ID: 1037348978

View in Genome Browser
Species Human (GRCh38)
Location 8:17929075-17929097
Sequence ATGTATTATTGGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 352}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037348978 Original CRISPR ATGTATTATTGGAAGGAAGA GGG (reversed) Intronic
901700473 1:11042563-11042585 ATGAATGGTTGGAAGGATGAGGG + Intronic
902949317 1:19869505-19869527 ATGTATGATTGGTAGAAAAATGG - Intergenic
904929001 1:34071597-34071619 ATGACTTAGTGGAAGGTAGATGG - Intronic
905456991 1:38095058-38095080 ATGAATTATAGAAAGGAAGAGGG + Intergenic
905600723 1:39248186-39248208 ATGTTTTAGTAGAAAGAAGACGG - Intronic
906740053 1:48173683-48173705 ATGAAATAATGGAATGAAGATGG - Intergenic
906822432 1:48943704-48943726 AATTATAATTGGAATGAAGAGGG + Intronic
906866522 1:49427066-49427088 ATTTATTTTTTGAAGTAAGAAGG + Intronic
907511926 1:54967904-54967926 ATATTTTATTGAAAGTAAGATGG - Intergenic
910094311 1:83503022-83503044 ATTTTTTAATGGAAGGGAGAGGG + Intergenic
911429071 1:97760263-97760285 CTGTATATTTGGAATGAAGATGG - Intronic
911684508 1:100759404-100759426 GTTTGTTATGGGAAGGAAGAAGG + Intergenic
914403969 1:147351370-147351392 ATGTATGCATGAAAGGAAGAGGG - Intergenic
915050179 1:153061188-153061210 ATATATTATTTGAATGAAGTGGG + Intergenic
915732936 1:158066996-158067018 ATGTTTTATGGGAAGGACAATGG - Intronic
916665865 1:166967021-166967043 TTCTATTACTGAAAGGAAGAAGG - Intronic
918569520 1:185972345-185972367 GTGTATCACTGGATGGAAGAAGG - Intronic
919123705 1:193371600-193371622 ATGGGTTAATGGATGGAAGAGGG + Intergenic
919340199 1:196296448-196296470 ATATATTACTGGAAGGAATTTGG + Intronic
921099536 1:211916429-211916451 ATGGATTATTGGATGGAAACTGG - Intergenic
922058671 1:222066411-222066433 ATGTATTTTAGGAAGGCAAATGG - Intergenic
922625217 1:227033724-227033746 ATTTATTATGGGAGGCAAGAGGG - Intronic
923022576 1:230176138-230176160 ATCGTTGATTGGAAGGAAGAAGG + Intronic
923022585 1:230176203-230176225 ATCATTGATTGGAAGGAAGAAGG + Intronic
923601691 1:235409234-235409256 ATGTGTAATTGGTAGGCAGAAGG + Intronic
924373123 1:243375996-243376018 ATGCATTTTTGTTAGGAAGATGG - Intronic
1062973833 10:1668761-1668783 ATTTATTAATGGAAGGAGAAGGG + Intronic
1063049233 10:2428252-2428274 ATGTATTATTGGGAGGAAACAGG + Intergenic
1063161886 10:3424354-3424376 AGGTATTACAGGAAGGAAAATGG - Intergenic
1063797957 10:9534353-9534375 ATTTCTAATTGGAATGAAGATGG + Intergenic
1063919574 10:10918943-10918965 ATGTATTCTTGGAACGAGAAGGG - Intergenic
1064493554 10:15884938-15884960 TTGTATTTTTGGTAGGAAAACGG + Intergenic
1065335036 10:24648465-24648487 ATGTATTTTTAAAAAGAAGATGG - Intronic
1065799790 10:29341746-29341768 ATCTCATATTGGAAGGCAGAAGG - Intergenic
1066377222 10:34868291-34868313 GAATATTATTGGAAGGAATATGG + Intergenic
1067092707 10:43277431-43277453 CTTTATGATGGGAAGGAAGAAGG - Intergenic
1068270055 10:54710851-54710873 TTTTATTCCTGGAAGGAAGATGG + Intronic
1068565370 10:58568779-58568801 GTGGGTTATTGGAAGAAAGAAGG + Intronic
1070109221 10:73466386-73466408 ATGTAATATGGGAAGGATGGAGG - Intronic
1070578233 10:77696852-77696874 TTGTATTATTAGTAGAAAGAGGG + Intergenic
1071444911 10:85736450-85736472 AGGTAGTATTGGAAGGCAAAAGG + Intronic
1072188881 10:93064953-93064975 AGGTGATTTTGGAAGGAAGAAGG - Intronic
1072257928 10:93638529-93638551 ATTTCTTATTTAAAGGAAGAAGG + Intronic
1072386936 10:94940325-94940347 ATTTAGTAATGGTAGGAAGAAGG + Intronic
