ID: 1037349726

View in Genome Browser
Species Human (GRCh38)
Location 8:17938960-17938982
Sequence AGGTGTCTGAAGAAGATGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 465}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037349723_1037349726 -6 Left 1037349723 8:17938943-17938965 CCTCTTGCAAAACTGTCAGGTGT 0: 1
1: 0
2: 1
3: 8
4: 249
Right 1037349726 8:17938960-17938982 AGGTGTCTGAAGAAGATGGGAGG 0: 1
1: 0
2: 3
3: 37
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037349726 Original CRISPR AGGTGTCTGAAGAAGATGGG AGG Exonic
900313747 1:2047223-2047245 AGGTGCCTGGAGAAGCTGTGGGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904617837 1:31759559-31759581 AGGTGTCTGAAGGAGACTGAGGG - Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
906614206 1:47223896-47223918 AGGTATCTCACAAAGATGGGCGG - Intronic
907676061 1:56518991-56519013 AGGCTTCTAAAGAAGGTGGGTGG + Intronic
908413978 1:63894491-63894513 TGGTGTGTGAAGATGATGGGAGG - Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910276024 1:85449792-85449814 AGGTGGCAGATGAAGTTGGGAGG + Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911429925 1:97772885-97772907 AGATTTCTGAAGAGGATGGATGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
913041001 1:115023003-115023025 AGCTGTGTGAAGAAGATGACTGG + Intergenic
916126413 1:161575446-161575468 AGGAGTCAGAAGCAGAAGGGAGG - Intergenic
916136332 1:161657286-161657308 AGGAGTCAGAAGCAGAAGGGAGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917766187 1:178219910-178219932 AGGTGTCTGACTAATAGGGGCGG + Intronic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919061581 1:192640862-192640884 AGGTTCCTGAAGAAGAAGGAGGG - Intronic
919233480 1:194806780-194806802 AGGGTTCGGAAGAAGATAGGAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
921972480 1:221165326-221165348 AGGTCCCTGAACAAGATGGCAGG + Intergenic
922413417 1:225397470-225397492 AGGTCTCTGAAGAGAAGGGGTGG - Intronic
922697161 1:227736238-227736260 GGGTGTCTGGAGAAGATGGTGGG + Intronic
922856317 1:228777878-228777900 AGGTGGGTCAAGAAGATAGGAGG + Intergenic
923522360 1:234745315-234745337 AGGTGCCTGAGGAAAAGGGGAGG + Intergenic
924134762 1:240952563-240952585 AGTTGGCTGAAAAAGAAGGGGGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924875571 1:248099790-248099812 ATGTGTGTGAAGATGATTGGAGG + Exonic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064797347 10:19028279-19028301 ATGTGTCTATAGAAGATGAGGGG - Intergenic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065561384 10:26967598-26967620 AGGTGTCTGTAGACCATTGGAGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068433643 10:56963505-56963527 AGTTGTCTAAACAAGATTGGAGG - Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069852670 10:71420295-71420317 AGGTGTCTGGAGGAGAGAGGTGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071737068 10:88312526-88312548 AGGTGGGTGAAGAGGATGGAAGG + Intronic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072156084 10:92724968-92724990 GGGTGGCTGAAGAACTTGGGAGG - Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074242400 10:111652093-111652115 AGCTGCCTGAAGAGGCTGGGAGG - Intergenic
1074435269 10:113428697-113428719 ATTTGCCTGAAGAGGATGGGAGG + Intergenic
1076213528 10:128673534-128673556 AGGTGTCTGAGGAAAGTGGTAGG - Intergenic
