronic
1134363923 16:13559041-13559063 TCTTGGAGCTTACATTGTGGTGG - Intergenic
1136549023 16:30972297-30972319 TCATCATGCTTACAGTCTACAGG + Intronic
1136627176 16:31468740-31468762 TCTTTTTGCTCACATTGGACTGG + Intergenic
1144930545 17:18855633-18855655 TCATGGGGCTTACAGTGTACAGG + Intronic
1148211577 17:45811885-45811907 TCATGGTGCTTACATTCTAGTGG - Intronic
1148727590 17:49805550-49805572 TCCTTGTTCTTACATTGTAGTGG + Intronic
1150634721 17:66904964-66904986 TCCTTGTTCTTAGATTGTACTGG - Intergenic
1153200638 18:2644051-2644073 TCATGGTGCTTACATTCTATAGG - Intergenic
1153783654 18:8515622-8515644 GCTTTGTGCTTTCATTCTACTGG - Intergenic
1154081544 18:11262268-11262290 TCCTTGTGCTTATATTGTACTGG - Intergenic
1156595887 18:38547154-38547176 TCTTTGTGGTTTCATTGTAGAGG + Intergenic
1157211674 18:45748150-45748172 TCCTCTTACTTCCATTGTACAGG + Intronic
1167371425 19:49084934-49084956 TGCTAGGGCTTACATTGTACTGG - Intergenic
931297319 2:60940655-60940677 TCTTCATTCTTACATATTACAGG + Intronic
934664682 2:96161903-96161925 TCTTGGTTCTTACATTGTAATGG + Intergenic
934895197 2:98112629-98112651 TCTTTGTACATACATTGCACTGG + Intronic
941858295 2:170252599-170252621 TCTTGGAGCTTACATTCTAGAGG + Intronic
943096441 2:183435269-183435291 TCTTCTTGCTTAAATTGGGCAGG - Intergenic
944032327 2:195250441-195250463 TCTTCTGGCTTCCATTTTACAGG + Intergenic
1169172655 20:3477619-3477641 TCATGGAACTTACATTGTACTGG - Intronic
1169309177 20:4520836-4520858 TTTTATTGCTTTCATTGTACAGG - Intergenic
1171953608 20:31442456-31442478 TCTTGGAGCTTACCTTCTACTGG + Intronic
1175524760 20:59625970-59625992 TCTTAGTGCTTCTATTGTGCTGG + Intronic
1177477173 21:21638798-21638820 TCTTCTTGCTTTTATTGTAGAGG + Intergenic
1181733225 22:24862699-24862721 TCTCAGAGCTTACATTCTACTGG + Intronic
950943471 3:16918800-16918822 TCTTTGTGCTCACATAGCACTGG + Intronic
952422338 3:33143580-33143602 TCATGGAGCTTACATTCTACAGG + Exonic
955143524 3:56292984-56293006 TCATGGTGCTTACATTCTATTGG - Intronic
956206432 3:66759903-66759925 TCCTGGAGCTTACATTCTACCGG + Intergenic
961544127 3:127620345-127620367 TTTTTGCACTTACATTGTACAGG + Intronic
961826667 3:129602777-129602799 GCTTGGTGCTTACTGTGTACTGG + Intronic
962072659 3:132047684-132047706 TCTTCTTGTTTCCATTCTACTGG - Intronic
966749453 3:183308144-183308166 TCATGGAGCTTACATTCTACTGG - Intronic
969831792 4:9803709-9803731 TCTTAGTGCTGACATTCTATGGG - Intronic
970998210 4:22292195-22292217 TCTGCTTGCTTACATTCAACAGG - Intergenic
972832240 4:42827513-42827535 ACATAGTGTTTACATTGTACAGG + Intergenic
972924824 4:43990894-43990916 TCTTAGTGCTTACATTGGTTGGG + Intergenic
981181638 4:141752575-141752597 TCCTTGTGCTTACATTATAGAGG + Intergenic
981874903 4:149530297-149530319 TCCTGAAGCTTACATTGTACTGG - Intergenic