1073011251 10:100361492-100361514 ATGTATGAATGTAAGGATGAGGG + Exonic
1074522258 10:114236612-114236634 ATATATGACTGGAAGGGAGACGG - Intergenic
1075004974 10:118823523-118823545 AGGTTCTGTTGGAAGGAAGATGG + Intergenic
1075412303 10:122237563-122237585 ATTTATAAGTGGCAGGAAGAGGG - Intronic
1075640602 10:124061610-124061632 AAGTAAAATTGGAAGCAAGATGG - Intronic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077888073 11:6400908-6400930 AAGAAGTATTGGAAGGCAGAGGG + Intronic
1079462736 11:20698380-20698402 ATGTACTATTTGATGGCAGAAGG - Intronic
1079685519 11:23354503-23354525 ATGTACTATTAGTAGGAACATGG - Intergenic
1083087966 11:60169553-60169575 ATTTATTATTGTAAGGAAAGTGG - Intergenic
1083845137 11:65327361-65327383 ATGTATTTTTGACAGAAAGAGGG - Intergenic
1084753231 11:71218022-71218044 TTGTATTTTTAGAAGAAAGAGGG + Intronic
1085383213 11:76139346-76139368 ATGTATTATTTGAATAATGAGGG + Intronic
1085994011 11:81888767-81888789 AATGAGTATTGGAAGGAAGAAGG - Intergenic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1088299421 11:108340292-108340314 AAATAATATTGGAAGGAAGTTGG - Intronic
1088799368 11:113291218-113291240 ATGTGTGATTTGAAGGCAGAAGG + Intergenic
1091348221 11:134870221-134870243 ATATATTTTTGGGAGGAAGGGGG + Intergenic
1093772124 12:23030396-23030418 AGGTATTATTGGAAGGTTCAGGG + Intergenic
1095644704 12:44529801-44529823 AAGTGTCACTGGAAGGAAGAAGG + Intronic
1096511696 12:52133567-52133589 ATGTATAATTGGGATTAAGAGGG + Intergenic
1097070446 12:56350716-56350738 AGGTAGGATTGGAAGGAGGAAGG + Intronic
1097397301 12:59091562-59091584 ATGTATTCTAGGATAGAAGAAGG + Intergenic
1097682815 12:62665010-62665032 ATATATTTTTGGAAGGCAAAGGG + Intronic
1098515537 12:71372395-71372417 CTGCATTATTGGAATAAAGAAGG - Intronic
1098553445 12:71791476-71791498 GTTTTTTATTGGAGGGAAGAAGG + Exonic
1098700525 12:73618862-73618884 ATGTATGAATGGAAGGAGAAAGG - Intergenic
1099005068 12:77225953-77225975 ACCTAATATGGGAAGGAAGAAGG - Intergenic
1099212130 12:79804156-79804178 AGGGGTTATTGAAAGGAAGAAGG - Intronic
1100285629 12:93163815-93163837 ATGTATTTTAGGAAGTATGAAGG - Intergenic
1101467136 12:104959618-104959640 AAGTATAATTGCAAGGAATATGG + Intergenic
1103402344 12:120651514-120651536 AGGTATTATTTAAAGGAAGAGGG + Intronic
1104813936 12:131635130-131635152 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104813964 12:131635300-131635322 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104917841 12:132275202-132275224 ATGTTTTATGGGAAGGAGGAGGG - Intronic
1105809980 13:23986410-23986432 ATGTGTTATCTGCAGGAAGAGGG + Intronic
1106708434 13:32306279-32306301 ATGAGTAATTGGAAGAAAGAAGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107094163 13:36516678-36516700 AGTTATTATTGGAAGGAAAGTGG - Intergenic
1107220673 13:37975592-37975614 ATGTACTTTTAAAAGGAAGAGGG + Intergenic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1107645024 13:42485278-42485300 ATGTATTATTACAGAGAAGAAGG - Intergenic
1108215408 13:48178933-48178955 ATCTATTCTTGAAAGGTAGAAGG - Intergenic
1108281246 13:48864446-48864468 TAGTAATATTGGAAGGCAGAGGG - Intergenic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1109168994 13:59073100-59073122 ATGTATGATTAGTAAGAAGAAGG - Intergenic
1110509855 13:76336696-76336718 ATGTATAATTGGAAGAATGCTGG - Intergenic
1110869872 13:80438265-80438287 TTGTAATATTGGAAGGCAGGAGG + Intergenic