1076674190 10:132139852-132139874 AAGGGACTGAAGAAGATGGCGGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077364570 11:2156365-2156387 AGCTGTCTGATGATGATGGTGGG - Intronic
1077801782 11:5546482-5546504 ATGTGTCGGGGGAAGATGGGAGG - Intronic
1078407284 11:11081414-11081436 AACTGTCTGGAGAAAATGGGAGG + Intergenic
1079958614 11:26894742-26894764 AGGGCTCAGAAGAAGATAGGAGG + Intergenic
1080088032 11:28310047-28310069 AGGTGTCAGTAGTTGATGGGGGG - Intronic
1080409661 11:32011658-32011680 AGGTGCTTGCAGAAGAAGGGAGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG + Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082734090 11:56837465-56837487 AGGTGGTTGAAGAAAAAGGGTGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1083311216 11:61784716-61784738 AGGTGTCTGCAGAAGCAGGAAGG + Intronic
1085726302 11:78957897-78957919 AGGAGTTTGAAGAAGATAAGAGG - Intronic
1086482312 11:87255213-87255235 AGGGGTCGGAAGAAGAGGGCAGG + Intronic
1088016641 11:105069158-105069180 AGGTGTCTCTGGAAGATGTGAGG + Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089789777 11:120934299-120934321 AGCTGTCTGAAAAAGAAGGGAGG + Intronic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091329852 11:134723825-134723847 AGATGTCTAAGGAAGATGGGTGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093910085 12:24737194-24737216 AAATGACTGAAGATGATGGGAGG + Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094299753 12:28949659-28949681 AGGTGTCACATGAAGAAGGGTGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096229018 12:49887296-49887318 AGGGCTGTGAGGAAGATGGGAGG + Intronic
1096426623 12:51509545-51509567 AGGTGGCAGGAAAAGATGGGAGG - Exonic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103500397 12:121397324-121397346 AGGTCTCTGAAGGAGGAGGGGGG - Intronic
1104292940 12:127485792-127485814 AGGTGACTGAAGGAGCAGGGGGG - Intergenic
1105377333 13:19857772-19857794 GGGAGGCTGAATAAGATGGGAGG + Intronic
1107626556 13:42291863-42291885 AGCTGTCTGATGAAAATGAGAGG - Intronic
1108267723 13:48729263-48729285 AGGTGTCTGATGGAGGTGGAGGG - Intergenic
1108626719 13:52236223-52236245 GGGTGTGGGAGGAAGATGGGTGG - Intergenic
1108659349 13:52570262-52570284 GGGTGTGGGAGGAAGATGGGTGG + Intergenic
1108688213 13:52839129-52839151 AGGTGTGTGAAGGGCATGGGAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112471244 13:99691734-99691756 AGGTGACTGCGGAAGAAGGGAGG - Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG + Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116289774 14:43018482-43018504 AGATGACTGAAGAGAATGGGGGG + Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117968890 14:61232994-61233016 CGGTGTCTGAAGAGTAGGGGTGG - Intronic
1118325869 14:64779981-64780003 AGATGAATGAAGAAGATGGAGGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1118988701 14:70778882-70778904 AGGTGTTCAAACAAGATGGGTGG - Intronic
1119900317 14:78253981-78254003 ATGTGGGTGAAGAAGATGGGTGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1121931840 14:97979233-97979255 AGTTGTCTGAGAAACATGGGTGG - Intergenic
1124857130 15:33400023-33400045 AGGAGTCAGAAGAAGAGGGGAGG - Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128502124 15:68233910-68233932 ATCTGGCTGAAGAAGCTGGGAGG + Intronic
1128613157 15:69089777-69089799 AGGGGTTTGAAGATGAAGGGAGG + Intergenic
1129323603 15:74788105-74788127 AAGTGTTTGAAGAAGAAGCGTGG + Intronic
1129785723 15:78308917-78308939 AGGTATGTGCAGAGGATGGGAGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132376668 15:101332623-101332645 AAATGTCTGCAGAAGCTGGGTGG + Intronic
