ID: 1037360460 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:18068652-18068674 |
Sequence | AGGATGTTTAGCAGTGTCCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 3008 | |||
Summary | {0: 8, 1: 68, 2: 253, 3: 1004, 4: 1675} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1037360460_1037360465 | 22 | Left | 1037360460 | 8:18068652-18068674 | CCAGGGACACTGCTAAACATCCT | 0: 8 1: 68 2: 253 3: 1004 4: 1675 |
||
Right | 1037360465 | 8:18068697-18068719 | AAAAAAGAGACACCCACCCCAGG | 0: 2 1: 0 2: 2 3: 18 4: 291 |
||||
1037360460_1037360467 | 27 | Left | 1037360460 | 8:18068652-18068674 | CCAGGGACACTGCTAAACATCCT | 0: 8 1: 68 2: 253 3: 1004 4: 1675 |
||
Right | 1037360467 | 8:18068702-18068724 | AGAGACACCCACCCCAGGCCGGG | 0: 2 1: 0 2: 4 3: 38 4: 411 |
||||
1037360460_1037360466 | 26 | Left | 1037360460 | 8:18068652-18068674 | CCAGGGACACTGCTAAACATCCT | 0: 8 1: 68 2: 253 3: 1004 4: 1675 |
||
Right | 1037360466 | 8:18068701-18068723 | AAGAGACACCCACCCCAGGCCGG | 0: 2 1: 0 2: 2 3: 29 4: 224 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1037360460 | Original CRISPR | AGGATGTTTAGCAGTGTCCC TGG (reversed) | Intronic | ||