1111406409 13:87812471-87812493 TTTTATTTTTGGAAGAAAGATGG + Intergenic
1112675211 13:101693501-101693523 ATGTCTTATTGGAGGGTGGAGGG + Intronic
1113573905 13:111381514-111381536 ATTTATTAGTTGAAGGAATAAGG + Intergenic
1113625504 13:111793298-111793320 AGATATTTTTGAAAGGAAGAAGG - Intergenic
1116106928 14:40520637-40520659 AGGGGTTATTGGCAGGAAGAAGG - Intergenic
1118033241 14:61838765-61838787 CTATGTTATTGGAAGGGAGAAGG + Intergenic
1120607831 14:86601721-86601743 ATTAATAATTGGAAGAAAGAGGG - Intergenic
1122379325 14:101290382-101290404 GGGTATTAATGGAAAGAAGACGG + Intergenic
1122748720 14:103917359-103917381 CTGGACTATGGGAAGGAAGATGG + Intronic
1124227993 15:27912640-27912662 ATGTATTAATAGAAGCAATAAGG + Intronic
1124725263 15:32150929-32150951 ATGTGTTTTTGGAAGTAAGGGGG + Intronic
1125088906 15:35767726-35767748 ATGTATTATGGAAGAGAAGAGGG - Intergenic
1126683254 15:51224652-51224674 ATGACTAATTGGAAGGAAGCAGG - Intronic
1126713075 15:51483345-51483367 ATGTAGGCTTGGAATGAAGACGG - Intronic
1127597829 15:60504372-60504394 TTGTATTTTTGGTAGGAACAGGG - Intronic
1127731430 15:61805801-61805823 ATGTAATTTTGGGAGGAAGTAGG + Intergenic
1128100408 15:64994111-64994133 AAGTTTGATTGGAAGCAAGAAGG - Intergenic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1128518954 15:68362821-68362843 ATGAATTAGTGGATGGATGATGG + Intronic
1128847115 15:70908925-70908947 TTGTATGATTAGAAGCAAGATGG + Intronic
1129100760 15:73260696-73260718 TTGCATTTTTGGAAGGAATAGGG + Intronic
1130033691 15:80339414-80339436 CTGTCTACTTGGAAGGAAGAAGG + Intergenic
1130311094 15:82755054-82755076 ATGAATGTTTGGAAGGAAGTAGG + Intergenic
1130569585 15:85029541-85029563 ATGTATATTTGGGAAGAAGATGG - Intronic
1130667442 15:85881568-85881590 AAGGAGTAGTGGAAGGAAGAGGG - Intergenic
1130721653 15:86392558-86392580 ATATATTGTTGAAAGAAAGAAGG + Intronic
1133719805 16:8484256-8484278 TTGTCTTAGTGGAAGGAACAAGG + Intergenic
1134374375 16:13657797-13657819 GTGCATTTTTGGAAGTAAGAAGG - Intergenic
1134410082 16:13996479-13996501 ATGGATGAATGGAAGAAAGAAGG - Intergenic
1134731662 16:16467431-16467453 ATCTATTATTGGTTGGAGGAAGG + Intergenic
1134935788 16:18244572-18244594 ATCTATTATTGGTTGGAGGAAGG - Intergenic
1137287024 16:47024891-47024913 ATTTATTATTGGCAGGAAGAGGG - Intergenic
1137306806 16:47208863-47208885 TTGTACTCATGGAAGGAAGATGG - Intronic
1137942768 16:52704919-52704941 TTTTATTTTTGGAAGGAAGGTGG - Intergenic
1139457208 16:67090479-67090501 ATGTCTTTTGTGAAGGAAGATGG + Intronic
1139918515 16:70443254-70443276 ATGTATTTTTAGTAGGGAGAGGG - Intergenic
1139931980 16:70535023-70535045 ATGTATTATAGGTCTGAAGATGG + Intronic
1141254448 16:82387553-82387575 ATAGACTTTTGGAAGGAAGAAGG - Intergenic
1141421528 16:83920982-83921004 ATGGATGGGTGGAAGGAAGATGG + Exonic
1141421561 16:83921126-83921148 GAGTTTTAATGGAAGGAAGATGG + Exonic
1141562647 16:84879769-84879791 CAGGATTATGGGAAGGAAGAAGG - Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143397127 17:6609733-6609755 ATGTGTGATTGAATGGAAGATGG - Intronic
1145184984 17:20786286-20786308 ATGTATGAATGTAAGGATGAGGG + Intergenic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146908585 17:36633452-36633474 ATCTGTTCTTCGAAGGAAGAGGG - Intergenic
1147259219 17:39198634-39198656 TGGTATTATTGGGAGGATGAGGG + Intergenic
1148056996 17:44805110-44805132 ATACATTATCAGAAGGAAGATGG + Exonic