1132517601 16:373112-373134 AGGTGTCTGATGGAGACTGGGGG - Intronic
1133856662 16:9555924-9555946 AGGCTTCTAAAGAAGATGGAAGG + Intergenic
1134323085 16:13181504-13181526 ATGTGTCTGGAGAAGTTGGTAGG + Intronic
1134397448 16:13878127-13878149 AGATGTCTGTTGAGGATGGGTGG - Intergenic
1134480508 16:14614897-14614919 AGGTGTCTGAAGGTGGTGTGGGG + Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136541216 16:30928485-30928507 AGGCACCTGAAGAAGGTGGGTGG + Exonic
1138389840 16:56662489-56662511 AGCTGCCTGAAGTGGATGGGAGG - Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141263566 16:82475536-82475558 AGGTGTCAGCAGCCGATGGGAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143751787 17:9033409-9033431 AGATGTCTGCAGAAGAAGTGAGG + Intronic
1144587332 17:16495130-16495152 AGGTCTCTGAAAAAGAGGAGAGG - Intergenic
1144633610 17:16889032-16889054 GGGTGTCTGAAGCAGAAGGACGG + Intergenic
1144850660 17:18242366-18242388 AGGCTTCTGTAGGAGATGGGTGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146461757 17:33051517-33051539 AGGAGTCTCAAGAAGATGCCAGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1147451301 17:40506418-40506440 AGGTGACTGATGAGAATGGGTGG + Intergenic
1148663701 17:49358850-49358872 GGGTGTCTGAAGAAGAGTGTTGG + Intronic
1149472095 17:56925256-56925278 GGGTGTCTGAATAGAATGGGAGG - Intergenic
1150944414 17:69729421-69729443 AAGTGTCTGAAGAAGGTGCTGGG + Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151129345 17:71880314-71880336 AGCTGCCAGAAGAAGATGAGGGG + Intergenic
1151227038 17:72655333-72655355 AGGTGATTGAAGAAGAGGAGAGG - Intronic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153907271 18:9673307-9673329 AGGTTTCTGAAGAACAAGTGTGG - Intergenic
1154308985 18:13253193-13253215 AGGTGACAGGAGAAGGTGGGAGG + Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156224581 18:35091637-35091659 AGGGGACTGCAGCAGATGGGTGG + Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156782181 18:40863741-40863763 AAGTGTTTGAAGAAGAAGGAAGG - Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160337060 18:78051497-78051519 AGGTGTCTGAGGAAGAGCGAGGG + Intergenic
1161200698 19:3013111-3013133 AGGGGTCTGGAGAAGATTTGGGG + Intronic
1162333522 19:10045731-10045753 TGGAGTCAGAGGAAGATGGGAGG + Intergenic
1164592396 19:29513817-29513839 ATGTGTAGGAAGGAGATGGGGGG + Intergenic
1165565770 19:36726469-36726491 AGGTGTCAGTAGAAGGTGAGTGG - Intronic
1167452964 19:49583205-49583227 AGGTGTCTGGAAAATATGAGGGG + Exonic
1167767653 19:51494961-51494983 AGGAGGATGAAGAGGATGGGAGG + Intronic
1168103119 19:54151601-54151623 ACGTGGCTGGAGGAGATGGGAGG + Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925495788 2:4447649-4447671 AGGTGTGTGAAGCAGAGGGAGGG - Intergenic
926742859 2:16126603-16126625 AGGTGTCCCAGGCAGATGGGTGG - Intergenic
927827070 2:26316480-26316502 GGCTGTCTGAAGAAGCTAGGTGG + Intronic
930933986 2:56924294-56924316 GAGTGTCTGAATAAGTTGGGAGG - Intergenic
932013973 2:68005675-68005697 AGGTGGCTGTAGTAGATGTGTGG - Intergenic
932194549 2:69772036-69772058 AGGGTTATGAAGAACATGGGTGG - Intronic
932714288 2:74090370-74090392 AGGTGTCCTGGGAAGATGGGGGG - Intronic
934525824 2:95050903-95050925 AATTGTGTGAAGAAGATGGAGGG - Intronic
935277326 2:101486198-101486220 GGCTGGCTGAAGAAGATGGAGGG - Intergenic