983065494 4:163205696-163205718 TCTTGGAGCTTACATTTTAGAGG - Intergenic
986203771 5:5603314-5603336 TCTTGATGCTTATATTGTGCAGG + Intergenic
986501933 5:8409816-8409838 TCTTGGGGCTTACATTCTAGTGG - Intergenic
986886269 5:12240422-12240444 TCATGGTGCTTACATTTTACTGG + Intergenic
988997629 5:36729631-36729653 TCTAACTGCTTCCATTGTACAGG - Intergenic
989011144 5:36875193-36875215 TCTTAGAGCTTACATTGCACTGG + Intergenic
990376827 5:55178586-55178608 TCTTGGAGCTTACAATATACTGG - Intergenic
992187348 5:74257173-74257195 TCTTCCTGCTTACATGGCAGAGG - Intergenic
992849982 5:80797269-80797291 TCTTCATGCTTACAGTCCACTGG - Intronic
995230183 5:109752484-109752506 TCTTGGAGCTTACATTCTAATGG + Intronic
995387552 5:111604561-111604583 TCTTCTTCATTACTTTGTACTGG + Intergenic
1003476609 6:6489416-6489438 TCTTCCTGCTTATACTTTACTGG - Intergenic
1008891878 6:56503408-56503430 TTTTCGTGGGTACATTGTAGGGG - Intronic
1009323575 6:62321543-62321565 TCTTGGTGTTTACATTCTATGGG - Intergenic
1009994134 6:70880188-70880210 TCTTAGTTCTTAGAATGTACAGG - Intronic
1011166297 6:84451046-84451068 TCTTGGAGCTTACATTTCACTGG - Intergenic
1012018719 6:93888380-93888402 ACATCGAGCTTACATTCTACTGG + Intergenic
1016442024 6:144094442-144094464 TCTTGGGGCTTACATTATGCTGG - Intergenic
1017793371 6:157821205-157821227 TCTTCTTGCTTTCATGGTGCTGG + Intronic
1020452992 7:8341129-8341151 CCTTTGTGCTTACTTTCTACTGG + Intergenic
1021647197 7:22800071-22800093 TTATGGTGCTTACATTCTACAGG + Intergenic
1026318067 7:69244911-69244933 TCTGCGTGGTTTCATTGTGCTGG + Intergenic
1029231238 7:99070677-99070699 TCTTGATGCTTACATTCTAGTGG - Intronic
1036142372 8:6220122-6220144 TTTTGGAGCTTACATTCTACCGG - Intergenic
1037345178 8:17891096-17891118 TCTTCGTGCTTACATTGTACAGG - Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1042041824 8:64599681-64599703 TCTTGGTAATTACATTGTTCTGG + Intronic
1052321156 9:27169208-27169230 TCTAAGTTCTTACATTCTACAGG - Intronic
1054710346 9:68504748-68504770 TCCTGGTGCTTCCATTCTACTGG - Intronic
1057560965 9:96127417-96127439 TCTTGGCGCTTACATTCTAGAGG + Intergenic
1058827851 9:108791013-108791035 TCTTGGTGCTTAAATTCTAGAGG - Intergenic
1059545436 9:115171198-115171220 TCTTTGTGCTTACAATTTAAAGG + Intronic
1060868857 9:127022906-127022928 TCATGGTGCTTACCTTCTACAGG - Intronic
1186612324 X:11149543-11149565 TCTTTGCTGTTACATTGTACTGG + Intronic
1189163234 X:38832687-38832709 TCTTGGAGCTTACAGTGTAGTGG - Intergenic
1192219344 X:69186591-69186613 TCTTCCTGCTTACATTTTAGAGG + Intergenic
1193974566 X:88101469-88101491 TCATGGTGCTTACAGTGTATGGG + Intergenic
1194130737 X:90078791-90078813 TCTCCGAGATTATATTGTACAGG - Intergenic
1194752306 X:97698575-97698597 TCATGGAGCTTACATTCTACTGG - Intergenic
1196387134 X:115169214-115169236 TCTTGGTGCTCACAATGTAGTGG - Intronic