1148235987 17:45969479-45969501 ATGTATAATTGGATGGATGATGG - Intronic
1148236005 17:45969586-45969608 ATGGATGATAGGAAGGATGAAGG - Intronic
1148236024 17:45969689-45969711 ATGGATGATAGGAAGGATGAAGG - Intronic
1150504038 17:65680507-65680529 GTGAATTAATGGGAGGAAGAAGG - Intronic
1151116948 17:71747065-71747087 AAGCATTAATGAAAGGAAGATGG - Intergenic
1151428790 17:74048788-74048810 ATGAATGAATGAAAGGAAGAAGG + Intergenic
1153864319 18:9249590-9249612 ATCTGTTGTGGGAAGGAAGACGG - Intronic
1156519287 18:37708066-37708088 AAGTATGACTGGAAGGGAGAAGG - Intergenic
1156750275 18:40444907-40444929 ATATATTCATGGAAGGGAGATGG + Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1157049998 18:44152543-44152565 ATTTATTTTTGGAAGGATGGTGG + Intergenic
1157883955 18:51348322-51348344 ATGTCTTTTTGGTAGGAAAATGG + Intergenic
1158287105 18:55895898-55895920 TTGTAATATAGGATGGAAGAAGG + Intergenic
1158804394 18:60952076-60952098 ATCTATCACTGGAAGGAAAAAGG + Intergenic
1159580209 18:70227071-70227093 TTGTGCTATTGGAAGCAAGATGG - Intergenic
1159663856 18:71132602-71132624 ACCTAATATTGGAAGGAAAAAGG + Intergenic
1159680560 18:71346098-71346120 ATGTATAATTGGAGTGAAGATGG - Intergenic
1160695340 19:481276-481298 AAGTATGATGGGAAGGATGATGG + Intergenic
1161817239 19:6506942-6506964 TTGTATTATTGGTAGGGACAGGG + Intergenic
1161874251 19:6895357-6895379 TTCTATTATTATAAGGAAGAGGG + Intronic
1163092279 19:15028865-15028887 ATTTATTTTTTGATGGAAGAAGG + Intergenic
1164279958 19:23760362-23760384 AGGCTTTATTAGAAGGAAGAGGG + Intergenic
1164309210 19:24031451-24031473 AGGCTTTATTGGAAGGAAGAGGG + Intergenic
1168332036 19:55576230-55576252 ATGTTTGATTTGAATGAAGATGG - Intergenic
925648324 2:6061311-6061333 TTGTACTATTGGAAGGAAGGAGG + Intergenic
925727889 2:6892133-6892155 ATGTATTTTTGGATGGCAGATGG - Intronic
926961375 2:18362046-18362068 TGGAATTATTGGAAGGGAGATGG + Intergenic
927404835 2:22755061-22755083 CTGTATTTTTGGGAAGAAGAGGG - Intergenic
927942480 2:27113782-27113804 ATGAACTCTTGGAAGGAAAAAGG - Intronic
928691154 2:33800345-33800367 GTATAATTTTGGAAGGAAGAAGG - Intergenic
930410433 2:51018442-51018464 AACTATTATTGGAAAGAAGTGGG - Intronic
930441150 2:51408048-51408070 ACGTATTAGTGTAAGGAATATGG - Intergenic
930455014 2:51596841-51596863 ATGTTTTCTCTGAAGGAAGATGG - Intergenic
930614813 2:53582611-53582633 AGGTTTTATTAGCAGGAAGATGG - Intronic
931079810 2:58756014-58756036 TTGTATTATTGAAAGAAATATGG + Intergenic
931151778 2:59582334-59582356 ATGTATTATTAGTAGAAACAGGG - Intergenic
931494704 2:62790540-62790562 ATGTATTATTAAAAGAAATAAGG + Intronic
933526237 2:83443608-83443630 ATTTTTTATTGGAGGGGAGATGG - Intergenic
934046613 2:88178035-88178057 ATCTACACTTGGAAGGAAGAGGG - Intronic
936895154 2:117419309-117419331 ATATATTATCAGATGGAAGATGG - Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937171203 2:119871268-119871290 AAGTGTTTTTGGAAGGCAGATGG + Intronic
937755866 2:125538139-125538161 AAGGAGTAATGGAAGGAAGATGG + Intergenic
937911213 2:127076442-127076464 ATGCATGCTGGGAAGGAAGAGGG - Intronic
942468487 2:176233846-176233868 CAGTATTATTGCAAGGAAGAAGG + Intergenic
943441720 2:187934196-187934218 ATCTATTCTTAGAAGCAAGAAGG - Intergenic
943569244 2:189553585-189553607 ATGTATTTGTGTAAAGAAGAAGG - Intergenic
944478240 2:200128427-200128449 ATGTACCATTTTAAGGAAGATGG - Intergenic
945600075 2:211850648-211850670 ATGTATGATTAGAAGGAGCAAGG + Intronic