935310348 2:101777123-101777145 AAGTGACTGAAGAAGGTGTGTGG + Intronic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936499648 2:113055954-113055976 AGGGCTCAGAAGAAGATAGGAGG - Intergenic
936603343 2:113922303-113922325 AGGTCTCTGAAAAAGCTGGAGGG + Intronic
936641221 2:114314661-114314683 AGTTATCTGGACAAGATGGGAGG - Intergenic
937729592 2:125212384-125212406 AGATATCTGAATAAGATGGATGG - Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
938064296 2:128272765-128272787 TGGTTTCTGAAAAAGCTGGGAGG + Intronic
938405842 2:131032686-131032708 AGGTGTCTGGGGCAGATGAGGGG - Intronic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941028529 2:160485269-160485291 AGGGGTTTCAAGAAGATGGGAGG - Intronic
941085818 2:161116583-161116605 AGAGGTCTGGAGAAGATGTGAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944323780 2:198379139-198379161 AGATGTCTGAATAAGGTGAGGGG - Intronic
945494958 2:210498934-210498956 TGGTGTCTGAACAGGATGGGTGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946453487 2:219801068-219801090 TGGATTCTGAAGAGGATGGGTGG + Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946937284 2:224735468-224735490 AGGGGTCAGAAGAAGAAAGGAGG + Intergenic
947264651 2:228265233-228265255 AGATGACTGAAGAGAATGGGAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947934684 2:233993730-233993752 AGCTCTCTGAGGAAGATGGGGGG + Intronic
948441532 2:237993822-237993844 ATTTGTTTGAAGGAGATGGGTGG + Intronic
948574275 2:238939754-238939776 TGGTGACTGTAGATGATGGGTGG - Intergenic
948574374 2:238940329-238940351 TGGTGACTGTAGATGATGGGTGG - Intergenic
1168885985 20:1256353-1256375 TGATGTCTGAATAAGCTGGGTGG - Intronic
1168890493 20:1292810-1292832 AGGTGGCAGCAGAAAATGGGAGG - Intronic
1170427199 20:16246854-16246876 AGGTGTTTGAAGCACATTGGCGG - Intergenic
1171099019 20:22364838-22364860 AGGTGAGTGGAGATGATGGGTGG + Intergenic
1172689788 20:36782510-36782532 AGAGGTCTGAAGGAGATGTGGGG + Exonic
1173539215 20:43838706-43838728 AGGTGGGGGAAGAAGATGAGAGG + Intergenic
1174633934 20:51982645-51982667 AGATGGTAGAAGAAGATGGGAGG + Intergenic
1174854648 20:54031863-54031885 GGGTGTCTGAAAGAGATGGAGGG + Intronic
1175257337 20:57655325-57655347 AGGGGACTGGAGGAGATGGGAGG - Intronic
1175598192 20:60252415-60252437 AGGTGTCTGCAGCAGATGCAGGG + Intergenic
1175754574 20:61521392-61521414 AGGGATCGTAAGAAGATGGGAGG + Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178370207 21:32021121-32021143 AGGTGTCTGAAGAAGGTTGCAGG - Intronic
1178960450 21:37060026-37060048 AGGGGTATAAAGAATATGGGGGG - Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181665507 22:24393140-24393162 AGGCTTCTGAAGAAGATGTGGGG + Intronic
1182554576 22:31122387-31122409 AGGTGTCTGCAGAAGAGGAGGGG + Intergenic
1184428291 22:44425848-44425870 AGGGGATTGAAGAAGGTGGGAGG - Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949152854 3:791453-791475 GGGAGGCTGAAGAAGGTGGGAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949951956 3:9236582-9236604 AGGAGTAGGAAGAAGAGGGGGGG - Intronic
950312393 3:11969999-11970021 AGGTGTCAGAAGGAGGTGGATGG + Intergenic
950661620 3:14470226-14470248 AGGTGTTTGAAGTGGACGGGAGG - Intronic
950876879 3:16283640-16283662 AGTTGTCAGCAGAAGGTGGGAGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951123011 3:18950429-18950451 AGGTGTCTGAAGATGTTGCTTGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952867020 3:37861501-37861523 AGGAGTCTGAGGCAGATGGGTGG - Intergenic
953810651 3:46109553-46109575 TGGTGGCTAAACAAGATGGGGGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954587963 3:51753313-51753335 AGGTGACTGAACAGAATGGGAGG + Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960192032 3:114718207-114718229 AAGTGTTTGAAGAAACTGGGTGG - Intronic
960302168 3:116016472-116016494 AGATGTCTGAAGGAGCTTGGTGG + Intronic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
960735685 3:120777309-120777331 AGGAGTATGTAGAAAATGGGAGG + Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961466189 3:127083084-127083106 AGATGCCTGCAGAAGAAGGGGGG - Intergenic
961639545 3:128356517-128356539 AGATGTCAGGAGAGGATGGGAGG + Intronic
962197727 3:133378345-133378367 AGGTGTCTGATGGAGAAGGCAGG - Intronic
963712961 3:148768315-148768337 AGGTGTCAAAAGAAGCTGAGTGG + Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964868865 3:161291283-161291305 AGGTGTTTGTAGAAGAGGGTTGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
966042321 3:175507189-175507211 GGGTGTCTGGAGAAGAAGAGAGG - Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
968217444 3:196905425-196905447 TGGTGTCTGAAGTGGGTGGGGGG - Intronic
968379234 4:74815-74837 AGGTGACTGAATAGAATGGGAGG + Intronic
969206527 4:5651378-5651400 GGGTGGGTGAAAAAGATGGGTGG + Intronic
970088482 4:12374884-12374906 AGGAGGCAGAAGAAGGTGGGAGG - Intergenic
971327199 4:25654460-25654482 TGGTGTTGGGAGAAGATGGGTGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973759917 4:54106126-54106148 CTGTGTTTGGAGAAGATGGGAGG - Intronic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975045436 4:69797513-69797535 AGATGTCTAAAGTAGAGGGGAGG + Intergenic
976139212 4:81972686-81972708 AGGTGTCTGATAGAGAAGGGAGG + Intronic
977339705 4:95743239-95743261 AGGTAACTGAATGAGATGGGAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978500931 4:109409344-109409366 AGGGGTCTGAGGAAGCGGGGTGG - Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980675615 4:136075513-136075535 TGGTGTGTGGTGAAGATGGGAGG + Intergenic
981370677 4:143955467-143955489 AGGTTTCTGAAGCCCATGGGAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983817068 4:172144212-172144234 AGGTTTCTGAAGTAAATTGGTGG + Intronic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
985171553 4:187155338-187155360 AGGTGGCCAAAGATGATGGGTGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG + Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991488608 5:67163437-67163459 ATGTGTCTGACGATGGTGGGCGG - Exonic
991643511 5:68777530-68777552 AAGAGTGTGAAGAAGAGGGGAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992948885 5:81837475-81837497 AAGTGTCTGTAAAAGAAGGGAGG - Intergenic
993363089 5:87002119-87002141 TGGTGGATGAAGAAGATGGCTGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994760306 5:103843760-103843782 ATGTGTCTGAAGAAGTGGTGGGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994897228 5:105721680-105721702 AAGTGTCTGAGGCAGCTGGGGGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995079400 5:108030802-108030824 AGGTGTTTGAAAGAGATGGCAGG + Intronic
997170266 5:131712230-131712252 AGGTTTTTGAAGAAGAATGGGGG - Intronic
997593457 5:135090437-135090459 GGGTGTCTGAAGTACCTGGGTGG + Intronic
998152625 5:139765795-139765817 AGGGGTTTGCAGAAGATGCGGGG - Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000730198 5:164825685-164825707 TGGTGTCTACAGAAGATGGGAGG + Intergenic