945752151 2:213801057-213801079 ATGTATTATTGAAATGTATATGG + Intronic
946623039 2:221579357-221579379 ATGTGTTATTTGAAGTAAGAAGG + Intergenic
947059505 2:226146816-226146838 ATTTTTTATTGAAAGTAAGATGG + Intergenic
947298111 2:228655866-228655888 ATTTATTTTTGGGAGCAAGATGG - Intergenic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948277474 2:236720102-236720124 ATGGATTAATGGAAGGGAGGGGG + Intergenic
1169589767 20:7127506-7127528 AGGTGTGATTGGAAGGAAAATGG + Intergenic
1169596333 20:7203881-7203903 ATGTTTTATGGCAAGGAAAATGG - Intergenic
1170532214 20:17305424-17305446 AGGGATGATTGGAGGGAAGAAGG + Intronic
1174763951 20:53234206-53234228 ATGTTTTATTGGAAAATAGAAGG + Intronic
1175165301 20:57039278-57039300 ATGGATGATTGGATAGAAGATGG + Intergenic
1175754158 20:61518807-61518829 ATGGATTAATGGATGGATGATGG - Intronic
1177083360 21:16670129-16670151 ATGTATTAATGTAAGGAAATTGG + Intergenic
1177229616 21:18302755-18302777 ACGTATTTTTGGTAGGAAGGAGG - Intronic
1177534505 21:22406439-22406461 ATGTATTTTTGGTAGACAGATGG + Intergenic
1178278118 21:31257608-31257630 ATGGATTGATGGAAGGAAGATGG - Intronic
1178348201 21:31850286-31850308 TTGTATTATTGGTATGAAGTAGG + Intergenic
1178962766 21:37082739-37082761 ATGTACTGTTGGGAGGAAAAAGG - Exonic
1179005806 21:37513046-37513068 ATGCAGTACTGTAAGGAAGAGGG + Intronic
1181842995 22:25681272-25681294 ATGTATTATTCAAATGATGACGG + Intronic
1181873665 22:25923152-25923174 ATGTGCTATTGGAAAGAATATGG + Intronic
1182074538 22:27486966-27486988 ATGTTTTATTGGATAGAAGCAGG + Intergenic
1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG + Intronic
1183847176 22:40551866-40551888 ATGAATTTATGGAAGGAATAGGG + Intronic
1184993171 22:48184183-48184205 ATGGGTTAATGGAAGAAAGAAGG - Intergenic
949796153 3:7853518-7853540 AAGCATTATTGGAAGGATTATGG + Intergenic
950354073 3:12388763-12388785 ATGAATTATTTAAAGGAAGAGGG + Intronic
951093485 3:18601507-18601529 ATATCAAATTGGAAGGAAGAGGG + Intergenic
951169869 3:19528612-19528634 ATATATACTTGGAATGAAGATGG + Intronic
951746415 3:25982611-25982633 ATGTATTATGGGAAAGAAAGTGG - Intergenic
951760745 3:26144770-26144792 AAGCCTTATTGAAAGGAAGAAGG - Intergenic
951804452 3:26629268-26629290 ACCTAAAATTGGAAGGAAGAAGG - Intronic
953648198 3:44774650-44774672 ATTTATTATTGCTAGTAAGAGGG + Intronic
954832482 3:53434296-53434318 ATGTACACTTGGAATGAAGAGGG + Intergenic
955030825 3:55215685-55215707 ATGAATTATTTGAAGCAAGTTGG + Intergenic
955713508 3:61804477-61804499 ATGTACCATTGGAATAAAGAAGG - Intronic
956556473 3:70528789-70528811 ATGTAGGATTGGAAAAAAGATGG - Intergenic
957210517 3:77251993-77252015 ATTTATAATTGGAAGCAAAATGG - Intronic
959008124 3:101043609-101043631 ATGTGTTTTTGGAAGGGATAAGG - Intergenic
959110377 3:102115768-102115790 ACGTACTCTAGGAAGGAAGAAGG + Intronic
960465226 3:117989756-117989778 AAATATTTATGGAAGGAAGAAGG + Intergenic
960879745 3:122332327-122332349 AAGTATGTTTTGAAGGAAGAAGG - Intronic
963117663 3:141745728-141745750 ACGTATTTTTGGCAGGGAGAGGG + Exonic
964017883 3:151969647-151969669 ATTTATTACAGGAAGGAAAAAGG - Intergenic
964509981 3:157439328-157439350 AAGTATTATTGGATGTAATAAGG - Intronic
965760868 3:172074875-172074897 TTTTGTTATTGGAAGGAAGTTGG - Intronic
966359261 3:179116854-179116876 ATGTATTTTTGGAATTAAAAAGG + Intergenic
966514640 3:180805101-180805123 TTGTCTTCTTGGAAAGAAGAGGG + Intronic
967284824 3:187858803-187858825 ATGTTTTAAAGGAAGGCAGATGG + Intergenic