1001156438 5:169276373-169276395 AGCTCTTGGAAGAAGATGGGAGG - Intronic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001209494 5:169796757-169796779 AGGAGTCAGGAGAAGATGGCTGG + Intronic
1001742810 5:174067927-174067949 AGGTGCCTGGAGACCATGGGTGG + Intronic
1002425213 5:179170888-179170910 AGGTGTCTGATGAACGTGGGAGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003281230 6:4693847-4693869 AGGTGGCTGAAGAAAAAGGAAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005939400 6:30549652-30549674 AGGTGTTTGAAGAGGAAAGGAGG - Intronic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006412878 6:33885508-33885530 AGGTGTCTGAATGAGGAGGGAGG - Intergenic
1006459801 6:34151720-34151742 GAGGGTCTGAGGAAGATGGGTGG - Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008619291 6:53256138-53256160 ATGTGTATGAAAAAGATTGGAGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1009871061 6:69452374-69452396 AAGTGTATGGACAAGATGGGTGG + Intergenic
1010196230 6:73242318-73242340 ATGTGACTGATGAAGGTGGGAGG + Intronic
1010987527 6:82442000-82442022 ACTTCTCTGGAGAAGATGGGGGG + Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012367238 6:98456883-98456905 AGGTGGCAGAAGAAGAGGAGGGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014538833 6:122649790-122649812 AGCTGTCTTCAGAAGATGGCAGG + Intronic
1014618990 6:123642275-123642297 AGGAGTTTGAAGCAGATGGAAGG + Intergenic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015117407 6:129664832-129664854 AGGTGGGTTAAGAGGATGGGTGG + Intronic
1015265205 6:131284730-131284752 AGGTTTATGAAGAAAATGGAAGG + Intergenic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015709117 6:136120479-136120501 AAGTGTCCTGAGAAGATGGGAGG + Intronic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016388280 6:143549705-143549727 AGGCGTGTGCAGAAGAAGGGAGG - Intronic
1017803214 6:157918080-157918102 ATGTGTCTGTAGCAGCTGGGTGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020210723 7:6156236-6156258 AGGTGTCTCAGGCACATGGGAGG + Intronic
1020476692 7:8603500-8603522 AGGGGTCTTAAGCAAATGGGTGG - Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022498798 7:30869794-30869816 AGGGGCCTGGAGAAGATGAGAGG - Intronic
1023418734 7:39955956-39955978 AAGAATCTGAAAAAGATGGGTGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024884345 7:54124683-54124705 AGCTATCTAAAGAAGATGGCAGG + Intergenic
1026191898 7:68136468-68136490 AGGAGGAGGAAGAAGATGGGAGG + Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1031513697 7:122677434-122677456 AGGTGCCTGAGGAGGACGGGTGG + Intronic
1032002883 7:128276699-128276721 AGGTGTCTAAGGAAGTGGGGGGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1034818192 7:154192807-154192829 AGGTGTTTGAAGCAGGTGGCGGG + Intronic
1035612444 8:977311-977333 AGCTGTCAGAAGAACATGGGAGG - Intergenic
1035885269 8:3284701-3284723 ATGTGTTTGAAGCAGATGGAAGG + Intronic
1037152779 8:15657604-15657626 AGGGCTCAGAAGAAGAGGGGAGG - Intronic
1037349726 8:17938960-17938982 AGGTGTCTGAAGAAGATGGGAGG + Exonic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037395743 8:18440870-18440892 GGGAGTCTGAATAAGATTGGTGG + Intergenic
1037802123 8:22041521-22041543 CGGTGACTGCAGAAGATAGGAGG - Intergenic
1038349823 8:26765685-26765707 AGGGCACTGAAGCAGATGGGAGG - Intronic
1041309499 8:56500971-56500993 AGGTGGCTGAAGCAGGAGGGTGG + Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045240693 8:100398495-100398517 CGGTGTCTGAAGGAGATGGCAGG - Intronic