967763983 3:193257394-193257416 ATGTTTTATTGCAGGGAAGATGG + Intronic
968930859 4:3577981-3578003 ATGTATGATAGGATGGAAGCTGG - Intronic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
970537665 4:17045702-17045724 AGGTATTACTGGAAAGTAGATGG + Intergenic
972168128 4:36312006-36312028 ATCTCTAATAGGAAGGAAGATGG + Intronic
973665923 4:53159355-53159377 ATGTATATTTTGAAGAAAGATGG - Intronic
973847140 4:54924383-54924405 ATGAATTTTTGGAAGCCAGAGGG - Intergenic
974030771 4:56774303-56774325 AGTTATAAGTGGAAGGAAGAAGG - Intergenic
974140336 4:57878569-57878591 ATGTATGATTGGGAGGAGCATGG + Intergenic
975907887 4:79236906-79236928 AAGTATTATTGACAGGAAGATGG + Intronic
976580970 4:86736853-86736875 ATATATTATTAGAAGGAGTAGGG - Intronic
976922445 4:90456254-90456276 ATCTATTCTTAGAAGCAAGAAGG - Intronic
976979347 4:91207132-91207154 ATATATCATTGGATAGAAGAAGG + Intronic
977383987 4:96314744-96314766 ATTCATTTTTGGAAAGAAGATGG + Intergenic
977759331 4:100712389-100712411 ATGTATTAGTGCAACCAAGAAGG - Intronic
980137536 4:128873110-128873132 CTGTACTATTGGAAGCCAGATGG - Exonic
980215240 4:129844336-129844358 ATATATTATTGGAAGAAACTGGG + Intergenic
980700377 4:136419888-136419910 GTGTATAGTTGGAAGGAACAGGG + Intergenic
981822439 4:148901550-148901572 AGGTACTACTGGAAGGAAGCAGG - Intergenic
981849689 4:149215217-149215239 ATGTATCATTGGAGATAAGAGGG - Intergenic
982332220 4:154193275-154193297 CTGCATTATTTGAAGGATGAAGG - Intergenic
983432377 4:167667570-167667592 ATACATTATAGGAAAGAAGAAGG - Intergenic
983465803 4:168087896-168087918 ATCTTTCATTGGAAGGAGGACGG + Intergenic
983650446 4:170031559-170031581 ATGGATTATTGGCAGGAGAAAGG + Intronic
984303258 4:177951876-177951898 ATGTCATATTTCAAGGAAGAAGG - Intronic
985106929 4:186509317-186509339 GTGATTTGTTGGAAGGAAGAAGG + Intronic
986884518 5:12216804-12216826 TTGTATTATTGGTAGGGACAGGG - Intergenic
988244235 5:28657751-28657773 GTGTATTATTTGAACCAAGAGGG + Intergenic
988421798 5:31014609-31014631 TTGTATTATTGGCATGAACAAGG + Intergenic
989785967 5:45329961-45329983 ATATGTAATTGGAAAGAAGATGG - Intronic
989824814 5:45840288-45840310 TTGTCTTTTTGGGAGGAAGATGG + Intergenic
991287199 5:64991058-64991080 AGATATCATTGTAAGGAAGAAGG + Intronic
991492691 5:67198288-67198310 ATGTCTTATTTGAAGCAAGGTGG - Intergenic
993088018 5:83387979-83388001 ATGAGTTATGGGAAGGAAAAAGG - Intergenic
993133299 5:83926168-83926190 ATGTGTGATAGGAAGGGAGAGGG + Intergenic
994114572 5:96047877-96047899 AAGTCTGATTTGAAGGAAGAAGG + Intergenic
994319848 5:98381439-98381461 AGGTTTGATTGGAAGGGAGAAGG - Intergenic
994639580 5:102390165-102390187 ATGTATTTTTGAATGGGAGAGGG - Intronic
994847726 5:105011421-105011443 AAGCATTATTGGATGGAGGAAGG - Intergenic
995006272 5:107199769-107199791 ATATATAAAAGGAAGGAAGAGGG + Intergenic
995098508 5:108269670-108269692 ATATATTGTTGGAAGGAAGGTGG - Intronic
998704996 5:144748975-144748997 ATGAATGATTGAAAGGATGATGG - Intergenic
999643394 5:153694743-153694765 ATGTATTATTTTAAAAAAGAGGG - Intronic
999864694 5:155687963-155687985 ATATATTATTGGAAGGATGAGGG + Intergenic
1000071039 5:157741278-157741300 ATGTATTTTTGAAAGGGTGATGG + Exonic
1000844514 5:166262710-166262732 ATTTATCATTTGAAGGTAGAAGG - Intergenic
1002123265 5:177022292-177022314 ATGTATTATTAGCAGTAATATGG + Intronic
1004649497 6:17595022-17595044 ATGTATTTTTGCAAGGTAGAAGG - Intergenic
1005236053 6:23763593-23763615 ATGTATTTTTGGTAGCAACATGG + Intergenic
1005499886 6:26420687-26420709 ATTTTTTTTTGGAGGGAAGAGGG + Intergenic
1005765732 6:29010149-29010171 AAAGATTATTGGAAGGAAAATGG - Intergenic
1005918673 6:30378337-30378359 AAGTATTAGGGGCAGGAAGAGGG + Intergenic
1008784270 6:55146480-55146502 ATGCCTTATTGGAAAGAAGTTGG + Intronic
1009035596 6:58114221-58114243 ATGTCTGATTGTAAGGCAGAGGG - Intergenic
1009856363 6:69269884-69269906 TTGTAATATTTGATGGAAGAAGG - Intronic
1010168453 6:72945001-72945023 ATTTTTTTTTGGAAGGATGAGGG - Intronic
1010380806 6:75222781-75222803 ATGTAATCTTGGAAAGAATAAGG - Intergenic
1011421812 6:87181140-87181162 CTGCTTTATTGCAAGGAAGAGGG + Intronic
1011582117 6:88880204-88880226 ATGAATGAATGAAAGGAAGAAGG + Intronic
1011829433 6:91353425-91353447 GGGTATTATTGGAGGGAAGAGGG - Intergenic
1014292153 6:119571100-119571122 ATGGATTATTGGCAGAATGAAGG + Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1015220310 6:130796629-130796651 AAATATTAAGGGAAGGAAGAGGG - Intergenic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016407392 6:143744738-143744760 AGGGATTGTTGGAAGTAAGATGG + Intronic
1016475253 6:144420190-144420212 ATCTATTATTGACAGGAAGTGGG + Intronic
1016739858 6:147515417-147515439 ATGGATGGTTGGATGGAAGACGG - Intronic
1017020881 6:150139390-150139412 ATGAAATATTGGAATGAAAATGG + Intergenic
1017732058 6:157325337-157325359 ATGTATGAGGGGAAGGAAAAAGG - Intergenic
1018691995 6:166353822-166353844 AGGAATTATTGGAACAAAGATGG - Intergenic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1020594886 7:10194205-10194227 ATATATTATTTAAAGGAAAAAGG - Intergenic
1020738006 7:11976200-11976222 ATCTACTATGGGAAGGAGGAAGG - Intergenic
1021462966 7:20909847-20909869 AAATATGATTGGTAGGAAGAGGG - Intergenic
1021993508 7:26158423-26158445 AAGAATTGATGGAAGGAAGATGG - Intronic
1022264495 7:28740801-28740823 ATGAATTATTTGAAAGAAAAAGG + Intronic
1022300775 7:29100221-29100243 ATGTAGTTTAGGAAGGAAGTGGG - Intronic
1022827698 7:34033112-34033134 AAGAATTTTTGGAAGGAGGATGG + Intronic
1022967973 7:35491705-35491727 TTCTATTATTGGAAAGAAGCAGG - Intergenic
1023475076 7:40568714-40568736 ATTTATTATTAGAAAGATGATGG + Intronic
1025854491 7:65265556-65265578 AGATTTTATTAGAAGGAAGAGGG + Intergenic
1026334133 7:69379238-69379260 AAGGATTATTGGAAGGTACAGGG - Intergenic
1026450037 7:70520587-70520609 ATTTTTTATTGGCTGGAAGAAGG - Intronic
1026480605 7:70775950-70775972 ATGAATTGTTGGACAGAAGATGG + Intronic
1026567129 7:71498502-71498524 ATGTAATATTGGAAAGAAACAGG + Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1028759847 7:94483709-94483731 CTGTAGTATTGGAAGGAATGGGG - Intergenic
1031962682 7:128004075-128004097 ATGTATTTGTGGGAGGAAGATGG + Intronic
1032444819 7:131973161-131973183 ATGTATCACTGGAAGGAAGCTGG + Intergenic
1033058289 7:138080213-138080235 ATGGATTATTGGAAGGCTGATGG - Intronic
1033218033 7:139508301-139508323 ATGAATTTGTGGAAGGAAGAAGG + Intergenic
1033784470 7:144714122-144714144 AAGTCTTGTTGAAAGGAAGAAGG - Intronic
1035970806 8:4246161-4246183 ATGGAATATTGGAAGAAAGAGGG - Intronic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1037348978 8:17929075-17929097 ATGTATTATTGGAAGGAAGAGGG - Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1038317122 8:26495193-26495215 ATGTAATATTTGAGGGTAGAGGG + Intronic
1038757920 8:30359209-30359231 TTGGGTAATTGGAAGGAAGAGGG - Intergenic