1045325275 8:101113047-101113069 AGGTGTCTAAATAAGATGGTAGG + Intergenic
1045592937 8:103618622-103618644 AGGAATCAGAAGAAGAGGGGTGG - Intronic
1045792759 8:106004346-106004368 AGCTATCAGAAGAAGATGAGGGG + Intergenic
1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG + Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046773174 8:118136788-118136810 AGGAGACTGTAGAAGATGTGAGG + Intergenic
1047853381 8:128883273-128883295 GGGTGTCTCAGGAAGATGGGTGG - Intergenic
1048334315 8:133491623-133491645 AGGTGCCTGAAGGAGCTGAGGGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051778410 9:20660990-20661012 AGGAGTCAGCAGAAGAGGGGAGG + Intronic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1053143460 9:35696485-35696507 AGGTGTTAGTAGCAGATGGGTGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056638167 9:88348336-88348358 AGGTGGCTGAATACGGTGGGTGG - Intergenic
1057347189 9:94260772-94260794 AGGTGGGGGAAGAAGTTGGGTGG + Intronic
1057717825 9:97508876-97508898 TGGTGTCTTAAGAAGAAGAGTGG + Intronic
1057791257 9:98126678-98126700 AGCTGGCTGCAGAAGATGGCTGG - Exonic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058968187 9:110056165-110056187 AGGTGTGTGTAGAAGGTGTGAGG + Intronic
1060463818 9:123884523-123884545 ACAAGACTGAAGAAGATGGGGGG - Intronic
1060666565 9:125435533-125435555 AGGTCCATGAAGAAGCTGGGAGG + Intergenic
1060896049 9:127218309-127218331 AGGTGTGTGCAGAGGGTGGGTGG - Intronic
1061052523 9:128204734-128204756 GAGTTTCTGAAGAAGATGGGGGG - Intronic
1061911508 9:133727619-133727641 AGGTGTCAGAGGAACATGAGGGG + Intronic
1062099282 9:134719799-134719821 GCGTGTCTGAAGAAGGTCGGAGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062437302 9:136551983-136552005 ATGTGTCTGGAGCAAATGGGGGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189240821 X:39523033-39523055 AGGTGACTGAAGGAGATTGATGG - Intergenic
1189444332 X:41066839-41066861 AGGGGTCTGCAGAAGATATGCGG - Intergenic
1189609745 X:42719375-42719397 AGGTCCCTGAACAAGATGGAAGG + Intergenic
1190484959 X:50914729-50914751 AGATGTCTGAAGATGAGAGGTGG + Intronic
1190959037 X:55227348-55227370 AGGTCTCAGAAGAAGACAGGAGG + Intronic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193940959 X:87680662-87680684 AGGGTTCAGAAGAAGAGGGGAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195043513 X:101035296-101035318 AGGTGTCTGAAGTATTTGGAAGG - Intronic
1195605039 X:106796689-106796711 TGGTGTTTGAAAAAGAAGGGGGG + Exonic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196178168 X:112663073-112663095 AGGGGTCTGAAGAAGATGGAAGG - Intronic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1198617294 X:138473377-138473399 ACATTTCTAAAGAAGATGGGAGG + Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG + Intergenic
1199732769 X:150652934-150652956 AGATGTCTGAGGAAGTTAGGAGG + Intronic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200709922 Y:6474113-6474135 AGGTGTCTGCAAAAGATGGCTGG + Intergenic
1200962879 Y:9011220-9011242 GGGTGTCTGCAAAAGATGGCTGG - Intergenic
1200983581 Y:9284238-9284260 AGGTGTCTGAGGAAGCATGGGGG + Intergenic
1201024193 Y:9690595-9690617 AGGTGTCTGCAAAAGATGGCTGG - Intergenic
1202126790 Y:21575450-21575472 AGGTGCCTGAGGAAGCAGGGGGG - Intergenic
1202129362 Y:21596087-21596109 GGGTGTCTGTGGAAGATGGCCGG - Intergenic
1202150227 Y:21837561-21837583 GGGTGTCTGCAAAAGATGGCTGG + Intergenic