1040112709 8:43576807-43576829 AGGTTTTATTGGAAGGTATATGG - Intergenic
1041031160 8:53736606-53736628 TTTTATTATTTGAAGGAATAAGG - Intronic
1041593479 8:59619175-59619197 AGGTATCCTTGAAAGGAAGATGG + Intergenic
1041797948 8:61766235-61766257 AAGTAATATAGGAAGGAAGTAGG + Intergenic
1042578783 8:70253104-70253126 ATTTATCCTTGTAAGGAAGAGGG + Intronic
1043007630 8:74839787-74839809 ATGTATCAATGGAAGAAAGAAGG - Intronic
1043381459 8:79706572-79706594 CTGGATTATTGGGAGGCAGAAGG - Intergenic
1043792536 8:84490630-84490652 ATTTATTAAAGGAAGGAAGTGGG + Intronic
1045869833 8:106912907-106912929 ATGTGTTATTAGAAGGAATTAGG + Intergenic
1046093312 8:109528624-109528646 ATGTAGAGTGGGAAGGAAGAAGG - Intronic
1046491695 8:114961081-114961103 ATGTATTCTTAGAAGAAAGATGG + Intergenic
1046701720 8:117408153-117408175 ATATATAAGTGGAAGGAAAAAGG + Intergenic
1048989208 8:139751459-139751481 AGCTAGTATTGGAAGCAAGAGGG - Intronic
1050116564 9:2269521-2269543 ATGATTTATTGGAAGAATGAAGG - Intergenic
1050858450 9:10392569-10392591 GTGTATTATTTGAAGGAATAAGG - Intronic
1051679360 9:19591600-19591622 CTGTATTCTTGGAAGGAGGAAGG - Intronic
1052261347 9:26519815-26519837 ATTTATTAGTGTAAGGAACATGG - Intergenic
1052548851 9:29921143-29921165 ATGTATTGTTGGAAGACTGACGG + Intergenic
1054459257 9:65453937-65453959 ATGTATGATAGGATGGAAGCTGG + Intergenic
1055730955 9:79278923-79278945 ATGAATTATTTGAAGGTAGATGG + Intergenic
1057454395 9:95194451-95194473 ATGCATTTTTGGTAGGAACATGG - Intronic
1059795885 9:117696287-117696309 ATGTGTTTTTGGAAGGAATGGGG - Intergenic
1060019948 9:120120546-120120568 TTTTATTACTGGAAGGAAAAAGG + Intergenic
1060700257 9:125745290-125745312 ATGGATTCTTGGAATGAAGCAGG - Intergenic
1061345207 9:130018485-130018507 GTCTTTTATTGCAAGGAAGAGGG - Intronic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1187727781 X:22221714-22221736 AACTATTATTGGAAGAAAGCTGG + Exonic
1188311468 X:28621932-28621954 ATATATTATTGGAATTAGGAAGG + Intronic
1188485055 X:30673367-30673389 ATGTGTTATTCCAAGAAAGAAGG + Intronic
1188979891 X:36717479-36717501 ATGTATTGTTGGAGGGAGCATGG + Intergenic
1189967710 X:46391583-46391605 ATATTTAATTGGAAGAAAGAAGG - Intergenic
1191163390 X:57360248-57360270 AGGAATTATTTGAAGAAAGAAGG - Intronic
1194706960 X:97187229-97187251 ATGTATTAGAGGAAGGAGTAGGG + Intronic
1197101696 X:122663493-122663515 ATGAAATATAGGAAGGCAGAGGG + Intergenic
1197971885 X:132122979-132123001 ATGGAGTATTGAAAGGAAAATGG - Intronic
1199322232 X:146454048-146454070 ATGTGTTATATGAAGGCAGAGGG - Intergenic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic
1199437271 X:147826855-147826877 AAGTATAATGGGAAGGAAGAGGG - Intergenic
1200013403 X:153138856-153138878 ATTTATTAGTGGAAAGCAGAGGG + Intergenic
1200026199 X:153261062-153261084 ATTTATTAGTGGAAAGCAGAGGG - Intergenic
1200463305 Y:3484274-3484296 ATGAGTTATTTGAAGGAACATGG + Intergenic
1201469293 Y:14316371-14316393 ATGTGTTATGGGATGGAAGTAGG + Intergenic
1201788241 Y:17808635-17808657 ATGTCCTCTTGGAAGCAAGATGG - Intergenic
1201813312 Y:18097353-18097375 ATGTCCTCTTGGAAGCAAGATGG + Intergenic
1201850332 Y:18472865-18472887 ATGAACTCTTGGAAGCAAGATGG + Intergenic
1201867754 Y:18673073-18673095 ATGTTTTCTTGGAAGCAAGGTGG - Intergenic
1201882986 Y:18847512-18847534 ATGAACTCTTGGAAGCAAGATGG - Intergenic
1201917383 Y:19196693-19196715 ATGGATTAATGGATGGATGATGG + Intergenic